of October 21, 2011This information is current as

http://www.jimmunol.org/content/187/7/3821doi:10.4049/jimmunol.1101195September 2011;

2011;187;3821-3830; Prepublished online 2J Immunol Mauro Martins Teixeira and Tarcília Aparecida da SilvaGustavo Pompermaier Garlet, Danielle da Glória de Souza, Rafaela Leal Costa Bessoni, Larissa Fonseca da Cunha Sousa,Madeira, Fernanda Matos Coelho, Vivian Vasconcelos Costa, Celso Martins Queiroz-Junior, Mila Fernandes Moreira Oral Microbiota

and theαDisease in Mice: Involvement of TNF-Experimental Arthritis Triggers Periodontal

References http://www.jimmunol.org/content/187/7/3821.full.html#ref-list-1

, 9 of which can be accessed free at:cites 45 articlesThis article

Subscriptions http://www.jimmunol.org/subscriptions

is online atThe Journal of ImmunologyInformation about subscribing to

Permissions http://www.aai.org/ji/copyright.html

Submit copyright permission requests at

Email Alerts http://www.jimmunol.org/etoc/subscriptions.shtml/

Receive free email-alerts when new articles cite this article. Sign up at

Print ISSN: 0022-1767 Online ISSN: 1550-6606.Immunologists, Inc. All rights reserved.

by The American Association ofCopyright ©2011 9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

The Journal of Immunology

Experimental Arthritis Triggers Periodontal Disease in Mice:Involvement of TNF-a and the Oral Microbiota

Celso Martins Queiroz-Junior,*,†,‡ Mila Fernandes Moreira Madeira,†,‡

Fernanda Matos Coelho,‡ Vivian Vasconcelos Costa,† Rafaela Leal Costa Bessoni,*,‡

Larissa Fonseca da Cunha Sousa,‡ Gustavo Pompermaier Garlet,x

Danielle da Gloria de Souza,† Mauro Martins Teixeira,‡ and Tarcılia Aparecida da Silva*,‡

Rheumatoid arthritis (RA) and periodontal disease (PD) are prevalent chronic inflammatory disorders that affect bone structures.Individuals with RA aremore likely to experience PD, but how disease in joints could induce PD remains unknown. This study aimedto experimentally mimic clinical parameters of RA-induced PD and to provide mechanistic findings to explain this association.Chronic Ag-induced arthritis (AIA) was triggered by injection of methylated BSA in the knee joint of immunized mice. Anti–TNF-a was used to assess the role of this cytokine. Intra-articular challenge induced infiltration of cells, synovial hyperplasia,bone resorption, proteoglycan loss, and increased expression of cytokines exclusively in challenged joints. Simultaneously, AIAresulted in severe alveolar bone loss, migration of osteoclasts, and release of proinflammatory cytokines in maxillae. Anti–TNF-atherapy prevented the development of both AIA and PD. AIA did not modify bacterial counts in the oral cavity. PD, but not AIA,induced by injection of Ag in immunized mice was decreased by local treatment with antiseptic, which decreased the oralmicrobiota. AIAwas associated with an increase in serum C-reactive protein levels and the expression of the transcription factorsRORg and Foxp3 in cervical lymph nodes. There were higher titers of anti-collagen I IgG, and splenocytes were more responsiveto collagen I in AIA mice. In conclusion, AIA-induced PD was dependent on TNF-a and the oral microbiota. Moreover, PD wasassociated with changes in expression of lymphocyte transcription factors, presence of anti-collagen Abs, and increased reactivityto autoantigens. The Journal of Immunology, 2011, 187: 3821–3830.

T he association between autoimmune rheumatic diseasesand chronic infectious periodontal disease (PD), theleading cause of tooth loss in humans, has been studied

since the 1960s (1); however, it has received increasing attentionlately (2–5). Data from several clinical studies suggested a po-tential relationship between these disorders and indicated thatindividuals with rheumatoid arthritis (RA) are more likely to ex-perience periodontal problems compared with healthy counter-parts (2, 3, 6–13). The major unanswered question is how auto-immune diseases that tend to affect one or few parts of the body(e.g., joints) could interfere with PD.The clue to understanding this association seems to rely on the

pathogenic features shared by RA and PD. The etiologies of RA and

PD are distinctly different: one is autoimmune, and the other is in-fectious. However, they share several common features, includinginfiltration of inflammatory cells; release of key cytokines, such asTNF-a, in affected tissues; and bone destruction. Thus, in line withthese similarities, a “two-hit” model was suggested, in which thecommensal oral biofilm (first “hit”) may interact with bone-destructive diseases in another location in the body (second “hit”)to induce PD (14). Other investigators hypothesized that a causalpathway (RA triggers PD and vice versa) and a noncausal pathway(involving genetic, environmental, and behavioral factors) exist (3).Both models are plausible but lack convergent data to support them.The majority of existing studies are low-prevalence case-controltrials that vary with respect to design, setting, and methods to as-certain the association (6–10, 15). Mechanistic studies are warranted,and the use of experimental models could be suitable in this way.In rats, induction of arthritis by injection of adjuvant was associated

with spontaneous loss of alveolar bone and increased levels of IL-1b,TNF-a, and metalloproteinases in gingival tissues (16). Tromboneet al. (4) used a pristane-induced model of RA in mice to show thata hyperinflammatory genotype was essential to aggravate bacteria-induced PD. Park et al. (5) demonstrated that alveolar bone cellsfrom collagen-induced arthritic mice had increased osteoclastic anddecreased bone-forming activity, and these findings were associatedwith oral bone loss. In this study, we developed a model of chronicAg-induced arthritis (AIA) in mice to evaluate the effects of arthritisinduction in the spontaneous development of PD and investigatedthe potential contribution of the oral microbiota and TNF-a to PD.

Materials and MethodsAnimals

Experimental groups consisted of 6-wk-old male C57BL/6mice maintainedin the animal facilities of the Department of Microbiology, Instituto de

*Departamento de Clınica, Patologia e Cirurgia Odontologicas, Faculdade de Odon-tologia, Universidade Federal de Minas Gerais, Minas Gerais, Brazil, CEP 31.270-901; †Departamento de Microbiologia, Instituto de Ciencias Biologicas, UniversidadeFederal de Minas Gerais, Minas Gerais, Brazil, CEP 31.270-901; ‡Departamento deBioquımica e Imunologia, Instituto de Ciencias Biologicas, Universidade Federal deMinas Gerais, Minas Gerais, Brazil, CEP 31.270-901; and xDepartamento de Cien-cias Biologicas, Faculdade de Odontologia de Bauru, Universidade de Sao Paulo, SaoPaulo, Brazil, CEP 17.012-901

Received for publication April 25, 2011. Accepted for publication August 1, 2011.

This work was supported by Conselho Nacional de Desenvolvimento Cientıfico eTecnologico and Fundacao do Amparo a Pesquisas do Estado de Minas Gerais.

