Post on 16-Oct-2021
Biorremediacioacuten de suelos contaminados con hidrocarburos
aromaacuteticos policiacuteclicos
Raquel Simarro Doblado
Dra Natalia Gonzaacutelez y Dra Mariacutea del Carmen Molina profesoras titulares del
Departamento de Biologiacutea y Geologiacutea de la Universidad Rey Juan Carlos
CERTIFICAN
Que los trabajos de investigacioacuten desarrollados en la memoria de tesis doctoral
ldquoBiorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicosrdquo son aptos para ser presentados por la Lda Raquel Simarro Doblado ante el
Tribunal que en su diacutea se consigne para aspirar al Grado de Doctor en Ciencias
Ambientales por la Universidad Rey Juan Carlos de Madrid
VordmBordm Director Tesis VordmBordm Director de Tesis
Dra Natalia Gonzaacutelez Beniacutetez Dra Mordf Carmen Molina
A mi familia a Javi y amigos todos ellos forman parte de esta tesis como si de un capiacutetulo se tratase
A todos gracias por formar parte de los capiacutetulos de mi vida
Iacutendice
I Resumen Antecedentes 13 Objetivos 25 Listado de manuscritos 27 Siacutentesis de capiacutetulos 29 Metodologiacutea general 33
Capiacutetulo 1a Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium 47
b Evaluation of the influence of multiple environmental factors on the biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal experimental design 67
Capiacutetulo 2 Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process 85
Capiacutetulo 3 High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures 113
Capiacutetulo 4 Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil change in bacterial community 143
II Discusioacuten general 171
III Conclusiones generales 181
IV Referencias bibliograacuteficas 185
V Agradecimientos 195
Resumen
AntecedentesObjetivos
Listado de manuscritosSiacutentesis de capiacutetulosMetodologiacutea general
I
Resumen Antecedentes
13
Antecedentes
Tal y como su propio nombre indica biorremediacioacuten significa ldquodar remediordquo mediante
teacutecnicas bioloacutegicas por lo que una definicioacuten acertada de biorremediacioacuten seriacutea el conjunto
de teacutecnicas que permiten resolver problemas de contaminacioacuten mediante el uso de
microorganismos (bacterias algas unicelulares etc) hongos plantas o enzimas derivadas
de ellos En el contexto de esta tesis la biorremediacioacuten se aplica a suelos u otros sistemas
contaminados con hidrocarburos aromaacuteticos policiacuteclicos (HAP o PAH siglas en ingleacutes
polyciclic aromatic hydrocarbons) Los HAP son compuestos que se generan por la
combustioacuten incompleta de combustibles foacutesiles por causas naturales y en mayor medida
antroacutepicas Si tenemos en cuenta que el sustento del sistema energeacutetico mundial son los
combustibles foacutesiles podemos hacernos una idea de la relevancia y elevada presencia de
estos compuestos en la vida cotidiana Considerando sus complejas propiedades y su
caraacutecter perjudicial para el ser humano y los ecosistemas (Internacional Agency for
Research on Cancer 1972-1990) los HAP suscitaron una creciente preocupacioacuten a partir
del pasado siglo siendo los primeros carcinoacutegenos ambientales reconocidos (Haritash amp
Kaushik 2009) Eacutesto dio lugar a numerosos estudios cientiacuteficos con el objetivo de
determinar sus efectos en el medio y el ser humano asiacute como a la buacutesqueda de soluciones
para su eliminacioacuten Frente a muchas otras teacutecnicas de eliminacioacuten de contaminantes
(teacutecnicas fiacutesicas yo quiacutemicas) la biorremediacioacuten presenta una caracteriacutestica clave que la
hace destacar sobre las otras teacutecnicas y es que se basa en procesos que respetan el medio
perturbado y permiten en la medida de lo posible su recuperacioacuten
Los hidrocarburos aromaacuteticos policiacuteclicos (HAP) Legislacioacuten espantildeola sobre medios
contaminados
La presente tesis se centra en el estudio de la biodegradacioacuten de los hidrocarburos
aromaacuteticos policiacuteclicos y por ello es esencial conocer a fondo queacute son cuaacuteles son sus
caracteriacutesticas y porqueacute suscitan este intereacutes Los HAP son compuestos quiacutemicos formados
por la fusioacuten de un determinado nuacutemero de anillos de su principal componente aromaacutetico el
benceno La estructura quiacutemica de alguno de los compuestos que han sido utilizados
durante el desarrollo de esta tesis aparecen en la Figura 1
Resumen Antecedentes
14
Figura 1 Hidrocarburos aromaacuteticos poliacuteciacuteclicos de bajo (naftaleno fenantreno y antraceno) y alto peso
molecular (pireno y perileno)
Los HAP se pueden clasificar en funcioacuten del nuacutemero de anillos benceacutenicos en HAP de
bajo (menos de tres anillos) y de alto peso molecular Tan soacutelo el naftaleno fenantreno y
antraceno (dos y tres anillos respectivamente) seriacutean considerados HAP de bajo peso
molecular (Cerniglia 1984 1992) La propiedades quiacutemicas de los HAP y por tanto su
destino en el medioambiente depende del nuacutemero de anillos aromaacuteticos que lo componen y
de su tipologiacutea molecular (Kanaly amp Harayama 2000) Por ejemplo el fenantreno y
antraceno son compuestos isoacutemeros (Figura 1) con el mismo peso molecular porque tienen
el mismo nuacutemero de anillos benceacutenicos pero en distinta disposicioacuten lo que les confiere
distintas caracteriacutesticas quiacutemicas En general a medida que aumenta su tamantildeo peso
molecular y angularidad aumenta su hidrofobicidad y estabilidad electroquiacutemica (Zander
1983) Tal y como algunos trabajos han demostrado eacutestos son dos factores primarios que
contribuyen a la persistencia de los HAP en el medio Por ejemplo de acuerdo con
Shuttleworth amp Cerniglia (1995) la vida media en suelos y sedimentos de un HAP de tres
anillos como el fenantreno podriacutea oscilar en un rango de entre 6 a 126 diacuteas mientras que
para moleacuteculas de cuatro a cinco anillos el tiempo aumentariacutea de 229 a maacutes de 1400 diacuteas
Ademaacutes debido a su naturaleza lipofiacutelica tiene un elevado potencial de bioacumulacioacuten en la
cadena troacutefica fenoacutemeno conocido como biomagnificacioacuten (Clements et al 1994) Se sabe
que los HAP ejercen un acusado efecto toacutexico y poseen propiedades mutageacutenicas
teratogeacutenicas y en algunos casos carcinogeacutenicas (Internacional Agency for Research on
Cancer 1972-1990) De hecho dieciseacuteis HAP han sido clasificados como contaminantes
prioritarios por la US Environmental Protection Agency (Agencia de proteccioacuten ambiental
Resumen Antecedentes
15
de Estados Unidos) y por la Comisioacuten Europea de Medio Ambiente (Maliszewska-Kordybach
1996)
Los HAP estaacuten presentes como constituyentes naturales de los combustibles foacutesiles y
se forman durante la combustioacuten incompleta de la materia orgaacutenica Las fuentes naturales
de produccioacuten de HAP son los incendios forestales y de pastizales yacimientos de petroacuteleo
o erupciones volcaacutenicas (Haritash amp Kaushik 2009) Sin embargo las fuentes antroacutepicas
