Concept Presentation:

DeoxyriboNucleic Acid

Stuart Lithwick

http://www.google.ca/imgres?imgurl=http://library.thinkquest.org/07aug/00775/dna.jpg&imgrefurl=http://library.thinkquest.org/07aug/00775/&usg=__gf9gT6BlZvx5BLkpmyB_RXSTbIY=&h=320&w=320&sz=30&hl=en&start=19&sig2=9G_ooEWlaxdRIRxdMJqA2Q&um=1&itbs=1&tbnid=bcdTHsoIeOWNNM:&tbnh=118&tbnw=118&prev=/images%3Fq%3DDNA,%2Bphoto%26um%3D1%26hl%3Den%26sa%3DX%26tbs%3Disch:1&ei=IAI9TJynK9KQnAf_n4neDg

DNA is the recipe for all life on earth...

present and past!

http://www.csb.yale.edu/userguides/graphics/ribbons/help/dna_rgb.gif

Miller et al., 2008

Why is DNA important to us?

• DNA are the instructions used to build all living things (including us)!

• The Future of Medicine Genetic Medicine!• Ethical discussions!

Why may DNA be important to our students?

• DNA is everywhere!!– News: Human Genome Project! Stem Cell Research!– Public Media: e.g. Television, Radio,

Internet!– Ethics!

• Careers in Medicine and Genetics

Why do our students care about DNA?

• DNA is an ongoing Toronto story!

–World-class DNA-based research is happening...

RIGHT HERE!!!

Our students need to have the tools to think critically!

• The world is changing faster than ever...

• We need to give our students the tools to be ready!

DNA in the Ontario Curriculum

Grades 17 Grade 8

Structure & Function in Plants

and AnimalsThe Cell

3.2, 3.3

DNA in the Ontario Curriculum

Grade 10 Science (Academic) (SNC2D)

Cells &

Tissues

Cell Cycle &

Mitosis

B3.2 B2.2, B3.1

DNA in the Ontario Curriculum

Grade 10 Science (Applied) (SNC2P)

Cells &

TissuesCell Cycle

B3.2 B3.1

DNA in the Ontario Curriculum

Grade 11 Biology (Academic) (SBI3U)

Introduction to DNA &

GenesMeiosis

D3.2 D3.1

DNA in the Ontario Curriculum

Grade 12 Biology (Academic) (SBI4U)

DNA Structure In-Depth

Molecular Biology

B3.2 D3.1, D3.2, D3.3, D3.6

DNA in the Ontario Curriculum

Grade 12 Biology (Academic) (SBI4U)

DNA Replication

Transcription &

Translation

D3.1 D3.2, D3.3

Today’s Concept Presentation:

DNA Structure

A little from Column A, a little from Column B...

Grade 12 Biology (Academic) (SBI4U)

Grade 11 Biology (Academic) (SBI3U)

D3.2 B3.2

Misconceptions1) Since cells are small, the amount of DNA in each cell is not large.

2) DNA looks like a double-helix when it is examined either under a microscope or with the naked eye.

Challenges1) Making students comfortable with the structure of the DNA molecule (Can be complex)

2) Maintaining accuracy while writing out DNA sequences

3) Calculating the frequency of bases within DNA sequences. (Numeracy)

HERE WE GO!

Where are we going?

The Animal Cell: A Diagnostic

DNA: The Recipe Book of Life

Lesson 1

Where are we going?

Playing with DNA:

Detailed Structure of the DNA Molecule

Lesson 2

Where are we going?

Counting Bases:

Nucleotide Frequency within DNA Molecules

Lesson 3

Where are we going?

Let’s Become DNA!

Lab: Extracting DNA from Bananas

Lesson 4

Where are we going?

The Grand Finale!

The Inevitable DNA Thinking Problem

Lesson 5

How are we getting there?Alternative

Approaches to DNA Modeling

DNA Sequence Manipulatives

Interactive Dramatic Activities

Laboratory Activities

How are we making sure everyone is on track?

Assessment for learning

Assessment of learning

Diagnostic Activities

Drawing of DNA Models

Nucleotide Frequency Practice Problems

Assembly of DNA Models

How are we making sure everyone has made it?

Summative Evaluation

The Inevitable DNA Thinking Problem

HERE WE GO!

Lesson 1

The Animal Cell: A Diagnostic

DNA: The Recipe Book of Life

The Animal Cell: A Diagnostic

• The Goal: To assess who in the class remembers the structures of an animal cell (From Grade 8)

• Most important part: The Nucleus!

The Animal Cell: A Diagnostic

• The Approach:– Hand out blank sheets of paper

– Ask students to draw an animal cell with as much detail as possible

The Animal Cell: A Diagnostic

• The Approach:– Have peers exchange papers and

mark– Select one student to draw the

animal cell on the board with help from peers

The Animal Cell: A Diagnostic

• The Approach:– Collect all of the papers as

students exit class

- Assessment for learning!

DNA: The Recipe Book of Life

• The Goal: To introduce DNA as the recipe book of life in a creative way

• Achieved using analogies!

DNA: The Recipe Book of Life

+ =

+ =

DNA: The Instructions for Building Life

+ =

+ =

So how much DNA is there really per

cell?

What is the total length of DNA in every cell?

2 metres10 trillion cells

per body

What is the total length of DNA in the entire human body?

Enough to travel from earth to the sun and back 35X!

1 Billion km!

Take home messages from lesson 1!

• DNA is found in the nucleus.