Address correspondence and reprint requests to Prof. Tarcılia Aparecida da Silva,Departamento de Clınica, Patologia e Cirurgia Odontologicas, Faculdade de Odon-tologia, Universidade Federal de Minas Gerais, Avenida Presidente Antonio Carlos6627, CEP 31.270-901, Belo Horizonte, Minas Gerais, Brazil. E-mail address: tarcilia@ufmg.br

Abbreviations used in this article: AIA, Ag-induced arthritis; CMC, carboxymethyl-cellulose; LN, lymph node; mBSA, methylated BSA; MPO, myeloperoxidase; NAG,N-acetylglucosaminidase; OPG, osteoprotegerin; PD, periodontal disease; RA, rheu-matoid arthritis; TB, toluidine blue; TRAP, tartrate-resistant phosphatase.

Copyright! 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1101195

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

3822 ARTHRITIS-INDUCED PERIODONTITIS IN MICE

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

Ciencias Biologicas, Universidade Federal de Minas Gerais. Mice werehoused under standard conditions and had free access to commercial chowand water. All animal experiments were performed according to a protocolapproved by the local Institutional Committee for Animal Care and Use(protocol number: 165/2009).

Chronic AIA

Chronic AIA was induced, as described earlier (17). C57BL/6 mice wereimmunized on day 221 with a s.c. injection of 100 mg methylated BSA(mBSA; Sigma-Aldrich, St. Louis, MO) in 50 ml PBS emulsified in 50 mlCFA (Sigma-Aldrich) and supplemented with 4 mg/ml heat-killed Myco-bacterium tuberculosis strain H37RA (Difco, Detroit, MI). Further im-munization was performed on day 214 with mBSA in IFA (Sigma-Aldrich). In parallel with each Ag-specific immunization, 200 ng Borde-tella pertussis toxin (Calbiochem, La Jolla, CA) was injected i.p. The firstchallenge with Ag was performed on day 0 by injecting 100 mg mBSA in20 ml PBS into the left knee joint. Thirty days later, mice were rechal-lenged by a second intra-articular injection with 100 mg mBSA in 20 mlPBS; knee joints, maxillae, spleen, serum, and inguinal and submandibularlymph nodes (LNs) were analyzed at various time points after thisrechallenge (7, 14, 21, 28, 45, and 60 d). Negative controls included micewith systemic mBSA immunization (following the protocols describedabove) but challenged with PBS injection in knee joints, as well as naivemice. Because no difference was observed between these negative controlgroups in any of the evaluated parameters, they were grouped as control.

Experimental PD

Infectious PD was induced in a group of mice, as previously described (18),to compare this infection-induced PD with the AIA-induced PD. Experi-mental PD was achieved by oral delivery of 1 3 109 CFU culture of theperiodontopathogen Aggregatibacter actinomycetemcomitans Y4 (anaero-bically grown in supplemented agar medium, tryptic soy broth) in 100 mlPBS with 1.5% carboxymethylcellulose (CMC), placed in the oral cavityof mice with a micropipette at days 0, 2, and 4. Mice were killed at dif-ferent time points (7, 14, 30, 45, and 60 d postinfection) for morphometricevaluation of maxillae.

Anti–TNF-a therapy

To evaluate the role of TNF-a in AIA-induced PD, mice were subjected toAIA and treated with infliximab, 10 mg/kg, i.p. (Remicade; Schering-Plough, Kenilworth, NJ), a chimeric monoclonal anti–TNF-a Ab, every2 d after AIA rechallenge (19, 20). Knee joints, maxillae, and serum ofmice were evaluated 14 d later.

Oral antimicrobial therapy

To investigate the effects of oral microbiota on AIA-induced PD, an ad-ditional group received topical delivery of 50 ml chlorhexidine (1-chlo-rhexidine gluconate 0.12%), an antiseptic agent, plus 2% CMC (4).Chlorhexidine was applied in the mouth of mice every 2 d after AIArechallenge until day 14, when animals were killed and the maxillae werecollected for evaluation of alveolar bone loss, myeloperoxidase (MPO),and quantification of bacterial load by real-time PCR. The control groupreceived 50 ml aqueous CMC with a similar protocol.

Knee joint evaluation

At the indicated time points, five mice/group were killed, and the kneecavity was washed with PBS (2 3 5 ml). The total number of leukocyteswas counted in a Neubauer chamber. Differential counting was obtainedfrom cytospin preparations (Shandon III; ThermoShandon, Frankfurt,Germany) stained with May–Grunwald–Giemsa. After PBS wash, theperiarticular tissue was removed from the joint and used for immu-noenzymatic assays.

Knee joints of five mice per group were also collected for histologi-cal evaluation. Samples were fixed in 10% buffered formalin (pH 7.4),decalcified for 30 d in 14% EDTA, embedded in paraffin, sectioned, andstained with H&E or toluidine blue (TB). Two sections/knee joint weremicroscopically examined by a single pathologist (T.A.S.) and scored ina blind manner for different parameters, as follows: severity of synovialhyperplasia, intensity and extension of inflammatory infiltrate, and boneerosion. The grades were summed to obtain an arthritis index (rangingfrom 0 to 8) (21). TB-stained slides were used to estimate joint pro-teoglycan content, as described previously (22). Images of the joint surfaceof each sample were digitalized and evaluated using Image J software(National Institutes of Health, Bethesda, MD). Cartilage proteoglycancontent is reported as the percentage of the TB-stained area in relation tothe total evaluated cartilage surface.

Morphometric evaluation of maxillae

The maxillae of mice killed for knee joint evaluation were collected andanalyzed, as previously described (18). Maxillae were hemisected, exposedovernight in 3% H2O2, mechanically defleshed, and stained with 0.3%methylene blue. The palatal faces of the molars were photographed usinga stereomicroscope and a digital camera (Kodak EasyShare C743; Kodak,Manaus, Brazil). Quantitative analyses included the measurement of thearea between the cemento-enamel junction and the alveolar bone crest inthe first molar using ImageJ software. Samples were evaluated by a singleblinded examiner (M.F.M.M.).

In further experiments, the left hemimaxillae were collected, frozen at270˚C, and used for immunoenzymatic assays. The corresponding righthemimaxillae were fixed in 10% buffered formalin (pH 7.4), decalcified for15 d in 14% EDTA, embedded in paraffin, and sectioned. These sectionswere stained for tartrate-resistant acid phosphatase (TRAP; Sigma-Aldrich) for histological osteoclast counting in the coronal two thirds ofthe distal alveolar bone adjacent to the first molar in five consecutivemicroscopic fields (3400)/section. Three distinct sections were analyzed.Samples were analyzed using an Axioskop 40 microscope (Carl Zeiss,Gottingen, Germany), attached to a digital camera (PowerShot A620;Canon, Tokyo, Japan), by a single blinded examiner.

