Nikitin Lab Presentation: Crispr

knockout of Rb1Candace Chien

4.15.2016

Introduction

Figure 1: Ten leading cancer types for estimated deaths in 2010 (1)

• Ovarian cancer is the fifth leading cause of death among women, causing about 5% of deaths due to cancer in women.

• According to an analysis in 2010, over 21,000 women will be diagnosed per year, with an estimated 13,850 deaths.

• Ovarian cancer has a 5-year survival probability of only 37% (1).

Stag

e Di

strib

utio

n (%

)Distribution of Stages at Diagnosis for Ovarian, Esophageal, Stomach and Prostate Cancers (1)

• The majority of ovarian cancer diagnoses are made at late stage, after the cancer has already spread beyond the primary tumor site.

• Over 70% of deaths occur in patients presenting with advanced stage, high-grade serous ovarian cancer (2).Figure 2. Cancer Statistics 2010 (1)

Genetic Mutations in High Grade Serous Epithelial Ovarian Cancer

• The Cancer Genome Atlas study (2) of high grade SEOC patients revealed:• Mutations in p53 in at least 96% of tumors• Mutations in BRCA1 and BRCA2 in 22% of tumors• Deregulated Rb1 pathway in 67% of cases

• ~Overall survival rate for EOC with normal Rb pathway (77.3%) much higher than for patients with altered Rb pathway (50.0%) (3)

Rb1 is a negative regulator of the cell cycle.

• Rb1 plays important roles in G0-G1 transition, as well as G1-S transition.

• Phosphorylation of pRB by Cdk3 promotes transition from G0 to G1.

• Active, hypophosphorylated pRb sequesters E2F transcription factors, preventing S phase entry (4).

Figure 3. STEM Academy, Google Images

Objectives• We have previously shown that hilum cells mutant

for p53 and Rb1 showed increased proliferation and did not undergo senescence in cell culture (Flesken-Nikitin, et al. Ovarian surface epithelium at the junction area contains a cancer-prone stem cell niche. Nature 2013).

• Aim: To create a model of ovarian cancer by immortalizing primary cells via double CRISPR knockout of p53 and Rb1.• Step 1: Create a Crispr construct to knock out

p53 (which we already have) and Rb1.

Hypothesis: CRISPR Knockout of Rb1 will lead to increased cell proliferation.

• Cas9-gRNA complex causes double strand break at target gene sequence in Rb1, leading to frameshift mutation and knockout of gene function.Increased

proliferation

Figure 4. Addgene CRISPR Guide (5) Knockout of

Rb1

Accumulation of E2F transcription factors, inactivated p53

CRISPR/Cas9 • Clustered Regularly Interspaced Short Palindromic Repeats Type II

system originated from the bacterial immune system and has been harnessed and modified for large scale genome engineering

• A lentiviral vector is used to deliver the CRISPR/Cas9 system into mammalian cells.

• LentiCRISPR viral vector composed of:• 1) Cas9 endonuclease• 2) sgRNA scaffold• 3) Puromycin resistance gene for selection

Guide RNA sequence

Puromycin Resistance Gene

Cas9 EndonucleaseFigure 5. Source

(6)

Guide RNA DesignGoal: Target the promoter region of the gene or the first couple exonsCriteria for the gRNA sequence:

• Must be about 20 nucleotides long• Target is immediately upstream of a Protospacer Adjacent Motif

(PAM) sequence: NGG• Sequence is unique compared to the rest of the genome: low

probability of off-target activity

Figure 6. Source (7)Blue = TATA boxPink = PAM sequencesGreen = where mRNA transcript begins

Target SequencesgRNA Target Region Target Sequence Offtarget Activity ScoreRb1-KO1 Promoter - TATA box TAGCCCCGTTAAGTGCACCC 945/1000

Rb1-KO2Promoter - Major Transcription Initiation site as identified by Hong et al., 1989 CCCCAGTTCCCCACAGACGC 736/1000