son las que maacutes contribuyen a su formacioacuten mediante la quema de combustibles foacutesiles con
fines energeacuteticos en el tratamiento de la madera con creosota mediante el uso de
lubricantes y en el refino del petroacuteleo y actividades de transporte (Lee et al 1981) Aunque
los vertidos se produzcan en una zona determinada es posible que la carga contaminante
se extienda si alcanza un efluente o mediante su filtracioacuten a traveacutes del suelo pudiendo
alcanzar acuiacuteferos Otras cargas contaminantes se generan por descarga directa
procedentes de efluentes industriales en grandes superficies de suelos o mares o por la
liberacioacuten accidental de materia prima (Kanaly amp Harayama 2000) Se han detectado HAP
en el aire procedente fundamentalmente de la quema industrial de combustibles foacutesiles y el
traacutefico (Koeber et al 1999 Lim et al 1999) en suelos y en la parte superficial y profunda
de la columna de agua y sedimentos (Readman et al 2002 Johnsen et al 2005 2006) En
alimentos vegetales y plantas aparecen como consecuencia de la difusioacuten y posterior
sedimentacioacuten de los HAP atmosfeacutericos sobre la vegetacioacuten (Wagrowski amp Hites 1997) y
por la adsorcioacuten de HAP acumulados en el agua del suelo
El suelo constituye uno de los medios receptores de la contaminacioacuten maacutes sensibles y
vulnerables Sin embargo y auacuten dada la gravedad y extensioacuten creciente de la contaminacioacuten
con HAP no fue hasta la Conferencia de Naciones Unidas sobre el Medio Ambiente y el
Desarrollo celebrada en Riacuteo de Janeiro en 1992 cuando se reconocioacute y planteoacute de forma
trascendente la importancia de la proteccioacuten de los suelos y la definicioacuten de sus usos
potenciales La Agencia Europea de Medio Ambiente (AEMA) estimoacute en 1999 que el
nuacutemero de zonas o aacutereas contaminadas en Europa Occidental estaba entre 300000 y
1500000
Hasta la promulgacioacuten de la Ley 101998 de 21 Abril de Residuos Espantildea careciacutea de
cualquier instrumento normativo para legislar controlar y proteger lo referente a suelos
contaminados Con esta Ley las Comunidades Autoacutenomas son las encargadas de declarar
delimitar e inventariar los suelos contaminados de sus territorios ademaacutes de establecer las
bases para una determinada actuacioacuten Con el Real decreto 92005 del 14 de Enero se da
cumplimiento a lo dispuesto en la 101998 de Residuos y en eacutel se establece la relacioacuten de
actividades potencialmente contaminantes del suelo y los criterios y estaacutendares para la
Resumen Antecedentes
16
declaracioacuten de un suelo bajo la categoriacutea de ldquocontaminadordquo Uno de los aspectos maacutes
importantes desde el punto de vista de la biorremediacioacuten se recoge en el Artiacuteculo 7 del
Real Decreto 92005 por el cual ldquola declaracioacuten de un suelo como contaminado obligaraacute a la
realizacioacuten de las actuaciones necesarias para proceder a su recuperacioacuten ambientalrdquo
Ademaacutes antildeade que las teacutecnicas deben ser las maacutes apropiadas en cada caso garantizando
soluciones de caraacutecter permanente y prioriza las teacutecnicas de tratamiento in situ que eviten la
generacioacuten traslado y eliminacioacuten de residuos
Lo dispuesto en esta ley sin duda supone un enorme impulso a las teacutecnicas de
biorremediacioacuten ya que a traveacutes de ellas se favorece el tratamiento in situ y la recuperacioacuten
del ecosistema a su estadio original sin generacioacuten de residuos y con el menor impacto
ambiental posible
Factores que condicionan la biodegradacioacuten
Aunque la biodegradacioacuten bacteriana es una de las teacutecnicas maacutes eficaces en la
descontaminacioacuten in situ de medios contaminados con HAP la eficacia y tasas de
biodegradacioacuten dependen en gran medida del nuacutemero y tipo de microorganismo
degradador presente en el medio y de la naturaleza y estructura quiacutemica del contaminante a
degradar (Haritash amp Kaushik 2009) Ademaacutes a la hora de disentildear un sistema de
biorremediacioacuten debemos tener en cuenta que existen muacuteltiples factores ambientales que
van a condicionar la eficacia y la rapidez del proceso con el agravante de que durante la
aplicacioacuten in situ es difiacutecil y en algunos casos imposible poder controlar o modificar alguno
de estos factores La biorremediacioacuten es una teacutecnica eficaz y econoacutemica pero cuenta con la
desventaja del tiempo ya que en algunos casos la descontaminacioacuten del medio y su
recuperacioacuten pueden durar antildeos
Por tanto los estudios de optimizacioacuten en los que se combinen todos los factores
posibles considerando los efectos sineacutergicos y antagoacutenicos son esenciales en
biorremediacioacuten Entre los factores ambientales maacutes estudiados en la literatura destacamos
temperatura pH tipo y concentracioacuten de nutrientes inorgaacutenicos y fuentes de carbono
Temperatura y pH
La temperatura es una de las variables maacutes influyentes en el proceso de biodegradacioacuten
bacteriana ya que afecta tanto a las propiedades fisicoquiacutemicas de los HAP como al
Resumen Antecedentes
17
metabolismo microbiano La temperatura guarda una relacioacuten proporcional con los rangos
de difusioacuten y solubilidad de los HAP e inversamente proporcional con el coeficiente de
particioacuten suelo-agua (Wu amp Gschwend 1986) Mientras que el coeficiente de particioacuten de los
HAP decrece entre un 20-30 por cada incremento de 10ordmC en temperaturas comprendidas
entre los 5 ordmC - 45 ordmC el coeficiente de difusioacuten en agua aumenta entre 4-5 veces con un
incremento de la temperatura de 20 a 120 ordmC Esto se traduce en que cuanto menor es la
temperatura menor es la solubilidad de los HAP en la fase acuosa y consecuentemente
menor es su biodisponibilidad para ser mineralizados por los microorganismos (Haritash amp
Kaushik 2009)
Por otro lado las bajas temperaturas afectan negativamente al metabolismo
microbiano ralentizaacutendolo y aumentando la duracioacuten de la fase de latencia en la que hay
inactividad (Atlas amp Bartha 1972 Eriksson et al 2001) Tal y como se ha demostrado en
estudios previos (Leahy amp Colwell 1990) la velocidad de metabolizacioacuten normalmente se
duplica por cada aumento de 10 ordmC en temperaturas comprendidas entre los 10 y 40 ordmC Sin
embargo y a pesar de las desventajas que las bajas temperaturas presentan para la
biodegradacioacuten existe degradacioacuten de hidrocarburos en ambientes friacuteos cuyas temperaturas
oscilan entre los 0 ordmC ndash 10 ordmC (Margesin et al 2002) Algunos trabajos se han centrado en el
estudio de la biodegradacioacuten en zonas de agua marina y suelos bajo temperaturas
extremadamente bajas (Colwell et al 1978 Mohn amp Stewart 2000 Ericksson et al 2001
Delille amp Pelletiere 2002) obteniendo resultados positivos Sin embargo la mayoriacutea de los
estudios de biodegradacioacuten se han llevado a cabo en condiciones de laboratorio en un rango