• DNA are the instructions for life.

• There is an enormous amount of DNA in every cell.

Lesson 2

Playing with DNA:

Detailed Structure of the DNA Molecule

Structure of the DNA Molecule

• Challenge: Help students become comfortable with the structure of the DNA molecule...• How?

• Magnetics & Manipulatives!

Magnetics & Manipulatives!

• Teacher – Uses magnetics on the board

• Students – Use sets of manipulatives at their desks.

Concepts Taught

• DNA is a double-stranded molecule

• DNA is made up of 4 types of compounds called nucleotides–A, G, C, T – A binds T and G binds C

Concepts Taught

• Each nucleotide is made up of 3 parts:

Sugar

BaseP Shapes reduce the complexity of the molecules... Can be less intimidating... But still have function!

Assessment for Learning:Building DNA Models!

1) CanDNA – Candy DNA2) BeaDNA – Bead DNA3) Origami DNA

Let`s try it out!

1) CanDNA

• Advantages: - Great for kinaesthetic learners and visual learners (colourful)

- Includes all parts of the DNA molecule

- Fun!

- Edible!

2) BeaDNA

• Advantages: - Also great for kinaesthetic learners and visual learners (colourful)

• Disadvantages:

- Not as detailed (just backbone and bases)

- Much smaller

3) Origami DNA

• Advantages: - Great for kinaesthetic learners and visual learners (colourful)

• Disadvantages:

- Much more difficult- Takes a much longer time

Exit Key Assessment of Learning:Drawing of the DNA Models

• Students have to:

1) Sketch the DNA molecules that they have built and label parts discussed in class.

2) Answer the question: It is often said DNA resembles a ladder. Explain using information learned in class.

- Collected at the end of class...- Why both? Differentiated assessment!

Lesson 3

Counting Bases:

Nucleotide Frequency within DNA Molecules

But first!

Diagnostic Assessment of Learning

• Students are asked to answer one of two questions:

1) What would be the sequence of the opposite strand for the following DNA molecule?

2) Identify the mistakes present in the following DNA molecule. Why are these mistakes?

• Assessments are evaluated by peers, as students complete questions on the board

Nucleotide Frequency in DNA

• Challenge: Help students become more comfortable with nucleotide frequency calculations.

• How?

• Back to Manipulative kits!

Example question:

• What is the frequency of G in the following double-stranded DNA sequence.

GATTCAGCAGTCACTAAGTCGTCAGT

Try it out!

Example question:

• What is the frequency of G in the following double-stranded DNA sequence.

GATTCAGCAGTCACTAAGTCGTCAGT

6 Gs out of 26 bases = 23% G

The Teaching Approach:

• Example Question 1) Teacher demonstrates approach to solving, Students follow.

• Example Question 2) Students attempt question independently. Student takes up the question (with teachers help as needed).

• Example Question 3) Student demonstrates approach to solving with help from others. Students follow.

The Reason:

• Quickly puts the power in the hands of the students

• Lets students take responsibility for their own learning

Assessment for Learning – Practice Problems

• 5- question problem set completed independently in class

• Collected as an exit key

Lesson 4

Let’s Become DNA!

Lab: Extracting DNA from Bananas

Extracting DNA from Bananas!

• This lab lets students see actual DNA from bananas with the naked eye!

• No harmful chemicals, and a simple approach.

Lab Safety

• Note: Students must be briefed on WHMIS, and lab safety

procedures before the lab begins.

The Approach: Become DNA while extracting Banana DNA!

• Begin the Banana lab...

• While the Banana DNA is being filtered in the refrigerator...

Become DNA!

Assessment of Learning: Becoming DNA!

• Students, given a base, phosphate, or sugar, must assemble themselves into DNA in under 2 minutes!

• Inter-class competitions for best time!

Option: DNA Frequency!

• 2 students must figure out nucleotide frequencies in the DNA assembled by their classmates!

Advantages:

• Great for the kinesthetic learners!• Fosters cooperation and teamwork!• Allows students to connect with the

DNA molecule at a different level!• A lot of fun!

Lesson 5

The Grand Finale!

The Inevitable DNA Thinking Problem

Summative AssessmentThe DNA Thinking Problem!

• Approach: Present in a way that students have never seen before.

• Should incorporate as much of the information covered as possible.

Summative AssessmentThe DNA Thinking Problem!

• e.g. The nucleotide frequencies in a DNA molecule are 11% G, 44% T, 44% A, and 11% C. Draw a DNA molecule of 24 bp or

more, which fits these characteristics. Include all parts of nucleotides as drawn in class.

Applications & Societal Implications

• Ethics of access to DNA information (To Know or not to Know)

• Cloning

• Stem Cells

• Gene Therapy

Concept Presentation:

Questions?

Stuart Lithwick

http://www.google.ca/imgres?imgurl=http://library.thinkquest.org/07aug/00775/dna.jpg&imgrefurl=http://library.thinkquest.org/07aug/00775/&usg=__gf9gT6BlZvx5BLkpmyB_RXSTbIY=&h=320&w=320&sz=30&hl=en&start=19&sig2=9G_ooEWlaxdRIRxdMJqA2Q&um=1&itbs=1&tbnid=bcdTHsoIeOWNNM:&tbnh=118&tbnw=118&prev=/images%3Fq%3DDNA,%2Bphoto%26um%3D1%26hl%3Den%26sa%3DX%26tbs%3Disch:1&ei=IAI9TJynK9KQnAf_n4neDg