BIOLOGIA 1 PED

download BIOLOGIA 1 PED

of 29

  • date post

    12-Jul-2015
  • Category

    Documents

  • view

    93
  • download

    0

Embed Size (px)

Transcript of BIOLOGIA 1 PED

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

NOMBRE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . APELLIDOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CALLE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . POBLACIN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . PROVINCIA . . . . . . . . . . . . . . . . . . . C.P. . . . . . . . . . . . . . . . . . . . .

BIOLOGA (Curso de Acceso)

PRUEBA DE EVALUACIN A DISTANCIA / 1 UNIDAD DIDCTICA / 1

Nmero de Expediente

Gloria Morcillo Ortega

0100008PE01A14

CURSO 2002/2003

0100008 Biologa (Curso de Acceso). Primera prueba

1

Prueba de Ensayo1. Representa esquemticamente la estructura de un nucletido utilizando los siguientes smbolos para indicar los elementos que lo componen: un pentgono para la pentosa, un crculo para el fosfato y un rectngulo para la base nitrogenada.

2. Utilizando los mismos smbolos que en la pregunta 1 para representar los componentes de los nucletidos, representa esquemticamente: I) un fragmento de RNA de 4 nucletidos II) un fragmento de DNA de 4 pares de nucletidos

3. Indica la funcin principal de los siguientes orgnulos celulares:

2

0100008 Biologa (Curso de Acceso). Primera prueba

Ribosomas:

Mitocndrias:

Cloroplastos:

Ncleo:

Flagelos:

4. A continuacin se representa la secuencia de bases nitrogenadas de un fragmento de DNA; representa la secuencia de bases del RNA que resultar de la transcripcin de este fragmento. AGGCTATTCGATTACG

0100008 Biologa (Curso de Acceso). Primera prueba

3

5. Una determinada protena tiene 75 aminocidos. Cuntos nucletidos tendr el RNA mensajero que codifica para estos 75 aminocidos?

6. Consulta una tabla del cdigo gentico para deducir los aminocidos codificados por el siguiente fragmento de RNA-m: AUGGUGGCUCCAUACGGUUAA

4

0100008 Biologa (Curso de Acceso). Primera prueba

7. Qu quiere decir clonar un gen? Indica brevemente cules seran las etapas fundamentales que se requieren para clonar un gen humano en una bacteria.

8. Qu es una clula madre? Qu caractersticas tiene?

0100008 Biologa (Curso de Acceso). Primera prueba

5

Prueba Objetiva1. Los aminocidos son las unidades que constituyen: a) los polisacridos b) los cidos nucleicos c) los genes d) las protenas e) las macromolculas 2. La estructura primaria de una enzima es: a) el orden o secuencia de sus aminocidos b) la secuencia de sus nucletidos c) la secuencia de bases nitrogenadas d) la secuencia de enlaces de hidrgeno e) la secuencia de tripletes 3. Ncleo, cloroplastos y retculo endoplsmico: a) son orgnulos de las clulas procariticas b) son orgnulos implicados en la produccin de energa c) son orgnulos celulares d) son orgnulos fundamentales para todos los tipos de clulas e) ninguna alternativa es correcta 4. Las membranas celulares estn compuestas fundamentalmente por: a) azcares y polisacridos b) fosfolpidos y protenas c) polisacridos y lpidos d) glucosa y protenas e) colesterol 5. A continuacin se indican algunas posibles diferencias entre el DNA y el RNA: 1) En el RNA el uracilo sustituye a la timina. 2) En el RNA el uracilo sustituye a la guanina. 3) El RNA es una cadena sencilla, el DNA es una doble hlice. 4) El DNA est en el ncleo, mientras que el RNA nunca se encuentra en el ncleo. Indicar cuales de estas frases son correctas: a) 1-3-4 b) 1-3 c) 1-2-3 d) 1-2-3-4 e) 3- 4 6. De las siguientes molculas cul es la que transporta los aminocidos al ribosoma para la sntesis de protenas? a) RNA de transferencia (RNA-t) b) RNA mensajero (RNA-m) c) ATP d) RNA ribosmico (RNA-r) e) todas son correctas

6

0100008 Biologa (Curso de Acceso). Primera prueba

7. En la sntesis de protenas, los genes: a) son productores de aminocidos b) forman los enlaces dipptido c) determinan el orden o secuencia de aminocidos d) sintetizan los aminocidos e) regulan el transporte de los aminocidos 8. El triplete o codn UCU codifica para el aminocido serina. Esto quiere decir que: a) se necesita U y C para le sntesis de serina b) UCU es una forma abreviada de indicar serina c) si se aade UCU a las clulas se producir serina d) la secuencia UCU de un RNA mensajero codifica serina e) las bases UCU en el DNA significa serina 9. Los monmeros que constituyen el DNA se denominan: a) purinas b) bases c) nucletidos d) azcares e) aminocidos 10. La informacin gentica est codificada en el DNA por: a) la secuencia de bases nitrogenadas b) la secuencia regular de fosfato y desoxirribosa c) los aminocidos d) los nucleosomas e) todas las anteriores son correctas 11. Todas las protenas estn formadas a partir de: a) 4 tipos de aminocidos b) 20 tipos de aminocidos c) 64 tipos de aminocidos d) 64 tripletes de aminocidos y distintos tipos de enzimas e) 4 tipos de aminocidos y 4 nucletidos 12. Cul de los siguientes elementos qumicos no es abundante en la materia viva? a) carbono b) oxigeno c) fosforo d) silicio e) hidrgeno 13. De los siguientes compuestos Cul encontraremos en la materia viva en mayor cantidad? a) DNA b) protenas c) lpidos d) glcidos e) agua