Quantification of neutrophil and macrophage enzymes

Quantification of MPO, a neutrophil enzyme marker, and N-acetylgluco-saminidase (NAG), a macrophage enzyme marker, was performed as de-scribed earlier (23). MPO and NAG activities in homogenized knee joint andmaxillary tissues (upper molars, alveolar bone, and buccal and palatal gin-gival tissues) were evaluated by enzymatic reaction, measured by absor-bance at 450 nm. The MPO and NAG contents were expressed as relativeunits calculated from standard curves based on MPO and NAG activitiesfrom 5% casein peritoneal-induced neutrophils and 3% thioglycollateperitoneal-induced macrophages, respectively, assayed in parallel.

Protein extraction and ELISA

The concentrations of IL-1b, IL-6, IL-17, IL-10, IFN-g, TNF-a, tumorgrowth factor-b, RANKL, and osteoprotegerin (OPG) were measured inknee joint, maxillary tissues, and serum using commercially available kits,according to the manufacturer’s instructions (R&D Systems, Minneapolis,MN). The results were expressed as picograms of cytokines (6 SEM)normalized for 100 mg tissue.

Real-time PCR

The extraction of total RNA from inguinal and submandibular LNs wasperformed with TRIzol reagent (Invitrogen, Rockville, MD), and the cDNAsynthesis was accomplished as described earlier (18). To allow quantifi-cation of the bacteria present in the oral biofilm, the extraction of bacterialDNA was performed from maxillary tissues, which were frozen in liquid

FIGURE 1. Chronic AIA in mice. Immunized mice were rechallenged with mBSA, treated with vehicle or infliximab (10 mg/kg/day, i.p.), and knee jointparameters were evaluated at different time points (7, 14, 21, 28, 45, and 60 d). Representative H&E images of control (A), AIA (14 d) (B), AIA (28 d) (C),and AIA (14 d)+infliximab (D) mice. The corresponding right panels show a higher magnification of the indicated area in the left panels. AIA (14 d) group(B) presented histopathological evidence of joint inflammation (inflammatory infiltrate, synovia hyperplasia [arrows in the higher-magnification photo-micrographs], alteration of tissue architecture) compared with the other groups (A, C, D). E–H, Representative TB-stained samples of the same groups showthe proteoglycan loss induced by AIA (14 d) (arrows). Other parameters were evaluated as follows: I, kinetics of AIA with regard to the arthritis index(described in Materials and Methods); J, quantification of proteoglycan loss; counting of total leukocytes (K) and mononuclear cells (L) in the synovialcavity; and NAG (M), MPO (N), IL-1b (O), and TNF-a (P) levels in periarticular joint tissues. Experiments were performed on five mice in each group.*p , 0.05, versus control; #p , 0.05, versus AIA (14 d). Fe, femur; Pa, patella.

The Journal of Immunology 3823

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

nitrogen, mechanically fragmented and homogenized in sterile Milli-Qwater, and subsequently submitted to DNA extraction with DNA Purifi-cation System (Promega Biosciences, San Luis Obispo, CA). Real-timePCR quantitative mRNA or DNA analyses were performed in a Mini-Opticon system (Bio-Rad, Hercules, CA), using SYBR Green PCR MasterMix (Invitrogen), 100 nM specific primers, and 2.5 ng cDNA or 5 ng DNAin each reaction. Primer sequences and reaction properties are shownin Table I. For mRNA analysis, the relative level of gene expressionwas calculated with reference to b-actin using the cycle thresholdmethod. Bacterial DNA levels were determined using the cycle thresholdmethod and normalized to the mean value of the control group, whichwas set as 1.

Detection of serum anti-collagen I Abs

The estimation of anti-collagen I total IgG in serum of mice was determinedas described earlier, with some modifications (24). Ninety-six–wellmicroplates were incubated overnight at 4˚C with 100 ml/well of 20 mg/mlsolution of murine collagen I (kind gift of Dr. G.T. Kitten, UniversidadeFederal de Minas Gerais) diluted in PBS. The plates were washed withPBS/0.05% Tween, blocked with 5% dry milk, incubated for 1 h at roomtemperature, and washed. Serial serum dilutions (1:2–1:100) were in-cubated for 1 h at 37˚C, washed, and incubated for 1 h at 37˚C with 100 mlbiotinylated goat anti-mouse IgG (Southern Biotechnology, Birmingham,AL). After washing, 100 ml/well streptavidin-HRP was added and in-cubated at room temperature for 20 min. The wells were washed, and 100ml/well substrate buffer (o-phenylenediamine dihydrochloride; Sigma-Aldrich) was added and incubated for 20 min at room temperature. Theenzymatic reaction was stopped by 1 M H2SO4, and the absorbance wasmeasured at 492 nm. Results are expressed as OD.

Spleen cell cultures

The protocol used for stimulation of cell cultures with collagen was adaptedfrom Berg et al. (25). Whole-spleen cells from individual mice wereharvested 14 d after AIA rechallenge and cultured in triplicate in 96-wellplates at 106 cells/ml in the presence of collagen I 15 mg/well, Con A 2 mg/well, or culture medium (RPMI 1640, Flow Laboratories, Irvine, U.K.).Culture supernatants were collected at 48 h, and cytokines levels weredetermined by ELISA, as described above.

C-reactive protein

Quantification of C-reactive protein levels was determined in serum samplesusing a commercially available agglutination kit, according to the manu-facturer’s instructions (Labtest Diagnostica, Sao Paulo, Brazil).

Statistical analysis

Data are presented as mean 6 SEM, and the statistical significance amongcontrol, AIA, and treated groups was analyzed by ANOVA, followed bythe Newman–Keuls post hoc analysis. Tests were performed with Graph-Pad Prism 3.0 software (GraphPad Software, San Diego, CA). Results withp , 0.05 were considered statistically significant.

ResultsChronic AIA

Intra-articular challenge of immunized mice with mBSA inducedsignificant infiltration of mononuclear cells in the synovium and peri-articular tissues, synovial hyperplasia (Fig. 1B), and lacunae of bone

FIGURE 2. AIA-induced periodontal disease. Maxillae of AIA mice were analyzed at different time points (7, 14, 21, 28, 45, and 60 d postrechallenge).Representative photographs of maxillae specimens from control (A), AIA (14 d) (B), infection-induced PD (C), and infliximab-treated AIA (14 d) (D) mice.The arrows indicate bone loss. E–H, Corresponding TRAP-stained samples. The arrows in the higher-magnification panels indicate TRAP+ osteoclasts.Kinetic of alveolar bone loss (I) and effects of anti–TNF-a therapy with infliximab (10 mg/kg/d, i.p.) on alveolar bone loss (J), number of TRAP+ cells (K),and MPO levels (L) in maxillary tissues. Maxillary samples were obtained from the same mice used for joint evaluation. *p , 0.05, versus control; #p ,0.05, versus AIA (14 d). ABC, alveolar bone crest; D, dentin; 1st M, first molar; PL, periodontal ligament.