de temperaturas comprendido entre los 20 ndash 35 ordmC sin observar a penas diferencias en las
tasas de biodegradacioacuten (Chen et al 2008) Por debajo de estas temperaturas la
degradacioacuten es maacutes complicada porque el metabolismo de los microorganismos se ralentiza
y la solubilizacioacuten de los HAP disminuye Aun asiacute hay bacterias adaptadas a estas
condiciones que hacen posible la degradacioacuten en ambientes con temperaturas extremas
Varias especies de Pseudomonas y Sphingomonas se han identificado como bacterias
degradadoras de HAP en la Antaacutertida (Aislabie et al 2000) Eacutestas y otras especies estaacuten
adaptadas a las temperaturas locales y a otras condiciones de estreacutes ya que durante el
deshielo sobreviven en suelos friacuteos y secos pobres en nutrientes y a menudo alcalinos Sin
embargo la capacidad de estas bacterias para crecer en suelos con condiciones climaacuteticas
suaves y la utilizacioacuten de HAP para su crecimiento implica que estas bacterias son
psicrotolerantes (Aislabie et al 2000) cuya temperatura oacuteptima es superior a los 20 ordmC pero
son capaces de sobrevivir cerca o por debajo de los 0 ordmC Ademaacutes existen algunas especies
cuyo crecimiento se desarrolla en ambientes que permanentemente esteacuten por debajo de los
5 ordmC este grupo de bacterias son psicroacutefilas La temperatura es un factor que difiacutecilmente se
puede controlar o manipular en proyectos de aplicacioacuten in situ por lo que es importante
Resumen Antecedentes
18
elaborar un estudio previo bajo las condiciones del ecosistema afectado Esto es
fundamental sobre todo en ambientes con temperaturas bajas en los que se puede estudiar
queacute otros factores modificar para suplir las desventajas de la temperatura como puede ser
inocular cepas bacterianas adaptadas a las bajas temperaturas aumentar el oxiacutegeno o
adicionar nutrientes En estas condiciones no toda la comunidad tiene por queacute ser eficaz en
la degradacioacuten de un contaminante aunque se ha propuesto que las bacterias y no los
hongos son las mayores colonizadoras y degradadoras (Kerry 1990) La identificacioacuten de
las especies de la poblacioacuten autoacutectona asiacute como la refrenciacioacuten de sus capacidades
metaboacutelicas son muy importantes en la biorremediacioacuten de suelos de ambientes friacuteos Esta
cuestioacuten es especialmente importante en la Antaacutertida ya que el Sistema del Tratado
Antaacutertico prohiacutebe la introduccioacuten de organismos aloacutectonos
Por otro lado el pH es un factor abioacutetico que de forma similar a la temperatura puede
afectar significativamente tanto a la actividad y diversidad microbiana como a la
mineralizacioacuten de los HAP Los rangos de pH oacuteptimos para el proceso de metabolizacioacuten
pueden ser muy variables ya que depende de las caracteriacutesticas del medio contaminado y
de la poblacioacuten microbiana que alberga (Dibble amp Bartha 1979) Las micobacterias son
bacterias neutroacutefilas cuyo pH oacuteptimo es superior 6 (Portaels amp Pattyn 1982) Sin embargo
a paritr de este pH se ha observado que la degradacioacuten de HAP por Mycobacterium es maacutes
eficaz cuando el pH tiende ligeramente a aacutecido (65) porque la membrana de aacutecidos
micoacutelicos es maacutes permeable a compuestos hidrofoacutebicos (Kim et al 2005) Otros autores
han mostrado que para otro tipo de bacterias comuacutenmente descritas en procesos de
biodegradacioacuten como Pseudomonas sp el rango oacuteptimo de pH oscila entre 55 y 78
notablemente mejor cuanto maacutes neutro (Dibble amp Bartha 1979) El uso de ciertos
surfactantes puede causar la basificacioacuten del medio (Bautista et al 2009) por lo que este
aspecto debe ser considerado a la hora de disentildear un proceso de biorremediacioacuten Tambieacuten
se pueden generar variaciones de pH durante el proceso como consecuencia de los
metabolitos intermedios derivados de los HAP Por ejemplo al comienzo de la degradacioacuten
se generan metabolitos con grupos hydroxiacutelicos que producen un aumento del pH (Habe amp
Omori 2003 Puntus et al 2008)
Nutrientes inorgaacutenicos
Ante una perturbacioacuten por un contaminante el requerimiento de nutrientes de las bacterias
degradadoras del ecosistema aumenta para poder metabolizar el aporte extra de carbono
que supone el contaminante Por este motivo en biorremediacioacuten es importante encontrar
una relacioacuten oacuteptima de carbononitroacutegenofoacutesforo (CNP) que tradicionalmente se han fijado
Resumen Antecedentes
19
en 100101 (ej Bouchez et al 1995) Sin embargo este aspecto es objeto de controversia
ya que otros autores (Leys et al 2005) han demostrado que la relacioacuten anteriormente
propuesta como oacuteptima puede ser insuficiente limitando el crecimiento bacteriano y por
tanto ralentizando la biodegradacioacuten La bioestimulacioacuten es una teacutecnica de biorremediacioacuten
que consiste en la adicioacuten de nutrientes inorgaacutenicos a los substratos contaminados La
disponibilidad de nutrientes es un aspecto muy importante en la eficacia de la
biodegradacioacuten Nutrientes como el nitroacutegeno el foacutesforo o el hierro son esenciales para el
metabolismo bacteriano en general y mucho maacutes en el caso de biorremediacioacuten de medios
contaminados por HAP Aunque la mayoriacutea de los trabajos indican que la adicioacuten de
nutrientes mejora el proceso algunos autores (Yu et al 2005) obtuvieron resultados
opuestos La diferencia entre unos resultados y otros radican en que la necesidad de
nutrientes depende del tipo de bacteria tipo de hidrocarburo y de las condiciones del medio
(Leys et al 2005) El hierro es un nutriente esencial necesario en el proceso de
biodegradacioacuten ya que por un lado es cofactor de las enzimas que catalizan la oxidacioacuten de
los HAP y por otro se ha relacionado con la produccioacuten de biosurfactantes para potenciar la
solubilidad de los HAP (Wei et al 2003) Sin embargo determinar la proporcioacuten oacuteptima de
este nutriente es fundamental pues altas concentraciones pueden ser toacutexicas (Santos et al
2008) Es tambieacuten una cuestioacuten a considerar la forma en la que se adicionan o se
encuentran los nutrientes en el medio ya que condiciona su biodisponibilidad Asiacute algunos
autores (Schlessinger 1991) proponen que las formas oxidadas como nitratos son maacutes
solubles que las formas reducidas como amonio que ademaacutes tiene propiedades
adsorbentes Establecer si un determinado problema medioambiental requiere un aporte
exoacutegeno de nutrientes es por tanto una cuestioacuten a discutir que probablemente dependa de
otras variables bioacuteticas y abioacuteticas
Fuentes de carbono laacutebiles
La adicioacuten a un medio contaminado de otras fuentes de carbono faacutecilmente biodegradables
se considera una alternativa que puede favorecer la biodegradacioacuten porque aumenta la
biomasa de la poblacioacuten microbiana y por tanto de la poblacioacuten degradadora Realmente se
puede entender como una forma de bioestimulacioacuten enfocada a aumentar y estimular el
