Bimbingan Coas Hematologi

Click here to load reader

  • date post

    02-Jun-2018
  • Category

    Documents

  • view

    221
  • download

    0

Embed Size (px)

Transcript of Bimbingan Coas Hematologi

  • 8/10/2019 Bimbingan Coas Hematologi

    1/53

    HEMATOLOGI

    Bag IKA

    FK-Unsri RSMH Palembang2007

  • 8/10/2019 Bimbingan Coas Hematologi

    2/53

    Hematopoesis

  • 8/10/2019 Bimbingan Coas Hematologi

    3/53

    hemoglobin

  • 8/10/2019 Bimbingan Coas Hematologi

    4/53

    PERKEMBANGAN HEMOGLOBIN

    6 12 18 24 30 36 1 6 12 18 24 30 36 42 48 minggu

    Kantung Kunir Hati Limpa Sumsum Tulang

    50

    40

    30

    20

    10

    Usia pasca konsepsi Usia pasca kelahiran

    Kelahiran

    Ju

    mlahsintesisglobin(%)

    Lokasi

    eritrop

    oesis

    Pada fase dewasa:

    Hb A : 95 - 98%

    Hb A2: 2,5-3,5%

    Hb F : 0,5-1%

  • 8/10/2019 Bimbingan Coas Hematologi

    5/53

    HEMOGLOBIN MANUSIA

    GugusHem

    1

    12

    2

    Protein tetramer 22+ 4 hem

    Globin utama:

    - Sub unit globin-(141 aa)- Sub unit globin-(146 aa)

    (Stamatoyannopoulos and Nienhuis, 1994)

    Thalassemia-dan thalassemia-

  • 8/10/2019 Bimbingan Coas Hematologi

    6/53

    Anemia

  • 8/10/2019 Bimbingan Coas Hematologi

    7/53

    Anemia pd neonatus

    1. Perdarahanvit K

    2. Proses hemolitik :

    a. Autoimun AB incomp, Rh incomp

    b. Non autoimun G6PD, sferositosis

    3. Kegagalan produksi eritrosit

  • 8/10/2019 Bimbingan Coas Hematologi

    8/53

    Heinz body

    G6PD

    http://www.emedicine.com/cgi-bin/foxweb.exe/[email protected]/em/makezoom?picture=/websites/emedicine/med/images/Large/39193918med0899-01.jpg&template=izoom2http://www.emedicine.com/cgi-bin/foxweb.exe/[email protected]/em/makezoom?picture=/websites/emedicine/med/images/Large/39193918med0899-01.jpg&template=izoom2
  • 8/10/2019 Bimbingan Coas Hematologi

    9/53

    Anemia Def Besi

    1. Hb kurang dari usia

    2. Fe serum < 50 Ug/dl

    3. Saturasi transferin < 15 %

    4. Free Erythrocyte Protoporphyrin (FEP)me >>

    5. TIBC me >>

    6. GDT : anemia hipokrom mikrositer

  • 8/10/2019 Bimbingan Coas Hematologi

    10/53

    Anemia Def B12/As.folat

  • 8/10/2019 Bimbingan Coas Hematologi

    11/53

    Normal Thalassemia-

    heterosigot Defisiensi besi

  • 8/10/2019 Bimbingan Coas Hematologi

    12/53

    Gangguan Leukosit

    Netropenia

    Gangguan Trombosit :

    ITP

    Gangguan pembekuan darah :hemofilia, von willebrand, def vit K,

  • 8/10/2019 Bimbingan Coas Hematologi

    13/53

    From Human to DNA

    Genes

    ..TGATTCGGT

    AATGACAGT..

    Cells

    Chromosomes

    DNA

    Human

  • 8/10/2019 Bimbingan Coas Hematologi

    14/53

    23 chromosome pairs

    3 billion nucleotides(3000000000)

    30.000 genes

  • 8/10/2019 Bimbingan Coas Hematologi

    15/53

    1 2 3 45 UTR 3 UTR

    From Chromosome toGene

  • 8/10/2019 Bimbingan Coas Hematologi

    16/53

    Transcription

    Transcription

    1 2 3 4

    Start (ATG) Stop (TGA, TAA, TAG)

    Genomic DNA

    5 UTR 3 UTR

    1 2 3 4

    Start (AUG) Stop (UGA, UAA, UAG)

    Primary RNA

    5 UTR 3 UTR

    2 copies

    many

    copies

  • 8/10/2019 Bimbingan Coas Hematologi

    17/53

    DNA: Deoxyribonucleic acid

    RNA: Ribonucleic acid

    A: Adenine

    T: Thymine

    G: Guanine

    C: Cytosine

    U: Uracil (replaces T)

    Double stranded

    ATTGCG

    TAACGC

    Single stranded

  • 8/10/2019 Bimbingan Coas Hematologi

    18/53

    Splicing

    Primary RNA

    1 2 3 4

    Start (AUG) Stop (UGA, UAA, UAG)