3824 ARTHRITIS-INDUCED PERIODONTITIS IN MICE

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

resorption (data not shown) from 7 to 28 d after challenge. Thisinflammatory process was also marked by loss of proteoglycan injoint cartilage (Fig. 1F) and reduction of the nociceptive threshold(data not shown) compared with control mice (Fig. 1E). From days28 to 60 after challenge, joint inflammation evolved to a morechronic phase, with fibrous tissue (Fig. 1C) and recovery of pro-teoglycan content (Fig. 1G). These parameters were confirmed byhistological score, as demonstrated by the arthritis index (Fig. 1I)and quantification of proteoglycan content in joint cartilage (Fig.1J). An increase in the number of total leukocytes (Fig. 1K) andmononuclear cells (Fig. 1L) was also observed in the synovialcavity during the course of AIA. In agreement with the quantifi-cation of cells in the joint cavity, levels of NAG (Fig. 1M), a markerof macrophage infiltration, and MPO (Fig. 1N), a marker of neu-trophil influx, were increased in periarticular tissues in the firstweeks after the second Ag challenge. Levels of IL-1b (Fig. 1O) andTNF-a (Fig. 1P) were quantified at day 14 after challenge andfound to be elevated in periarticular tissues. In contrast, no signs ofinflammation or tissue disturbance were observed in the contralat-eral unchallenged joint of mice subjected to AIA.

Blockade of TNF-a represents an important therapy for thetreatment of inflammatory disorders, including RA. The role ofTNF-a in chronic AIAwas evaluated by using infliximab, an anti-TNF Ab used in the clinic but also shown to be effective in ex-perimental animal models (19, 20). As seen in Fig. 1, treatment withinfliximab had major effects on the parameters evaluated, includingarthritis index, proteoglycan loss, infiltration of cells, and cytokinerelease, indicating that TNF-a has a pivotal role in this model.

AIA-induced PD

Induction of AIA resulted in severe alveolar bone loss just 14 dafter articular challenge of immunized mice with Ag (Fig. 2B, 2I).Alveolar bone loss in animals subjected to AIAwas similar to thatinduced by oral infection with the periodontopathogen A. acti-nomycetemcomitans (Fig. 2C, 2I). Alveolar bone loss began rap-idly and seemed to correlate with progression of arthritis, reachinga plateau from days 21 to 60 after rechallenge (Fig. 2I). AIA-induced PD was characterized by increases in the number ofosteoclasts (Fig. 2F, 2K) and local levels of MPO (Fig. 2L).Moreover, there was a significant increase in the expression ofinflammatory cytokines, including TNF-a, IL-1b, IL-6, IL-17,

FIGURE 3. Anti–TNF-a therapy de-creases cytokine release induced by AIAin maxillae of mice. AIA mice weretreated with vehicle or infliximab (10mg/kg, i.p., every 2 d after joint re-challenge) and killed 14 d later. Levelsof TNF-a (A), IL-1b (B), IL-6 (C), IL-17 (D), IFN-g (E), IL-10 (F), RANKL(G), and OPG (H) in maxillae (uppermolars, alveolar bone, and buccal andpalatal periodontal tissues) were evalu-ated by ELISA. Results are mean 6SEM of five mice/group and are repre-sentative of two independent assays.*p , 0.05, compared with C (control);#p , 0.05, compared with vehicle-treated AIA (14 d).

The Journal of Immunology 3825

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

IFN-g (Fig. 3A–E), and RANKL (Fig. 3G) in maxillary tissues atday 14 after AIA induction. In contrast, levels of IL-10 (Fig. 3F)and OPG (Fig. 3H) were reduced.Because treatment with anti–TNF-a greatly ameliorated AIA,

we evaluated whether such treatment would affect development ofPD after induction of AIA. Alveolar bone loss (Fig. 2D, 2J), os-

teoclast recruitment (Fig. 2H, 2K), local MPO levels (Fig. 2L), andproduction of proinflammatory cytokines (Fig. 3) were signifi-cantly ameliorated by blockade of TNF-a. Moreover, the treat-ment was associated with increased maxillary levels of IL-10 (Fig.3F) but had no effect on levels of OPG (Fig. 3H).

AIA-induced PD is dependent on oral microbiota

Because PD is primarily triggered by infection, and there was noinoculation in AIA animals that developed PD spontaneously, wehypothesized whether AIA-induced PD would depend on the oralmicrobiota. To address this possibility, we orally applied theclinically prescribed antimicrobial agent chlorhexidine topicallyto mice subjected to AIA. Induction of AIA in mice had no effecton bacterial load in the oral cavity (Fig. 4A). Oral application ofchlorhexidine greatly reduced the oral microbiota, as assessed bymeasuring 16S bacterial DNA (Fig. 4A). Significantly, thistreatment was associated with prevention of alveolar bone loss(Fig. 4B) and a decrease in MPO levels in maxillae (Fig. 4C). Inthese animals, despite the improvement in periodontal conditions,knee joint inflammatory signs were similar to those observed invehicle-treated mice: number of total leukocytes (AIA [14 d]+vehicle: 2985 6 506 versus AIA[14 d]+chlorhexidine: 2494 6297; p . 0.05) and mononuclear cells (AIA[14 d]+vehicle: 2324 6515 versus AIA[14 d]+chlorhexidine: 2063 6 251; p . 0.05)in synovial cavity and histological arthritis index (AIA[14 d]+vehicle: 3.87 6 0.13 versus AIA[14 d]+chlorhexidine: 3.75 60.25, p . 0.05). We also evaluated bacterial load at the peri-odontal sites in animals treated with anti–TNF-a therapy andfound that it had no effect on the local number of bacteria (AIA[14d]+vehicle: 1.4 6 0.2 versus AIA[14 d]+infliximab: 1.5 6 0.2;p . 0.05).

Evaluation of Th transcription factors in inguinal andsubmandibular LNs

In view of the results indicating that this model of AIA triggers signsof PD, in a way dependent on the injection of Ag in the knee joint, onTNF-a, and oral bacteria, we then investigated systemic alterationsthat could be involved in the association between PD and AIA. Ininguinal LNs, which drain the joint region, expression of the Thtranscription factors tBET, GATA3, RORg, and Foxp3mRNA (TableI) increased significantly after Ag challenge (Fig. 5A–D). There wasan increase in the expression of all transcription factors that tendedto peak at day 14, with the exception of GATA3, which peaked atday 21 after Ag induction. However, when evaluating submandi-bular LNs, which drain the oral region, a pattern distinct from thatin the inguinal region was observed. AIA increased the expressionof RORg and induced a decrease, followed by an increase, inFoxp3 during the course of the disease (Fig. 5G, 5H), whereas tBETand GATA3 remained unaltered in these LNs (Fig. 5E, 5F). Therapy

FIGURE 4. AIA-induced PD is dependent on oral microbiota. AIA micewere treated with vehicle or the antimicrobial agent chlorhexidine (0.12%in 2% CMC, oral application, every 2 d after joint rechallenge) and killed14 d later. A, 16S bacterial load was quantified by real-time PCR inmaxillae. Alveolar bone loss (B) and MPO levels (C) in maxillae weredecreased in AIA mice treated with chlorhexidine. Results are mean 6SEM for five mice in each group. *p , 0.05, compared with the respectiveC (control) group; #p , 0.05, compared with the respective vehicle-treatedAIA (14 d) group.