crecimiento bacteriano o su actividad y por consiguiente la degradacioacuten Algunas de las
sustancias tratadas con este fin son el piruvato que estimula el crecimiento de ciertas cepas
bacterianas o el salicilato que induce la activacioacuten de enzimas degradadoras En el caso de
la glucosa su raacutepida asimilacioacuten y aumento de biomasa asociado se podriacutea traducir en un
aumento de la biodegradacioacuten (Ye et al 1996) Lee et al (2003) propusieron y
comprobaron que el piruvato potenciaba el crecimiento de la cepa degradadora
Resumen Antecedentes
20
Pseudomonas putida lo que se tradujo en un aumento de la tasa de biodegradacioacuten de
naftaleno Chen amp Aitken (1999) han comprobado que el salicilato induce la siacutentesis de
enzimas cataboacutelicas y por tanto su adicioacuten favorece la metabolizacioacuten de HAP siempre
que su concentracioacuten en el medio no supere una concentracioacuten liacutemite inhibitoria Wong et al
(2000) observoacute que la adicioacuten de glucosa favoreciacutea el crecimiento total de la poblacioacuten pero
las tasas de biodegradacioacuten fueron significativamente menores Estos resultados se deben
a que la cepa o consorcio degradador es capaz de mineralizar un HAP como uacutenica fuente de
carbono y la asimilacioacuten de glucosa inhibe la siacutentesis de enzimas implicadas en la
degradacioacuten del contaminante Es necesario valorar en cada caso de estudio coacutemo afecta la
adicioacuten de una nueva fuente de carbono ya que en el caso de bacterias no pre-adaptadas a
degradar HAP es posible que sus efectos sean positivos (Wong et al 2000) pero en
poblaciones microbianas histoacutericamente adaptadas a substratos contaminados la adicioacuten de
glucosa puede favorecer el crecimiento de microorganismos heteroacutetrofos no degradadores
Importancia y efecto de los surfactantes en la biodegradacioacuten de HAP
La baja solubilidad de los HAP y de la mayoriacutea de los compuestos del petroacuteleo limita la
capacidad de los microorganismos para acceder y degradar los compuestos contaminantes
Los surfactantes son tensioactivos que actuacutean disminuyendo la tensioacuten superficial del agua
para facilitar la disolucioacuten de los HAP en la fase acuosa En algunos estudios (Bautista et al
2009) se ha demostrado que el uso de surfactantes en procesos de biodegradacioacuten es
necesario para solubilizar los HAP Muchas bacterias degradadoras de HAP han
desarrollado la capacidad de generar biosurfactantes (surfactantes de origen microbiano)
como parte de su superficie celular o como moleacuteculas liberadas extracelularmente (Fiechter
1992) Algunas de estas especies pertenecen a los geacuteneros Pseudomonas (P aeruginosa
P fluorescens) Rhodococcus Mycobacterium Lactobacillus Acinetobacter o
Sphingomonas Los biosurfactantes se clasifican en funcioacuten de su masa molecular en
biosurfactantes de bajo peso molecular como glicoliacutepidos o lipopeacuteptidos y de alto peso
molecular que incluyen moleacuteculas maacutes complejas como polisacaacuteridos anfipaacuteticos proteiacutenas
lipopolisacaacuteridos y lipoproteiacutenas Se han observado resultados muy contradictorios en
cuanto a sus efectos sobre las tasas de biodegradacioacuten por un lado positivos (Jing et al
2007) pero tambieacuten inhibitorios (Laha amp Luthy 1991) Los biosurfactantes de alto peso
molecular son eficaces en la estabilizacioacuten de emulsiones de aceite en agua mientras que
los de bajo peso molecular son maacutes eficaces en la disminucioacuten de la tensioacuten interficial y
superficial (Rosenberg amp Ron 1999) En el caso de los surfactantes sinteacuteticos su eficacia
estaacute determinada por sus propiedades de carga (no ioacutenicos anioacutenicos o catioacutenicos) su
balance hidrofiacutelico-lipofiacutelico y su concentracioacuten micelar criacutetica (CMC) concentracioacuten a la cual
Resumen Antecedentes
21
la tensioacuten superficial es miacutenima y los monoacutemeros de surfactante se agregan formando
micelas Sin embargo algunos surfactantes pueden inhibir la mineralizacioacuten de los HAP por
cuestiones como la toxicidad del medio derivada de una elevada concentracioacuten de
surfactantes la cual resulta toacutexica para los microorganismos (ej Tergitol NP-10) o porque
al solubilizarse los HAP por accioacuten del surfactante aumenta toxicidad del medio (Liu et al
2001) En algunos casos ademaacutes los surfactantes no son biodegradables (Bautista et al
2009) De hecho Bautista et al (2009) comprobaron que el surfactante no ioacutenico Tergitol
NP-10 es un surfactante no biodegradable y toacutexico para los microorganismos en
comparacioacuten con el Tween-80 Dada la amplia variabilidad de resultados referentes a los
surfactantes es importante la eleccioacuten correcta en cada proceso considerando el tipo de
contaminante a eliminar y los microorganismos presentes en el medio
Biodegradacioacuten bacteriana cepas y consorcios microbianos degradadores de HAP
Son muchas las especies bacterianas descritas con capacidad degradadora de HAP la
mayoriacutea de ellas aisladas de aguas sedimentos y suelos previamente contaminados con
hidrocarburos La biodegradacioacuten de HAP de bajo peso molecular como el naftaleno
fenantreno y antraceno ha sido ampliamente estudiada Sin embargo son escasos los
estudios realizados sobre la biodegradacioacuten de HAP de alto peso molecular como el pireno
perileno acenafteno o fluoreno (Kanaly amp Harayama 2000) De acuerdo con Chauhan et al
(2008) especies de Pseudomonas y Ralstonia se relacionan en mayor medida con la
degradacioacuten de naftaleno y fenantreno Burkolderia y Stenotrophomonas con naftaleno
fenantreno y antraceno y otras especies pertenecientes a los geacuteneros Rhodococcus
Sphingomonas y Mycobacterium con HAP de mayor peso molecular como fluoranteno
benzo[a]pireno pireno benzo[b]fluoranteno Las especies bacterianas degradadoras
pertenecen a grupos filogeneacuteticos muy diversos y en muchos casos taxonoacutemicamente
alejados Trabajos previos (Vintildeas et al 2005 Molina et al 2009 Gonzaacutelez et al 2011)
muestran una gran parte de las bacterias degradadoras pertenecen al phylum
Proteobacteria en mayor proporcioacuten a las clases α- Proteobacteria (Sphingomonas
Bradyrizobium Nitrobacteria Balneimonas) y γ- (Pseudomonas Stenotrhophomonas
Enterobacter Pantoea Acinetobacter o Psychrobacter) Tambieacuten se han aislado especies
pertenecientes a la clase β- Proteobacterias (Ralstonia) y a los phylum Actinobacteria
(Microbacterium sp Rhodococcus sp) Firmicutes (Bacillus subtillis) y Bacteroidetes
(Flexibacter) aunque eacutestas en menor frecuencia Muchos de los trabajos de degradacioacuten
bacteriana se han realizado con cepas individuales (Grimberg et al 1996 Das amp Mukherjee
2006) extraiacutedas de suelos contaminados o bien con consorcios artificiales formados por
varias cepas degradadoras (Ghazali et al 2004) siendo muy pocos aquellos en los que se
Resumen Antecedentes
22
ha utilizado un consorcio bacteriano natural extraiacutedo directamente de un suelo Bautista et al
