Malin [email protected]
Quality Control of NGS data
FastQ files
@HWUSI-EAS100R:6:73:941:1973#0/1GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT+!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
1st row: sequence identifier (machine ID, x-y coordinates, additional info)2nd row: The actual sequence3rd row: starts with “+” and optionally the same identifier as in the 1strow4th row: Quality score for each base in read
Phred Quality Scores
FastQC
Bad qualities: Good qualities:
• Different NGS application have their own problem areas and requires their own QC strategy
• Today: Focus on QC for whole genome sequencing
• For variant calling it is important to look at quality score distribution, sequence length distribution and duplication levels.
• Thursday: More details on QC for RNA-seq
What is QC?
FastQC
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Top Related