Table I. Primer sequences and reaction properties

Target Sense and Antisense Sequences (59–39) At (˚C) Mt (˚C) Bp

tBET CCC CTG TCC AGT CAG TAA CTT 60 78 115CTT CTC TGT TTG GCT GGC T

GATA3 AGG AGT CTC CAA GTG TGC GAA 60 80 124TTG GAA TGC AGA CAC CAC CT

Foxp3 CAGTCACTGCAAATGTCCGGT 62 75 75TGTCGGACACAAAGGAACTGC

RORg TGACGGCCAACTTACTCTTGG 53 49 59GCCTGGTTTCCTCAAAACGA

b-actin ATGTTTGAGACCTTCAACA 56 75 495CACGTCAGACTTCATGATGG

16S CGCTAGTAATCGTGGATCAGAATG 60 72 69TGTGACGGGCGGTGTGTA

At, annealing temperature; bp, bp of amplicon size; Mt, melting temperature.

3826 ARTHRITIS-INDUCED PERIODONTITIS IN MICE

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

with anti–TNF-a reversed the pattern of polarization of Th tran-scription factors 14 d after AIA challenge, both in the inguinal(tBET, GATA3, RORg, and Foxp3) (Fig. 5A–D) and submandibularLNs (RORg and Foxp3) (Fig. 5G, 5H).

Systemic reactivity to collagen I

We also investigated whether any factor soluble in serum couldaccount for PD in animals subjected to AIA. No significant changesin levels of cytokines, including TNF-a, IL-1b, IL-6, IL-17, and

IL-10, were observed in serum of mice subjected to AIA com-pared with controls at 14 d after joint challenge (data not shown).Nevertheless, there was a slight increase in levels of TNF-a(control: nondetectable versus AIA [14 d]: 21.7 6 8.9 pg/100 mgtissue; p , 0.05) and IL-10 (control: 15.8 6 3.2 versus AIA [14d]: 71.8 6 21.1 pg/100 mg tissue; p . 0.05) in spleen of AIAmice. Serum C-reactive protein levels were increased in AIAanimals (control: 3.1 6 0.4 versus AIA [14 d]: 6.0 6 0.6 mg/l;p , 0.05), indicating systemic reactivity, but they decreased

FIGURE 5. Expression of Th subsets transcription factors in the LNs of AIA mice. Control (C), AIA, and infliximab-treated AIA mice were evaluated forthe levels of tBET, GATA3, RORg, and Foxp3 mRNA in the inguinal LNs (A–D, respectively) and submandibular LNs (E–H, respectively). The results arepresented as mean 6 SEM of expressions of the target mRNAs with normalization to b-actin. *p , 0.05, versus control (group C); #p , 0.05, versusvehicle-treated AIA (14 d) group.

The Journal of Immunology 3827

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

after anti–TNF-a treatment (2.8 6 0.4 mg/l; p , 0.05 versusAIA). In addition to these mediators, AIA induced production ofanti-collagen I Abs that could be detected in serum and werepartially reduced by anti–TNF-a treatment (Fig. 6).Collagen I is prevalent in periodontium; when it was used to

stimulate whole-spleen cell cultures from control and AIA mice,a distinct pattern of response was seen. Supernatants collected fromAIA cell cultures presented significantly higher levels of TNF-aand IL-17 than did controls, whereas TGF-b levels were not al-tered (Table II) after collagen I stimulation. Both cell culturesresponded similarly without stimulation and with a nonspecificstimulus, such as Con A (Table II). These findings suggested thatarthritis may induce systemic reactivity to specific Ags, and thismay contribute to the triggering of oral damage in the presence oforal microbiota.

DiscussionThe association between RA and PD has long been studied, butconflicting data of several clinical trials hinder a better under-standing of this relationship. Indeed, there is a lack of experi-mental evidence to support the hypotheses raised upon the existingepidemiological findings (3, 13, 14). The major results of thisstudy can be summarized as follows: an experimental model ofchronic AIAwas shown to be useful in mimicking several featuresof inflammatory RA and the PD triggered by joint lesion. In thismodel, AIA-induced PD was associated with low-grade systemicinflammation measured by C-reactive protein, but not with serumTNF-a, IL-1b, IL-6, IL-17, and IL-10, and it was dependent onTNF-a and oral bacteria. Cells of AIA mice also were hyperre-sponsive to the auto-Ag collagen I.

In the current study, AIA spontaneously induced inflammatoryPD, without any manipulation of the oral environment (i.e., therewas no need for the injection of periodontopathogens). Thesefindings strongly support current hypotheses to explain RA and PDassociation (3, 14). Ag challenge of the knee joint rapidly trig-gered PD, characterized by alveolar bone loss; osteoclast differ-entiation; and an increase in the levels of MPO, proinflammatorycytokines, and RANKL. The present model of chronic AIA inmice differs from others because the trigger point is local ratherthan systemic. Tatakis and Guglielmoni (26) used transgenic ratsand Ramamurthy et al. (16) used the adjuvant model in rats, whichinduce inflammatory reaction in all joints of the animal. Similarly,recent published studies of Trombone et al. (4) and Park et al. (5)used the pristane-induced and the collagen-induced models ofarthritis, respectively, in which generalized systemic inflammationis present after immunization. In our study, immunization alonewas not capable of inducing changes in the oral cavity. Indeed, inimmunized animals there were no signs of inflammation in joints,any evidence of PD, or increase in serum levels of inflammatorymediators compared with naive mice. Only after challenge in thejoint did arthritis and periodontal disease occur. Therefore, jointchallenge, in addition to immunization, is necessary for PD tooccur, and this only happens in cooperation with the oral micro-biota. This finding clearly demonstrated the need of another “hit,”such as the oral microbiota, to induce a secondary disease.The results showing the dependence of the association between

AIA and PD on TNF-a and commensal oral bacteria are of specialrelevance. The role of TNF-a in inflammatory RA and PD iswidely known (18, 27); indeed, some clinical studies addressedthe role of anti–TNF-a therapies in the reduction of periodontalparameters in patients with RA (28, 29). In these individuals, thistherapy reduced periodontal indices and TNF-a levels in gingivalcrevicular fluid (28). In the current study, it became clear that thiscytokine, independently of other interfering variables found inclinical trials, is fundamental for the development of AIA-inducedPD. In addition to reducing TNF-a levels and ameliorating AIAparameters, such as cell infiltration and cartilage destruction, theanti–TNF-a Ab prevented the development of AIA-induced PD.In contrast, Pers et al. (29) indicated that infliximab tended toaggravate gingival inflammation in patients, although it induceda decrease in attachment loss. Indeed, the absence of the TNF-areceptor p55 results in an impairment in protective immunity to A.actinomycetemcomitans infection in mice, leading to an increasein bacterial load (18), which could explain the gingival inflam-mation in those patients. Nevertheless, in the current study, thebacterial load of infliximab-treated mice was not altered, andpatients taking infliximab were already shown to present a dentalplaque index similar to their healthy counterparts (28). The latter

FIGURE 6. AIA triggers the release of anti-collagen I IgG. Serumsamples of control, vehicle-treated AIA, and infliximab-treated AIA micewere collected 14 d after joint rechallenge and assayed for total anti-col-lagen I IgG. Ab titers were enhanced by AIA and partially reversed byinfliximab. *p , 0.05, versus control (group C); #p , 0.05, versus vehicle-treated AIA (14 d) group.