(2009) sentildeala que la capacidad de degradacioacuten de un consorcio artificial es mayor que la de
las cepas individuales Seguacuten algunos autores (Fritsche 1985 Mueller et al 1997) la mejor
eficiencia de degradacioacuten de un consorcio es debido a que la diversidad de especies permite
que cada una tenga un papel en el proceso de biodegradacioacuten facilitando la degradacioacuten de
HAP gracias al cometabolismo establecido entre las especies implicadas
Existe una importante controversia referente a la capacidad degradadora que
presentan los consorcios naturales ya que se ha observado que ciertos consorcios
extraiacutedos de zonas no contaminadas con HAP son capaces de metabolizar dichos
compuestos (Tian et al 2008 Couling et al 2010) Seguacuten estos autores es una
caracteriacutestica general presente en algunas comunidades microbianas que se expresa ante
una determinada perturbacioacuten Sin embargo Barkay amp Pritchart (1988) exponen que es una
caracteriacutestica que soacutelo estaacute presente en comunidades previamente expuestas y por lo tanto
preadaptadas como consecuencia de presiones selectivas Algunos autores (Jhonsen et al
2005) subrayan que la capacidad cataboacutelica se propaga faacutecilmente entre bacterias de un
mismo suelo contaminado como resultado de la transferencia horizontal de genes (ej
conjugacioacuten y transformacioacuten) Esto facilitariacutea auacuten maacutes que una comunidad no preadaptada
pueda hacer frente a una perturbacioacuten
Teacutecnicas de biorremediacioacuten
El objetivo uacuteltimo de la biorremediacioacuten es que el proceso de biodegradacioacuten se desarrolle
de la forma maacutes eficaz posible y por eso muchos trabajos se centran en la optimizacioacuten del
proceso mediante el desarrollo de teacutecnicas que aumenten la eficacia del mismo Teacutecnicas
como la bioestimulacioacuten anteriormente mencionada se centran en aumentar la capacidad
degradadora de la comunidad autoacutectona bacteriana mediante la adicioacuten de nutrientes
(nitroacutegeno foacutesforo potasio) de forma que la falta de nutrientes no suponga una limitacioacuten
para el metabolismo microbiano y por consiguiente para la biorecuperacioacuten de la zona
perturbada Otras teacutecnicas se basan en el aumento de la poblacioacuten degradadora mediante la
adicioacuten de cepas o consorcios con capacidad reconocida para metabolizar un determinado
compuesto es lo que se conoce como bioaumento En algunos trabajos los resultados
derivados de la bioestimulacioacuten y el bioaumento han sido positivos (Mills et al 2004
Atagana 2006) pero en trabajos como Chen et al (2008) o Yu et al (2005) los efectos de
ambas teacutecnicas en el proceso fueron negativos o simplemente no tuvieron efecto Se tiene
que tener en cuenta que ambas teacutecnicas generan cambios en las comunidades autoacutectonas
que afectan y modifican las relaciones de competencia Estos cambios pueden ser auacuten maacutes
Resumen Antecedentes
23
acusados en el caso del bioaumento pues la introduccioacuten de una comunidad foraacutenea puede
tener resultados difiacuteciles de predecir La atenuacioacuten natural es otra teacutecnica basada en la
mera actuacioacuten de la comunidad autoacutectona sin ninguacuten tipo de modificacioacuten de la comunidad
yo adicioacuten de sustancias Dowty et al (2001) entre otros defiende que cuando se trata de
restablecer el medio a las condiciones originales preservando la biodiversidad la
atenuacioacuten microbiana puede ser la mejor opcioacuten siempre que las poblaciones autoacutectonas
presenten capacidad degradadora
Resumen Objetivos
25
Objetivos
El objetivo general de la tesis es el conocimiento profundo de la biodegradacioacuten bacteriana
de hidrocarburos aromaacuteticos policiacuteclicos para la biorremediacioacuten y recuperacioacuten de medios
contaminados con estos compuestos toacutexicos El proyecto se ha centrado en la identificacioacuten
y conocimiento de la poblacioacuten bacteriana de consorcios procedentes de ambientes
(contaminados o no) y de su dinaacutemica ante determinadas condiciones durante el proceso de
biodegradacioacuten Para alcanzar este objetivo principal se fijaron objetivos especiacuteficos
desarrollados en cuatro capiacutetulos
1 Estudiar los factores abioacuteticos a fin de optimizar las condiciones de desarrollo en el
proceso de biodegradacioacuten de HAP en cultivos liacutequidos (capiacutetulo 1a) En un segundo
proyecto de optimizacioacuten el objetivo fue asemejar el proceso en laboratorio lo maacutes
posible a las condiciones naturales considerando los efectos derivados de la
interaccioacuten muacuteltiple de factores ambientales y bioloacutegicos (capiacutetulo 1b)
2 Analizar el efecto de la aplicacioacuten de distintos tipos de surfactantes (no ioacutenicos
biodegradables y no biodegradables) en la eficacia de degradacioacuten de HAP de un
consorcio bacteriano previamente adaptado (C2PL05) Asiacute mismo se quiso estudiar el
efecto del tipo de surfactante en la sucesioacuten y dinaacutemica del consorcio identificando los
microorganismos implicados a lo largo del proceso (capiacutetulo 2)
3 Estimar la capacidad degradadora de microcosmos inoculados con consorcios
procedentes de suelos con distinta historia de contaminacioacuten suelo croacutenicamente
contaminado (C2PL05) frente a un suelo procedente de un ambiente libre de
contaminacioacuten (BOS08) bajo condiciones climaacuteticas suaves y extremas Describir y
comparar las comunidades bacterianas que componen ambos consorcios (capiacutetulo 3)
4 Evaluar la eficacia de diversas teacutecnicas de biorremediacioacuten (atenuacioacuten natural
bioestimulacioacuten yo bioaumento) tanto en la eliminacioacuten del contaminante y la
toxicidad como en la capacidad de recuperacioacuten del ecosistema (capiacutetulo 4) Para el
desarrollo de este objetivo se llevoacute a cabo una simulacioacuten a pequentildea escala
(microcosmos) de un proceso de biorremediacioacuten in situ de suelos naturales
contaminados con creosota
Resumen Listado de manuscritos
27
Listado de manuscritos
Los capiacutetulos que integran este proyecto doctoral han sido redactados en ingleacutes para su
publicacioacuten en revistas cientiacuteficas de aacutembito internacional Por ello se presentan los
manuscritos originales de dichos artiacuteculos A continuacioacuten se detalla la traduccioacuten del tiacutetulo
los nombres de los coautores y el estado de publicacioacuten de los manuscritos
Capiacutetulo 1a Simarro R Gonzaacutelez N Bautista LF Sanz R y Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium
Water Air and Soil Pollution (2011) 217 365-374
Capiacutetulo 1b Simarro R Gonzaacutelez N Bautista LF y Molina MC
Evaluation of the influence of multiple environmental factors on the
biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial
consortium using an orthogonal experimental design
Water Air and Soil Pollution (Aceptado febrero 2012)
Capiacutetulo 2 Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L y Villa
JA