    5 UTR 3 UTR

    2 315 UTR 4 3 UTRmRNA

    Start Stop

    splicing2 3

    2 3

    GT AGIntron 2

    exons

    introns

  • 8/10/2019 Bimbingan Coas Hematologi

    19/53

    Primary RNA

    1 2 3 4

    Start (AUG) Stop (UGA, UAA, UAG)

    5 UTR 3 UTR

    2 315 UTR 4 3 UTRmRNA

    315 UTR 4 3 UTRmRNA

    215 UTR 4 3 UTRmRNA

    15 UTR 4 3 UTRmRNA

    Splicing: Flexibility

  • 8/10/2019 Bimbingan Coas Hematologi

    20/53

    Translation

    2 315 UTR 4 3 UTRmRNA

    Start Stop

    NC

    Nucleus

    Cytoplasm2 315 UTR 4 3 UTR

  • 8/10/2019 Bimbingan Coas Hematologi

    21/53

    2 315 UTR 4 3 UTRmRNA

    Start Stop

    CCGGAUGCACUUGAAAUAAGCUA

    GUG

    H

    UUU

    K

    CCGGAUGCACUUGAAAUAAGCUA

    L

    AAC

    UAC

    M

    UAC

    M

  • 8/10/2019 Bimbingan Coas Hematologi

    22/53

    CCGGAUGCACUUGAAAUAAGCUA

    UACGUGAAC

    GUG

    MHL

    K

    GUG UAC

    M

    GUG

    H

    AAC

    LK

    CCGGAUGCACUUGAAAUAAGCUAGUG

    H

    UUU

    K

    CCGGAUGCACUUGAAAUAAGCUA

    L

    AAC

    UAC

    M

    UAC

    M

  • 8/10/2019 Bimbingan Coas Hematologi

    23/53

    CCGGAUGCACUUGAAAUAAGCUA

    M H L K

    mRNA

    protein

  • 8/10/2019 Bimbingan Coas Hematologi

    24/53

    Gene

    Transcription

    Primary RNA

    Splicing

    mRNA

    Export to cytoplasm

    Translation

    Protein

  • 8/10/2019 Bimbingan Coas Hematologi

    25/53

    Bonecell

    Livercell

    Neuron

    Cell-type specificexpression

  • 8/10/2019 Bimbingan Coas Hematologi

    26/53

    Cell-type specific expression

    Temporal regulation

    Coexpression with other genes

    The transcription translation system allows

    the formation of a complex life form such asa human being out of 30.000 genes

    If everything goes fine

  • 8/10/2019 Bimbingan Coas Hematologi

    27/53

    Mutations

    Abberant expression

    Genetic disease

    If something goes wrong

  • 8/10/2019 Bimbingan Coas Hematologi

    28/53

  • 8/10/2019 Bimbingan Coas Hematologi

    29/53

    ONKOLOGI ANAK

    Leukemia Akut

    30-40% dari keganasan

    LLA 82%, LMA 18%

    Translokasi (9;22), (8;21), (15;17)

    Gen PML, LMA-1

  • 8/10/2019 Bimbingan Coas Hematologi

    30/53

    Limfoma maligna (NHL)

    Keganasan sel limfosit

    Beda dengan Hodgkin : sel retikulum

    Translokasi p8, t(8;14), (q24;q32)

  • 8/10/2019 Bimbingan Coas Hematologi

    31/53

    Neuroblastoma

    10 %

    Sepanjang syaraf simpatis : 65% diabdomen

  • 8/10/2019 Bimbingan Coas Hematologi

    32/53

    Wilms tumor / nefroblastoma

    Massa di abdomen 75-90%

    Hematuri makroskopis

    hipertensi

  • 8/10/2019 Bimbingan Coas Hematologi

    33/53

    Rabdomiosarkoma

    Histiositosis

    retinoblastoma

  • 8/10/2019 Bimbingan Coas Hematologi

    34/53

    Fig. 1 Phospholipid-bound reactions that are involved in the activation of coagulation. TF

    (green) is exposed on extravascular cells after vascular injury and binds circulating FVIIa. The

    TF-FVIIa complex activates the vitamin K-dependent FIX and FX with high efficiency

    and the activated factors either remain on the surface of the activating cell or diffuse intosolution and binds to the platelets. On the surface of activated platelets, the enzymes FIXa and

    FXa together with their respective cofactor FVIIIa and FVa form the tenase and prothrombinase

    complexes that activate FX and prothrombin respectively. Thrombin-mediated activation of FV

    and FVIII give positive feedback amplification of the system. FVIII circulates in plasma bound to

    the high molecular weight von Willebrand factor (VWF) and thrombin activation results in the

    liberation of the FVIIIa from VWF. The FVIIIa binds to the platelet surface and form the tenase

    complex with FIXa. Activated FV (FVa) forms the prothrombinase complex with FXa, whichefficiently generates thrombin from prothrombin.