Table II. Levels of cytokines in the supernatants of spleen cell cultures 48 h after stimulation with collagen I, culture medium, orCon A

CytokineSpleen Cell

Culture SampleCollagen I (15 mg/well)(Mean 6 SEM; pg/ml)

No Stimulus (RPMI 1640)(Mean 6 SEM; pg/ml)

Con A (2 mg/well)(Mean 6 SEM; pg/ml)

TNF-a Control 1.3 6 1.2 15.4 6 5.4 210.8 6 76.9AIA 108.7 6 17.6* 26.7 6 12.9 368.6 6 120.2

p value 0.0003 0.589 0.616IL-17 Control 55.5 6 24.7 107.6 6 79.6 342.8 6 71.5

AIA 285.4 6 55.9* 43.3 6 38.7 336.1 6 182.7p value 0.005 0.488 0.973

TGF-b Control 296.1 6 6.3 295.6 6 8.5 293.7 6 10.4AIA 314.4 6 15.7 283.3 6 6.5 288.2 6 17.6

p value 0.311 0.280 0.796

*p , 0.05, control versus AIA; unpaired Student t test

3828 ARTHRITIS-INDUCED PERIODONTITIS IN MICE

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

contrasting results may be accounted for by potential clinicalvariables, such as differences in the periodontal microbial envi-ronment and the responsiveness of the patient to the medication.TNF-a blockade has been a major breakthrough in the therapy ofRA during the past years, but this should not detract from the factthat in more than half of the patients in clinical trials the com-plete remission of RA is rare (30). Therefore, it seems that onlyan efficacious treatment of RA may prevent the development ofother associated diseases, such as PD.The control of oral microbiota to avoid the development of

AIA-induced PD also became evident in the current study. Al-though the quantitative oral bacterial load was not affected byAIA, its control by the antimicrobial agent chlorhexidine, widelyprescribed in dental offices, abrogated alveolar bone loss withoutaltering signs of AIA. Accordingly, several studies showed thatRA patients have oral hygiene status similar to healthy individ-uals, although the periodontal condition is worse (2, 9, 28). Thepresent results showed the clinical importance of treating bothRA and PD.In addition to TNF-a and oral microbiota, AIA-induced PD was

associated with the presence of serum anti-collagen I Abs. Col-lagen I is one of the major components of periodontal tissues (31)and, it was shown, mainly for RA, that Abs binding to self-Ags caninitiate an inflammatory reaction in tissues, possibly through therelease of tissue-degrading enzymes (32) and cytokines (33) by theinfiltrating cells (34). In this study, the production of proinflam-matory cytokines, such as TNF-a and IL-17, was enhanced bycells of AIA mice when stimulated by collagen I. Thus, it seemsreasonable to hypothesize that the increased concentrations ofproinflammatory cytokines and osteoclast activators in a quantita-tively nonaltered bacterial environment, such as the maxillae ofAIA mice, were triggered by anti-collagen I Abs. Abs can alsodirectly cause the destruction of their target tissue through im-pairment of tissue formation (35), inhibition of collagen fibrillo-genesis (36), and disruption of collagen fibrils in the extracellularmatrix (37). Once more, there is evidence of increased matrixmetalloproteinases in maxillae of AIA mice (4, 16); however, itremains to be determined whether it is triggered by autoantibodies.Along with this inflammatory milieu in maxillae, submandibular

LNs of AIA mice seemed to present an altered pattern of polari-zation of Th cells. The expression of RORg transcription factormRNA was increased in AIA submandibular LNs, distinctly fromtBET and GATA3. RORg is selectively expressed in in vitro-differentiated Th17 cells and in IL-17+ T cells present in thelamina propria of naive mice (38). These findings are corroboratedby unpublished observations of our research group, indicating thatthere are greater numbers of CD4+CD25+IL17+ cells in the sub-mandibular LNs and spleen of AIA mice compared with controls.In view of the present results, we cannot ascertain whether thisprobable polarization was the cause or the consequence of oralinflammation, but it seems to be important in the context of theassociation between AIA and PD. The increase in RORg expres-sion occurred concomitantly with the decrease in Foxp3. Indeed,Th17 and regulatory T cell developmental programs of T cells areantagonistically interconnected, and regulatory T cells are in-volved in the control of PD by release of IL-10 (39). Accordingly,in the current study, maxillae of AIA mice presented decreasedlevels of IL-10 and higher levels of IL-17. In RA patients, theexpression of TNF-a, IL-1b, and IL-17 was predictive of bonetissue destruction (40), and RANKL expression on the surface ofTh17 cells induced osteoclastogenesis (41), directly promotingbone erosion (42). Furthermore, osteoblasts respond vigorously toIL-17 by upregulating several proinflammatory cytokines, che-mokines, and proteases, and TNF-a, IL-1b, and IL-6 induced by

IL-17 might even feedback on the generation and expansion ofadditional Th17 cells. This pattern of polarization was differentfrom the observed by Trombone et al. (4) in an experimentalmodel of pristane-induced RA. In that study, tBET, GATA3, andRORg were upregulated, suggesting activation of the Th1, Th2,and Th17 pathways. The systemic challenge discussed in thisarticle may account for this distinction. Nevertheless, despite thisdiscrepancy, the Th17 component also seemed to be important inthose experimental conditions (4) and, irrespective of such con-troversies, there are data suggesting that both Th1 and Th17 cellsmay be involved in the process of inflammatory bone loss (43).Another important finding was the prevention of this transcriptionfactor polarization by the anti–TNF-a therapy. In fact, TNF-a wasalready shown to alter the maturation of monocytes and dendriticcells and, subsequently, the pattern of Th responses. Anti–TNF-atherapies resulted in impaired Th17 and Th1 responses in modelsof autoimmune disorders (44, 45). This effect might have con-tributed to the periodontal amelioration in AIA mice.Altogether, the present findings clearly support the two-hit

model (14). It is possible to suggest that, in the presence ofa “suitable” environment, such as the mouth with its commensalmicrobiota (first “hit”), the systemic immunoactivated milieutriggered by RA (i.e., autoantibodies, Th polarization, and releaseof acute-phase proteins) results in greater cell migration and al-veolar bone loss, even in the absence of classic periodontopath-ogens or greater amounts of dental plaque. This hypothesis isfurther strengthened by the finding that the nonchallenged joints ofAIA mice did not present any signs of inflammation.In conclusion, this study provided new experimental evidence to

support the two-hit model. AIA exaggerated the reactivity to Agof the local oral microbiota and caused spontaneous periodontalbone loss in a TNF-a–dependent manner. Thus, PD triggered byarthritis may be the manifestation of systemic inflammatory bonedisease.