Effect of surfactants on PAH biodegradation by a bacterial consortium and
on the dynamics of the bacterial community during the process
Bioresource Technology (2011) 102 9438-9446
Capiacutetulo 3 - Simarro R Gonzaacutelez N Bautista LF y Molina MC
High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures
FEMS Microbiology Ecology (Subscrito Diciembre 2011 En revisioacuten)
Resumen Listado de manuscritos
28
Capiacutetulo 4 - Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez L y Peacuterez
M
Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil
change in bacterial community
Manuscrito ineacutedito
Resumen Siacutentesis de capiacutetulos
29
Siacutentesis de capiacutetulos
La presente tesis doctoral se desarrolla dentro de un proyecto de investigacioacuten basado en la
biorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicos y
sustancias contaminantes que los contengan Este proyecto se esta llevando a cabo desde
hace seis antildeos por el grupo de Biorremediacioacuten del Departamento de Biologiacutea y Geologiacutea de
la Universidad Rey Juan Carlos Los artiacuteculos citados anteriormente componen los cuatro
capiacutetulos que se desarrollan en el cuerpo de la tesis
Anteriormente al desarrollo de los experimentos que componen los capiacutetuos de la
presente tesis se realizoacute un trabajo (Molina et al 2009) en el que se estudioacute la capacidad
de degradacioacuten de un consorcio bacteriano extraiacutedo de un suelo croacutenicamente contaminado
y se describioacute su poblacioacuten bacteriana mediante teacutecnicas dependientes e independientes de
cultivo El consorcio fue capaz de degradar los HAP (naftaleno fenantreno y antraceno) en
maacutes de un 98 en un periodo de 18 diacuteas y ademaacutes eliminoacute completamente la toxicidad del
medio en 41 diacuteas La identificacioacuten molecular permitioacute aislar e identificar 5 cepas bacteriana
(DIC-1 a DIC-6 DIC Degrading isolated Culture) todas γ-Proteobacterias pertenecientes a
los geacuteneros Enterobacter Pseudomonas y Stenotrophomonas (maacutes detalles en Molina et al
2009) Ademaacutes el anaacutelisis de la poblacioacuten mediante electroforesis en un gel con gradiente
desnaturalizante (DGGE Denaturing Gradient Gel Electrophoresis) confirmoacute que estos tres
geacuteneros eran dominantes La alta eficacia en la degradacioacuten de los HAP y la escasa
biodiversidad tiacutepica de suelos sometidos a elevadas concentraciones de contaminantes
durante largos peridos de tiempo indican que el consorcio C2PL05 estaacute totalmente
adaptado a la degradacioacuten de HAP
En el capiacutetulo 1 se optimizoacute el proceso de biodegradacioacuten a traveacutes de dos disentildeos
experimentales diferentes que se recogen en los subcapiacutetulos 1a y 1b En el capiacutetulo 1a
se evaluacutea y mejora la influencia de varios factores ambientales como la relacioacuten molar de
CNP la fuente de nitroacutegeno fuente y concentracioacuten de hierro pH y fuente de carbono El
anaacutelisis estadiacutestico de las tasas de degradacioacuten (Kb) y los incrementos de la densidad celular
indicoacute que todos los factores fueron significativamente influyentes en la Kb Esto permitioacute
establecer un valor oacuteptimo de estos factores y descartar en los siguientes ensayos aquellos
paraacutemetros como el pH cuyo valor oacuteptimo (pH 7) seguacuten nuestros resultados coincidiacutea con
otros estudios y estaba claramente definido en la bibliografiacutea A partir de los resultados de
esta primera parte se realizoacute un segundo ensayo de optimizacioacuten ortogonal multifactorial
(capiacutetulo 1b) que permitioacute la optimizacioacuten de 8 factores de forma conjunta La concentracioacuten
de surfactante y de inoacuteculo bacteriano son dos factores que no fueron incluiacutedos en el
anterior anaacutelisis pero a traveacutes de la bibliografiacutea se consideraron factores importantes en la
Resumen Siacutentesis de capiacutetulos
30
biodegradacioacuten de HAP Los resultados confirmaron que la temperatura la fuente de
carbono y la concentracioacuten de inoacuteculo fueron factores significativos en el incremento de la
densidad celular pero soacutelo la fuente de carbono influyoacute significativamente el porcentaje total
de degrad acioacuten Estos resultados (capiacutetulo 1) permitieron conocer cuaacuteles son las
condiciones oacuteptimas del cultivo para una degradacioacuten maacutes eficaz de HAP con el consorcio
bacteriano C2PL05
El uso de surfactantes en la biodegradacioacuten de HAP puede optimizar la eficacia del
proceso y en algunos casos su uso es imprescindible Sin embargo su utilizacioacuten implica
un elevado coste y en ocasiones pueden tener efectos negativos dependiendo de la
concentracioacuten y tipo de surfactante En el capiacutetulo 2 se evaluacutea el efecto de dos
surfactantes no ioacutenicos Tergitol NP-10 (no biodegradable) y Tween-80 (biodegradable) en
la capacidad degradadora del consorcio microbiano C2PL05 teniendo en cuenta la
velocidad de degradacioacuten de los HAP y la dinaacutemica de la poblacioacuten microbiana durante el
proceso (teacutecnicas cultivo-dependientes e independientes) La degradacioacuten bacteriana de
los HAP y la reduccioacuten de la toxicidad del medio fue significativamente mejor con el
surfactante no ioacutenico y biodegradable Tween-80 Ademaacutes el tipo de surfactante utilizado
para optimizar la biodegradacioacuten de HAP afectoacute significativamente a la dinaacutemica de la
comunidad bacteriana del consorcio siendo especies pertenecientes a los geacuteneros
Pseudomonas Sphingomonas Sphingobium y Agromonas responsables de estas
diferencias Teoacutericamente la uacutenica funcioacuten del surfactante en el proceso de
biodegradacioacuten es aumentar la solubilidad de los HAP pero sin embargo en este capiacutetulo
se ha puesto de manifiesto que modifican notablemente las poblaciones bacterianas y la
sucesioacuten de especies pudiendo afectar a la eficacia del proceso Un estudio previo que
desemboque en la eleccioacuten del surfactante maacutes adecuado asiacute como su concentracioacuten
favorece la efiacacia de la biorremediacioacuten
El capiacutetulo 3 se centra en el estudio de la capacidad degradadora de los
microorganismos El principal objetivo es comprobar si la capacidad de degradacioacuten se
adquiere necesariamente tras un periodo de exposicioacuten a un contaminante o si bien es una
caracteriacutestica intriacutensecamente presente en algunas bacterias Se considera que la
temperatura es uno de los factores maacutes influyentes en el proceso de biodegradacioacuten de
manera que a temperaturas friacuteas (lt15 ordmC) o extremas (lt5 ordmC) se dificulta el proceso porque
afecta a la solubilidad de los HAP y al metabolismo microbiano Sin embargo existen
especies que toleran o estaacuten adaptadas a las bajas temperaturas y que ademaacutes pueden
degradar HAP En este capiacutetulo se avaluoacute la capacidad degradadora de un consorcio
preadaptado a HAP (C2PL05) frente a un consorcio extraiacutedo de una zona priacutestina rica en