  • 8/10/2019 Bimbingan Coas Hematologi

    35/53

  • 8/10/2019 Bimbingan Coas Hematologi

    36/53

    Sistem Imun

    Nonspesifik Spesifik

    Fisik Larut Selular Humoral Selular

    Kulit

    Sel. Lendir

    Silia

    Batuk

    Bersin

    Biokimia

    Lisozim (keringat)

    Sekresi sebaseus

    Asam lambung

    Laktoferin

    Asam neuraminik

    Batuk

    Humoral

    Komplemen

    Interferon

    CRP

    Kolektin

    Fagosit

    Mono

    PMN

    Sel NK

    Sel mast

    Basofil

    Sel B

    IgG

    IgA

    IgM

    IgD

    IgE

    Sel T

    Th1

    Th2

    Ts/Tr

    Tdth

    Tc

  • 8/10/2019 Bimbingan Coas Hematologi

    37/53

    SpecificNonspecific

    Sistem Imun Nonspesifik dan Spesifik

  • 8/10/2019 Bimbingan Coas Hematologi

    38/53

    Menegakkan diagnosis

    Anamnesis

    Demam lama, pucat, perdarahan,

    memar/biru, BB turun, BAK coca cola, BABhitam, kelainan kulit, pusing, muntahprofuse, benjolan di perut/dll

  • 8/10/2019 Bimbingan Coas Hematologi

    39/53

    Pemeriksaan fisik

    1. Vital sign tanda-tanda kegawatan/

    ggn oksigenisasi

    2. Kepala s/d kaki

    3. Organomegali

    4. KGB

  • 8/10/2019 Bimbingan Coas Hematologi

    40/53

    10 Darah Besar

    1. Hb

    2. Ht

    3. Leukosit

    4. LED

    5. D/C

    6. Trombosit

    7. MCH

    8. MCV

    9. MCHC

    10. Gambaran darah Tepi

  • 8/10/2019 Bimbingan Coas Hematologi

    41/53

    CT, BT pT, aPTT Fe serum TIBC As Urat Na

    K Ureum Kreatinin

  • 8/10/2019 Bimbingan Coas Hematologi

    42/53

    Urine rutin

    Feses rutin

    Rontgen BMP

    Biopsi

    USG CT Scan

    Marker tumor

  • 8/10/2019 Bimbingan Coas Hematologi

    43/53

    terapi

    1. Suportif : isolasi, bed rest

    2. Diet : mkn lunak

    3. Kurangi aktivitas

    4. Edukasi ke orang tua

    5. Simptomatik : transfusi

    6. Kemoterapi, radioterapi, operasi

  • 8/10/2019 Bimbingan Coas Hematologi

    44/53

    monitor

    Fungsi hepar

    Fungsi ginjal

    Organ vital lain : jantung, dll

    Elektrolit

    Homeostasis

    Darah infeksi ?

  • 8/10/2019 Bimbingan Coas Hematologi

    45/53

  • 8/10/2019 Bimbingan Coas Hematologi

    46/53

    DR, 5 thn

    Hb : 8

    Ht : 24

    Leukosit : 1.500

    LED : 20

    Trombosit 40.000

    d/c : 0/0/10/60/25/5

  • 8/10/2019 Bimbingan Coas Hematologi

    47/53

    DR, 5 thn

    Hb : 14

    Ht : 44

    Leukosit : 7.500

    LED : 5

    Trombosit 250.000

    d/c : 0/0/3/75/17/5

  • 8/10/2019 Bimbingan Coas Hematologi

    48/53

    DR, 5 thn

    Hb : 12

    Ht : 36

    Leukosit : 10.500

    LED : 40

    Trombosit 440.000

    d/c : 0/0/3/55/37/5

  • 8/10/2019 Bimbingan Coas Hematologi

    49/53

    DR, 5 thn

    Hb : 10

    Ht : 30

    Leukosit : 2.500

    LED : 20

    Trombosit 66.000

    d/c : 0/0/0/0/100/0

  • 8/10/2019 Bimbingan Coas Hematologi

    50/53

    DR, 5 thn

    Hb : 12

    Ht : 36

    Leukosit : 7.500

    LED : 12

    Trombosit 40.000

    d/c : 0/0/0/60/40/0

  • 8/10/2019 Bimbingan Coas Hematologi

    51/53

    DR, 5 thn

    Hb : 11

    Ht : 33

    Leukosit : 10.500

    LED : 10

    Trombosit 210.000

    d/c : 0/10/0/60/30/0

  • 8/10/2019 Bimbingan Coas Hematologi

    52/53

    DR, 5 thn

    Hb : 12

    Ht : 36

    Leukosit : 5.000

    LED : 10

    Trombosit 110.000

    d/c : 0/0/12/36/52/0

  • 8/10/2019 Bimbingan Coas Hematologi

    53/53