DisclosuresThe authors have no financial conflicts of interest.

References1. Liubomorova, I. M. 1964. State of periodontium in patients affected with

rheumatism. Stomatologiia 43: 33–37.2. Pischon, N., T. Pischon, J. Kroger, E. Gulmez, B. M. Kleber, J. P. Bernimoulin,

H. Landau, P. G. Brinkmann, P. Schlattmann, J. Zernicke, et al. 2008. Associ-ation among rheumatoid arthritis, oral hygiene, and periodontitis. J. Periodontol.79: 979–986.

3. de Pablo, P., I. L. C. Chapple, C. D. Buckley, and T. Dietrich. 2009. Periodontitisin systemic rheumatic diseases. Nat. Rev. Rheumatol. 5: 218–224.

4. Trombone, A. P., M. Claudino, P. Colavite, G. F. de Assis, M. J. Avila-Campos,J. S. Silva, A. P. Campanelli, O. M. Ibanez, M. De Franco, and G. P. Garlet.2010. Periodontitis and arthritis interaction in mice involves a shared hyper-inflammatory genotype and functional immunological interferences. GenesImmun. 11: 479–489.

5. Park, J. C., C. Su, I. H. Jung, S. H. Choi, K.-S. Cho, C. K. Kim, Y. B. Park,S. K. Lee, and C. S. Kim. 2011. Mechanism of alveolar bone loss in a collagen-induced arthritis model in mice. J. Clin. Periodontol. 38: 122–130.

6. Tolo, K., and L. Jorkjend. 1990. Serum antibodies and loss of periodontal bone inpatients with rheumatoid arthritis. J. Clin. Periodontol. 17: 288–291.

7. Kasser, U. R., C. Gleissner, F. Dehne, A. Michel, B. Willershausen-Zonnchen,and W. W. Bolten. 1997. Risk for periodontal disease in patients with long-standing rheumatoid arthritis. Arthritis Rheum. 40: 2248–2251.

8. Mercado, F., R. I. Marshall, A. C. Klestov, and P. M. Bartold. 2000. Is therea relationship between rheumatoid arthritis and periodontal disease? J. Clin.Periodontol. 27: 267–272.

9. Mercado, F. B., R. I. Marshall, A. C. Klestov, and P. M. Bartold. 2001. Re-lationship between rheumatoid arthritis and periodontitis. J. Periodontol. 72:779–787.

10. Havemose-Poulsen, A., J. Westergaard, K. Stoltze, H. Skjødt, B. Danneskiold-Samsøe, H. Locht, K. Bendtzen, and P. Holmstrup. 2006. Periodontal and he-matological characteristics associated with aggressive periodontitis, juvenileidiopathic arthritis, and rheumatoid arthritis. J. Periodontol. 77: 280–288.

The Journal of Immunology 3829

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from

11. Ishi Ede, P., M. B. Bertolo, C. Rossa, Jr., K. L. Kirkwood, and M. A. Onofre.2008. Periodontal condition in patients with rheumatoid arthritis. Braz. Oral Res.22: 72–77.

12. Miranda, L. A., A. G. Islabao, R. G. Fischer, C. M. Figueredo, R. V. Oppermann,and A. Gustafsson. 2007. Decreased interleukin-1b and elastase in the gingivalcrevicular fluid of individuals undergoing anti-inflammatory treatment forrheumatoid arthritis. J. Periodontol. 78: 1612–1619.

13. Bartold, P. M., R. I. Marshall, and D. R. Haynes. 2005. Periodontitis andrheumatoid arthritis: a review. J. Periodontol. 76(11, Suppl.)2066–2074.

14. Golub, L. M., J. B. Payne, R. A. Reinhardt, and G. Nieman. 2006. Can systemicdiseases co-induce (not just exacerbate) periodontitis? A hypothetical “two-hit”model. J. Dent. Res. 85: 102–105.

15. Bozkurt, F. Y., Z. Yetkin Ay, E. Berker, E. Tepe, and S. Akkus. 2006. Anti-inflammatory cytokines in gingival crevicular fluid in patients with periodontitisand rheumatoid arthritis: a preliminary report. Cytokine 35: 180–185.

16. Ramamurthy, N. S., R. A. Greenwald, M. Y. Celiker, and E. Y. Shi. 2005. Ex-perimental arthritis in rats induces biomarkers of periodontitis which are ame-liorated by gene therapy with tissue inhibitor of matrix metalloproteinases. J.Periodontol. 76: 229–233.

17. Wengner, A. M., U. E. Hopken, P. K. Petrow, S. Hartmann, U. Schurigt,R. Brauer, and M. Lipp. 2007. CXCR5- and CCR7-dependent lymphoid neo-genesis in a murine model of chronic antigen-induced arthritis. Arthritis Rheum.56: 3271–3283.

18. Garlet, G. P., C. R. B. Cardoso, A. P. Campanelli, B. R. Ferreira, M. J. Avila-Campos, F. Q. Cunha, and J. S. Silva. 2007. The dual role of p55 tumour necrosisfactor-a receptor in Actinobacillus actinomycetemcomitans-induced experi-mental periodontitis: host protection and tissue destruction. Clin. Exp. Immunol.147: 128–138.

19. Zwerina, J., B. Tuerk, K. Redlich, J. S. Smolen, and G. Schett. 2006. Imbalanceof local bone metabolism in inflammatory arthritis and its reversal upon tumornecrosis factor blockade: direct analysis of bone turnover in murine arthritis.Arthritis Res. Ther. 8: R22.

20. Sachs, D., F. M. Coelho, V. V. Costa, F. Lopes, V. Pinho, F. A. Amaral,T. A. Silva, A. L. Teixeira, D. G. Souza, and M. M. Teixeira. 2011. Cooperativerole of tumour necrosis factor-a, interleukin-1b and neutrophils in a novelbehavioural model that concomitantly demonstrates articular inflammation andhypernociception in mice. Br. J. Pharmacol. 162: 72–83.

21. Williams, A. S., P. J. Richards, E. Thomas, S. Carty, M. A. Nowell,R. M. Goodfellow, C. M. Dent, B. D. Williams, S. A. Jones, and N. Topley. 2007.Interferon-g protects against the development of structural damage in experi-mental arthritis by regulating polymorphonuclear neutrophil influx into diseasedjoints. Arthritis Rheum. 56: 2244–2254.

22. Urech, D. M., U. Feige, S. Ewert, V. Schlosser, M. Ottiger, K. Polzer, G. Schett,and P. Lichtlen. 2010. Anti-inflammatory and cartilage-protecting effects of anintra-articularly injected anti-TNFalpha single-chain Fv antibody (ESBA105)designed for local therapeutic use. Ann. Rheum. Dis. 69: 443–449.