madera en descomposicioacuten (BOS08) Al mismo tiempo se simularon dos ambientes de
Resumen Siacutentesis de capiacutetulos
31
biodegradacioacuten uno a temperaturas suaves comprendidas entre los 15 ordmC-25 ordmC y otro maacutes
extremo con temperaturas entre los 5 ordmC-15 ordmC todo ello en un sustrato soacutelido (suelo) con
objeto de ajustarnos a las condiciones naturales Sin duda el resultado maacutes significativo fue
que el consorcio BOS08 no adaptado a la degradacioacuten de HAP fue capaz de degradar
eficazmente e incluso mejor que el consorcio C2PL05 cuando las temperaturas fueron bajas
Ademaacutes se observoacute que aunque hubo geacuteneros exclusivos de cada consorcio (Ralstonia
Bacillus) otros fueron comunes en ambos (Microbacterium Acinetobacter Pseudomonas)
Los resultados obtenidos confirman la hipoacutetesis de que la capacidad de degradacioacuten estaacute
presente de forma intriacutenseca en algunas especies y no depende de una pre-exposicioacuten al
contaminante
En la biorremediacioacuten de un suelo contaminado con HAP es muy importante tener en
cuenta la respuesta de la poblacioacuten bacteriana autoacutectona del suelo frente a un episodio de
contaminacioacuten En el capiacutetulo 4 se estudioacute el comportamiento de la comunidad bacteriana
de un suelo previamente no contaminado cuando es perturbado con creosota La
biorremediacioacuten in situ es un proceso maacutes complejo que cuando se estudia bajo condiciones
controladas de laboratorio ya que hay factores como la escasez de nutrientes o las bajas
temperaturas que dificultan el proceso (capiacutetulos 1 y 3) Sin embargo la aplicacioacuten de
tratamientos in situ como la bioestimulacioacuten o el bioaumento pueden mejorar la eficacia de la
biorremediacioacuten En este capiacutetulo se determinoacute la respuesta de la comunidad bacteriana
frente a la bioestimulacioacuten el bioaumento o a la atenuacioacuten natural evaluando el porcentaje
de degradacioacuten de creosota y los HAP que la componen la reduccioacuten de la toxicidad y al
mismo tiempo estudiando los cambios poblacionales El criterio para la eleccioacuten de la
teacutecnica maacutes eficaz se determinoacute en funcioacuten de la eficacia en la degradacioacuten y en la
reduccioacuten de la toxicidad Los resultados mostraron que aunque la creosota se redujo
considerablemente y sin diferencias significativas entre tratamientos la toxicidad del medio
permanecioacute alta durante todo el proceso La ausencia de diferencias significativas entre
tratamientos en cuanto a la eliminacioacuten de creosta se refiere indica que la comunidad
autoacutectona del suelo tiene mcroorgasnimos con capacidad degradadora aunque previamente
no hayan estado expuestos a HAP Las bajas temperaturas a las que se desarrolloacute el
experimento fue la causa de que la toxicidad del medio no se redujera Cabe destacar la
importancia de las identificaciones mediante teacutecnicas no cultivables de especies
pertenecientes a los geacuteneros Balneimonas y Pantoea previamente no descritas en procesos
de biodegradacioacuten de creosota o HAP
Resumen Metodologiacutea general
33
Metodologiacutea general
Todos los materiales y meacutetodos estaacuten descritos y con sus respectivas refrencias en cada
uno de los capiacutetulos que se indican a continuacioacuten Sin embargo en algunos casos y dado
que la publicacioacuten de los datos en muchos casos obliga a ajustarse a los formatos de cada
revista especializada algunos meacutetodos no se han explicado en detalle en los capiacutetulos Este
apartado ldquoMetodologiacutea generalrdquo tiene como objetivo profundizar en el fundamento de
algunos de los meacutetodos utilizados durante el desarrollo de este proyecto
Preparacioacuten de consorcios bacterianos
El consorcio bacteriano C2PL05 fue utilizado en los experimentos de los capiacutetulos que
componen esta tesis como consorcio degradador de HAP Este consorcio fue extraiacutedo de un
suelo croacutenicamente contaminado con HAP (Figura 2A) de una refineriacutea de petroacuteleo situada
en Puertollano Ciudad Real (Espantildea) Su capacidad degradadora se verificoacute en un cultivo
semicontinuo en matraces Erlenmeyer de 100 ml que conteniacutean 50 ml BHB con Tween-80
(1 vv) y naftaleno fenantreno (05 gmiddotlminus1) y antraceno (005 gmiddotlminus1) realizando refrescos del
medio cada 15 diacuteas
Cuando se indique (capiacutetulo 3) se preparoacute un consorcio de un suelo procedente de un
bosque (43ordm 4175acuteN 8ordm 0683acuteO Frgas do Eume Galicia Espantildea Figura 2B) totalmente
libre de contaminacioacuten por HAP al que se denominoacute BOS08 El suelo se obtuvo de la parte
maacutes superficial por lo que teniacutea un alto contenido en materia orgaacutenica y restos de madera
muerta
Figura 2 Suelo contaminado procedente de la refineriacutea (A) y suelo
procedente de bosque (B) de los cuales se extrajeron los consorcios
C2PL05 y BOS08 respectivamente
A B
Resumen Metodologiacutea general
34
Para la extraccioacuten de ambos consorcios bacterianos 1 g de suelo se resuspendioacute en
10 ml de solucioacuten salina PBS (pH 70) y se mantuvo en agitacioacuten constante a 150 rpm en
oscuridad y a 25ordmC durante 24 horas Posteriormente se formoacute un cultivo madre de cada
consorcio en 50 ml de BHB con la mezcla de HAP que se fuera a utilizar en el experimento
tween-80 (1 vv) como surfactante y 15 ml del extracto de cada consorcio Los cultivos se
incubaron en un agitador orbital a 150 rpm y 25ordmC hasta que alcanzara la fase exponencial
En este momento se inoculaba la cantidad de cultivo madre necesario en los microcosmos
de los experimentos en funcioacuten de la concentracioacuten de inoacuteculo deseada en los mismos
Disentildeos experimentales
En este apartado se explica el disentildeo y la composicioacuten de los experimentos que conforman
los capiacutetulos de esta tesis para facilitar su comprensioacuten Generalizando los capiacutetulos 1 (1a y
1b) y 2 tratan de optimizar el medio nutritivo suministrado al consorcio C2PL05 el tipo y
concentracioacuten de surfactante y otros factores ambientales para lo cual los microcosmos
eran cultivos liacutequidos incubados en Erlenmeyers en un agitador orbital Los capiacutetulos 3 y 4
se centran en el estudio de la biodegradacioacuten de HAP en sustrato soacutelido (arena de riacuteo y
suelo natural respectivamente) para reproducir en la medida de los posible las condiciones
naturales
En el capiacutetulo 1a se optimizaron 6 factores (3 posibles valores cada factor) de forma
individual y consecutiva En total se desarrollaron 18 tratamientos en cultivos liacutequidos (3
reacuteplicas) incubados en un agitador orbital a 150 rpm 25 ordmC y oscuridad (Figura 3) durante
168 horas En el capiacutetulo 1b el disentildeo ortogonal L18 (37) (21) permitioacute mediante el desarrollo
de 18 tratamientos (3 reacuteplicas cada uno) la optimizacioacuten de 8 factores 7 de ellos con 3
posibles valores (37) y un factor con dos valores (21) Un total de 54 cultivos se incubaron
durante 159 horas en las mismas condiciones que en el capitulo 1a variando la temperatura