Rb1-KO3 Exon 1 GGCGCTCCTCCACAGCTCGC 991/1000

Off-target activity predicted by CCTop Prediction Tool 2015 • Scores are out of 1000, with 1000 indicating the lowest likelihood

of off-target activity and lowest likelihood of potential deleterious effects

• Takes into account number of possible off-targets in the genome, the number of mismatches with respect to PAM, and distance to gene exons

• The off-target sites are ranked by decreasing likelihood of potential Cas9 activity (8)

Last semester: the link between Rb1 and p53

• Knockout of Rb1 leads to accumulation of transcription factor E2F1, which can act as a signal for p53 induced apoptosis (4)

Cell cycle arrest

E2F transcription factors sequestered

pRb - P

Cdk4

pRb

E2F transcription factors active

E2F1 Active

Entry into S

p19/ARF accumulation

Block Mdm2

p53 accumulation: p53 induced apoptosis

Growth signaling

Lentivirus Infection of HIO80s• Day 1:

• Thaw lentivirus tubes on ice.• Seed 10 cm plate with 100,000 cells/plate• Add 10 mL medium/plate and 2 tubes of thawed virus

• Day 2: Add 5 mL media and incubate for 72 hours

• Day 6: Change medium and de-contaminate. Begin puromycin selection.• Concentration of 2 microg puromycin/mL media

• Day 9: All cells on the control plate died – take the knockout plates off puromycin and return to normal media.

Day 6 of Recovery after End of Puromycin treatment

HIO80pCW infection

4X

4X4X

4X

HIO80Rb1LV2 infection

HIO80Rb1LV1 infection

HIO80Rb1LV5infection

Morphology Changes

• After 2 or so passages, the knockouts started to look a bit different from the control cells.

• They had longer and more extensions, and skinnier cell bodies.

pcW vs. Rb1LV1

HIO80 pcW, p.2 4X

HIO80 Rb1LV1, p.24X

pcW vs. Rb1LV2

HIO80 pcW, p.24X

HIO80 Rb1LV2, p.24X

pcW vs. Rb1LV3

HIO80 pcW, p.24X

HIO80 Rb1LV2, p.24X

Western Blot analysis• Cell lysate was obtained with RIPA buffer.• Protein concentration was determined by BCA protein assay.• 15 μg total protein was loaded per well.• Rb1:

• Primary Antibody: Purified Mouse Anti-Human Retinoblastoma Protein, BD Biosciences, Concentration 2 μg/mL, 10% BSA• Secondary Antibody: Anti-Mouse, IgG-HRP, Dilution 1:2000, 3% BSA

• GAPDH• Primary Antibody: Goat Polyclonal GAPDH (V-18), Santa Cruz Biotechnology, 1:2000 dilution, 5% milk• Secondary Antibody: Anti-Goat IgG-HRP, 1: 2000 dilution, 1% milk

Western Blot Results

Conclusion: My constructs did not work.

ppRb (116 kDa)pRb (110 kDa)

130 kDa

110 kDa

pcW Rb1 LV1

Rb1 LV2

Rb1 LV3Null

40 kDaGAPDH

Where to go from here?

• I have about 5 other Rb1 constructs to test (I only tested the ones targeting the promoter region).

• These other constructs target exons instead of the promoter region and 2 of them were made with a different online tool (the Zhang lab tool).

Thank you to everyone in the Nikitin Lab!

Questions?

References1. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin 2010;60:277–300.

2. The Cancer Genome Atlas Research Network, Integrated genomic analyses of ovarian carcinoma. Nature 2011; 474:609–15.

3. Hashiguchi Y, Tsuda H, Inoue T, Nishimura S, Suzuki T, Kawamura N. Alteration of cell cycle regulators correlates with survival in epithelial ovarian cancer patients. Hum Pathol 2004; 35: 165–75.

4. Nevins J. The Rb/E2F pathway and cancer. Human Molecular Genetics 2001, Vol. 10, No.7.

5. https://www.addgene.org/CRISPR/guide/

6. https://www.addgene.org/static/cms/files/Zhang_lab_LentiCRISPR_library_protocol.pdf

7. Hong F, Huang H, To H, Young L, Oro A, Bookstein R, Lee E, Lee W. Structure of the human retinoblastoma gene. PNAS 1989, Vol. 86, 5502-5506.