0100008 Biologa (Curso de Acceso). Primera prueba

7

14. Una de las siguientes combinaciones representa un nucletido en una molcula de RNA: a) Guanina-desoxirribosa-fosfato b) Timina-ribosa -fosfato c) Uracilo-desoxirribosa-fosfato d) Adenina-ribosa-fosfato e) Citosina-desoxirribosa-fosfato 15. En el ncleo celular se encuentra: a) el centriolo b) los ribosomas c) la cromatina d) las mitocondrias e) el retculo 16. Los cambios en el programa gentico se denominan. a) mutaciones b) adaptaciones c) combinaciones d) seleccin e) replicacin 17. La estructura de doble hlice del DNA fue descubierta por: a) Cajal b) Mendel c) Darwin d) Einstein e) Watson y Crick 18. Una clula muscular y una nerviosa de un mismo organismo son diferentes debido a que: a) tienen diferentes genes b) tienen mutaciones c) expresan diferentes genes d) tienen diferentes orgnulos e) todas las anteriores son ciertas 19. Si UCA es un codn en el m-RNA su anticodn en el t-RNA ser: a) UGT b) UCA c) TGT d) AGU e) ninguna es correcta 20. De los siguientes elementos cual no est directamente implicado en la sntesis de protenas: a) RNAm b) ribosomas c) DNA d) RNAt e) aminocidos

CONSULTAS REFERENTES AL CONTENIDO DE LOS TEMAS Y METODOLOGA DE SU ESTUDIO

RESPUESTAS DEL PROFESOR

EVALUACIN

PRUEBA OBJETIVA Aciertos Errores Omisiones TOTAL

PRUEBA DE ENSAYO

TOTAL

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

NOMBRE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . APELLIDOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CALLE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . POBLACIN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . PROVINCIA . . . . . . . . . . . . . . . . . . . C.P. . . . . . . . . . . . . . . . . . . . .

BIOLOGA (Curso de Acceso)

PRUEBA DE EVALUACIN A DISTANCIA / 2 UNIDAD DIDCTICA / 2

Nmero de Expediente

Isabel Portela Peas

0100008PE01A14

CURSO 2002/2003

0100008 Biologa (Curso de Acceso). Segunda prueba

1

1. De las siguientes proposiciones referidas a la nutricin humana cul no es correcta? a) Los nutrientes energticos contenidos en el alimento aportan la energa necesaria para el desarrollo de las funciones vitales. b) El objetivo de los procesos digestivos es la transformacin del alimento para obtener de l los nutrientes que contiene. c) Los carbohidratos son los nutrientes con mayor valor energtico. d) La energa contenida en los nutrientes se considera de tipo qumico y se libera en los procesos digestivos y metablicos. 2. Elija la proposicin falsa: a) El almidn es una molcula de reserva glucdica en los vegetales. b) El almidn es una molcula de reserva proteica en los vegetales. c) El glucgeno es una molcula de reserva glucdica en los animales. d) El glucgeno es un polmero de glucosa propio de las clulas animales. 3. El Ciclo de Krebs es: a) Gluclisis en la que se obtiene cido pirvico. b) Va fermentativa para la degradacin del cido pirvico. c) Va respiratoria para la degradacin del cido pirvico. d) Fotosntesis o reaccin de utilizacin directa de energa solar. 4. Elija la proposicin falsa. En la fotosntesis los organismos auttrofos: a) Sintetizan molculas de glucosa. b) Desprenden oxgeno y agua. c) Utilizan la luz solar como fuente de energa. d) Toman dixido de carbono y agua del medio ambiente. 5. Cul es la respuesta incorrecta?: a) La glucolisis es un proceso anaerbico. b) En la degradacin de la glucosa a cido pirvico se consume energa. c) La liberacin de energa es mayor en la respiracin aerbica que en la fermentacin. d) En la glucolisis una molcula de glucosa da lugar a dos de cido pirvico con liberacin de energa. 6. Elija la proposicin correcta, desde un punto de vista de balance energtico: a) La respiracin aerobia de la glucosa, en la que se sintetizan 38 ATP, es ms eficaz que la anaerobia. b) La respiracin aerobia de la glucosa es menos eficaz que la anaerobia. c) Es lo mismo una va metablica aerbica que una fermentativa. d) La respiracin aerobia de la glucosa, en la que se sintetizan 28 ATP, es ms eficaz que la anaerobia.

2

0100008 Biologa (Curso de Acceso). Segunda prueba

7. Elija la proposicin correcta: a) El anabolismo es la fase del metabolismo en la que grandes molculas se reducen a otras ms pequeas. b) Las reacciones de sntesis metablica se denominan anablicas y transcurren con gasto energtico. c) Las reacciones catablic