23. Barcelos, L. S., A. Talvani, A. S. Teixeira, L. Q. Vieira, G. D. Cassali,S. P. Andrade, and M. M. Teixeira. 2005. Impaired inflammatory angiogenesis,but not leukocyte influx, in mice lacking TNFR1. J. Leukoc. Biol. 78: 352–358.

24. Van de Velde, N. C., P. L. Mottram, M. S. Powell, B. Lim, R. Holmdahl, andP. M. Hogarth. 2010. Transgenic mice expressing human FcgammaRIIa haveenhanced sensitivity to induced autoimmune arthritis as well as elevated Th17cells. Immunol. Lett. 130: 82–88.

25. Berg, L., J. Ronnelid, C. B. Sanjeevi, J. Lampa, and L. Klareskog. 2000. In-terferon-g production in response to in vitro stimulation with collagen type II inrheumatoid arthritis is associated with HLA-DRB1(*)0401 and HLA-DQ8. Ar-thritis Res. 2: 75–84.

26. Tatakis, D. N., and P. Guglielmoni. 2000. HLA-B27 transgenic rats are sus-ceptible to accelerated alveolar bone loss. J. Periodontol. 71: 1395–1400.

27. McInnes, I. B., and G. Schett. 2007. Cytokines in the pathogenesis of rheumatoidarthritis. Nat. Rev. Immunol. 7: 429–442.

28. Mayer, Y., A. Balbir-Gurman, and E. E. Machtei. 2009. Anti-tumor necrosisfactor-alpha therapy and periodontal parameters in patients with rheumatoidarthritis. J. Periodontol. 80: 1414–1420.

29. Pers, J. O., A. Saraux, R. Pierre, and P. Youinou. 2008. Anti-TNF-a immuno-therapy is associated with increased gingival inflammation without clinical at-tachment loss in subjects with rheumatoid arthritis. J. Periodontol. 79: 1645–1651.

30. Firestein, G. S. 2003. Evolving concepts of rheumatoid arthritis. Nature 423:356–361.

31. Havemose-Poulsen, A., and P. Holmstrup. 1997. Factors affecting IL-1-mediatedcollagen metabolism by fibroblasts and the pathogenesis of periodontal disease:a review of the literature. Crit. Rev. Oral Biol. Med. 8: 217–236.

32. Adkison, A. M., S. Z. Raptis, D. G. Kelley, and C. T. Pham. 2002. Dipeptidylpeptidase I activates neutrophil-derived serine proteases and regulates the de-velopment of acute experimental arthritis. J. Clin. Invest. 109: 363–371.

33. Mullazehi, M., L. Mathsson, J. Lampa, and J. Ronnelid. 2006. Surface-boundanti-type II collagen-containing immune complexes induce production of tumornecrosis factor alpha, interleukin-1beta, and interleukin-8 from peripheral bloodmonocytes via Fc gamma receptor IIA: a potential pathophysiologic mechanismfor humoral anti-type II collagen immunity in arthritis. Arthritis Rheum. 54:1759–1771.

34. Nandakumar, K. S., E. Bajtner, L. Hill, B. Bohm, M. J. Rowley, H. Burkhardt,and R. Holmdahl. 2008. Arthritogenic antibodies specific for a major type IIcollagen triple-helical epitope bind and destabilize cartilage independent of in-flammation. Arthritis Rheum. 58: 184–196.

35. Amirahmadi, S. F., M. H. Pho, R. E. Gray, D. E. Crombie, S. F. Whittingham,B. B. Zuasti, M. P. Van Damme, and M. J. Rowley. 2004. An arthritogenicmonoclonal antibody to type II collagen, CII-C1, impairs cartilage formation bycultured chondrocytes. Immunol. Cell Biol. 82: 427–434.

36. Gray, R. E., N. Seng, I. R. Mackay, and M. J. Rowley. 2004. Measurement ofantibodies to collagen II by inhibition of collagen fibril formation in vitro. J.Immunol. Methods 285: 55–61.

37. Amirahmadi, S. F., S. Whittingham, D. E. Crombie, K. S. Nandakumar,R. Holmdahl, I. R. Mackay, M. P. van Damme, and M. J. Rowley. 2005.Arthritogenic anti-type II collagen antibodies are pathogenic for cartilage-derived chondrocytes independent of inflammatory cells. Arthritis Rheum. 52:1897–1906.

38. Ivanov, I. I., B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J. Lafaille,D. J. Cua, and D. R. Littman. 2006. The orphan nuclear receptor RORgammatdirects the differentiation program of proinflammatory IL-17+ T helper cells.Cell 126: 1121–1133.

39. Garlet, G. P., C. R. Cardoso, F. S. Mariano, M. Claudino, G. F. de Assis,A. P. Campanelli, M. J. Avila-Campos, and J. S. Silva. 2010. Regulatory T cellsattenuate experimental periodontitis progression in mice. J. Clin. Periodontol.37: 591–600.

40. Kirkham, B. W., M. N. Lassere, J. P. Edmonds, K. M. Juhasz, P. A. Bird,C. S. Lee, R. Shnier, and I. J. Portek. 2006. Synovial membrane cytokine ex-pression is predictive of joint damage progression in rheumatoid arthritis: a two-yearprospective study (the DAMAGE study cohort). Arthritis Rheum. 54: 1122–1131.

41. Sato, K., A. Suematsu, K. Okamoto, A. Yamaguchi, Y. Morishita, Y. Kadono,S. Tanaka, T. Kodama, S. Akira, Y. Iwakura, et al. 2006. Th17 functions as anosteoclastogenic helper T cell subset that links T cell activation and bone de-struction. J. Exp. Med. 203: 2673–2682.

42. Koenders, M. I., E. Lubberts, F. A. van de Loo, B. Oppers-Walgreen, L. van denBersselaar, M. M. Helsen, J. K. Kolls, F. E. Di Padova, L. A. Joosten, andW. B. van den Berg. 2006. Interleukin-17 acts independently of TNF-a underarthritic conditions. J. Immunol. 176: 6262–6269.

43. Garlet, G. P. 2010. Destructive and protective roles of cytokines in periodontitis:a re-appraisal from host defense and tissue destruction viewpoints. J. Dent. Res.89: 1349–1363.

44. Iwamoto, S., S. Iwai, K. Tsujiyama, C. Kurahashi, K. Takeshita, M. Naoe,A. Masunaga, Y. Ogawa, K. Oguchi, and A. Miyazaki. 2007. TNF-alpha driveshuman CD14+ monocytes to differentiate into CD70+ dendritic cells evokingTh1 and Th17 responses. J. Immunol. 179: 1449–1457.

45. Palucka, A. K., J. P. Blanck, L. Bennett, V. Pascual, and J. Banchereau. 2005.Cross-regulation of TNF and IFN-alpha in autoimmune diseases. Proc. Natl.Acad. Sci. USA 102: 3372–3377.

3830 ARTHRITIS-INDUCED PERIODONTITIS IN MICE

on October 21, 2011

ww

w.jim

munol.org

Dow

nloaded from