seguacuten las necesidades del tratamiento En la Figura 4 y 5 se muestran los disentildeos
experimentales correspondientes a los capiacutetulos 1a y 1b respectivamente
Resumen Metodologiacutea general
35
Figura 3 Cultivos liacutequidos incubados en un agitador orbital
Optimizacioacuten
CNP
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
100101
1002116
100505
Optimizacioacuten
fuente de N
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
NaNO3
NH4NO3
(NH4)2SO3
Optimizacioacuten
fuente de Fe
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
FeCl3
Fe(NO3)3
Fe2(SO4)3
Optimizacioacuten
[Fe]
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
005 mM
01 mM
02 mM
Optimizacioacuten
pH
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
50
70
80
Optimizacioacuten
fuente de C
BHB tween-80
C2PL05
Naftaleno fenantreno
antraceno y glucosa (20 80 100)
X 3
HAP
HAPglucosa (5050)
Glucosa
2ordm 3ordm
4ordm 5ordm 6ordm
Figure 4 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 1a
Resumen Metodologiacutea general
36
Tordf
Optimizacioacuten CNP
OptimizacioacutenFuente N
OptimizacioacutenFuente Fe
Optimizacioacuten[Fe]
Optimizacioacuten[Tween-80]
Optimizacioacutendilucioacuten inoacuteculo
Optimizacioacutenfuente de C
20ordmC25ordmC30ordmC
1001011002116100505
NaNO3
NH4NO3
(NH4)2SO3
FeCl3Fe(NO3)3
Fe2(SO4)3
005 mM01 mM02 mM
CMC20 CMC
10-1
10-2
10-3
0100505020100
18 tratamientos
X 3
C2PL05Antraceno dibenzofurano pireno
BHB (modificado seguacuten tratamiento)
Figura 5 Disentildeo experimental correspondiente a al experimento que conforma el capiacutetulo 1b
En el capiacutetulo 2 se estudioacute la capacidad de degradacioacuten y la evolucioacuten del consorcio
C2PL05 en dos tratamientos (cada uno en triplicado) uno adicionado con Tween-80 y otro
con Tergitol NP-10 (1 vv) como surfactantes En total 6 cultivos liacutequidos se incubaron a
150 rpm 25 ordmC y oscuridad durante 45 diacuteas como se muestra en la Figura 3 El disentildeo
experimental de este capiacutetulo se resume graacuteficamente en la Figura 6
Tratamiento 1con Tween-80
Tratamiento 2con Tergitol NP-10
C2PL05BHB-Tergitol NP-10 (1)Naftaleno fenantreno antraceno
X 3
X 3
C2PL05BHB-Tween-80 (1)Naftaleno fenantreno antraceno
Figura 6 Disentildeo experimental correspondiente al experimento que conforma
el capiacutetulo 2
Resumen Metodologiacutea general
37
El capiacutetulo 3 se desarrolloacute en microcosmos con 90 g de arena de riacuteo esterilizada
(Figura 7) e incinerada en una mufla a 300 ordmC para eliminar cualquier tipo de
microorganismos o materia orgaacutenica que pudiera contener Se realizaron 4 tratamientos
distintos en funcioacuten de la temperatura de incubacioacuten (5-15 ordmC o 15-25 ordmC) y del consorcio
inoculado (C2PL05 o BOS08) cada tratamiento con tres reacuteplicas para cada uno de los 5
tiempos de muestreo lo que supuso un total de 60 microcosmos (Figura 8) Los nutrientes
se suministraron antildeadiendo 18 ml de medio BHB que proporcionaba una humedad relativa
del 60 y que ademaacutes conteniacutea Tween-80 (1 vv) Los microcosmos se inocularon con
35 ml de un cultivo madre del consorcio C2PL05 oacute BOS08 y se incubaron en caacutemaras bajo
condiciones controladas de temperatura (seguacuten tratamiento) humedad (60 constante) y
luz (16 horas de luz8 horas oscuridad)
Figura 7 Microcosmos del experimento para el capiacutetulo 3 en caacutemara de crecimiento
Resumen Metodologiacutea general
38
Tratamiento 1
Tratamiento 2
Tratamiento 3
Tratamiento 4
C2PL0515-25ordmCBHB oacuteptimoNaftaleno fenantreno antracenopireno y perileno
C2PL055-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS0815-25ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS085-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
X 3
X 3
X 3
X 3
X 5 tiempos
X 5 tiempos
X 5 tiempos
X 5 tiempos
TOTAL = 60 MICROCOSMOS
Figura 8 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 3
El experimento que compone el capiacutetulo 4 de biorremediacioacuten in situ se desarrolloacute
bajo condiciones ambientales externas en una zona del campus preparada para ello Como
sustrato se utilizoacute suelo natural extraiacutedo de los primeros 20 cm y tamizado con una maya lt
2 mm El sustrato se depositoacute en bandejas de plaacutestico para evitar que el agente
contaminante se filtrara al suelo y se protegioacute de la lluvia tal y como se observa en la Figura
9 Cada uno de los cinco tratamientos (control atenuacioacuten natural bioestimulacioacuten
bioaumento y bioestimulacioacuten junto con bioaumento) se hizo en duplicado para cada uno de
los 4 muestreos realizados durante los 8 meses de experimentacioacuten (octubre-junio) Cada
microcosmos (bandeja) conteniacutea 550 g de suelo humedecidos (40) con agua o BHB como
fuente de nutrientes en el caso de los tratamientos con bioestimulacioacuten Los tratamientos
bioaumentados se enriquecieron con 5 ml de un cultivo madre del consorcio C2PL05 Como
agente contaminante se utilizoacute creosota antildeadiendo 25 ml de una disolucioacuten de creosota en
Resumen Metodologiacutea general
39
n-hexano (25 g creosota por bandeja) a todos los tratamientos excepto al control Resumen
del disentildeo en la Figura 10
Figura 9 Experimento para el capiacutetulo 4 bajo condiciones ambientales
externas en el Campus de la Universidad Rey Juan Carlos Moacutestoles
Tratamiento 1 Control
Tratamiento 2 Atenuacioacuten
natural
Tratamiento 3 Bioestimulacioacuten
Tratamiento 4 Bioaumento
Tratamiento 5 Bioestimulacioacuten
y Bioaumento
Suelo sin contaminar X 4 tiempos
CreosotaH2O-Tween-80 X 4 tiempos
CreosotaBHB oacuteptimo-Tween-80 X 4 tiempos
CreosotaH20 ndash Tween-80 X 4 tiemposC2PL05
CreosotaBHB oacuteptimo-Tween-80 X 4 tiemposC2PL05
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
TOTAL = 40 MICROCOSMOS
Figura 10 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 4
Resumen Metodologiacutea general
40
Anaacutelisis fiacutesico-quiacutemicos
La caracterizacioacuten del suelo contaminado del cual se extrajo el consorcio C2PL05 asiacute como
la explicacioacuten de las teacutecnicas y metodologiacuteas empleadas se detallan en Molina et al (2009)
No obstante en la Tabla 1 se presentan las propiedades fiacutesico-quiacutemicas de dicho suelo
contaminado
Tabla 1 Propiedades fisico-quiacutemicas y bioloacutegicas del suelo contaminado con HAP
Propiedades Unidades Media plusmn ES
Tamantildeo medio de partiacutecula μm3 291 plusmn 6 Composicioacuten (arenaslimosarcillas) v 291009000 plusmn 03603600
pH - 77 plusmn 01
Conductividad μSmiddotcm-1 74 plusmn 22
WHCa v 33 plusmn 7
(NO3)- μgmiddotKg-1 40 plusmn 37
(NO2)- μgmiddotKg-1 117 plusmn 01
(NH4)+ μgmiddotKg-1 155 plusmn 125
(PO4)3- μgmiddotKg-1 47 plusmn 6
Carbono total v 96 plusmn 21
TOCb (tratamiento aacutecido) v 51 plusmn 04
MPNc (heteroacutetrofos) x104 ceacutelulasmiddotg-1 97 plusmn 12
MPNc (degradador de HAP) x103 ceacutelulasmiddotg-1 93 plusmn 19
Toxicity EC50d gmiddot100ml-1 144 plusmn 80
Hidrocarburos extraiacutedos w 92 plusmn 18
a Capacidad de campo del agua (WHC Water holding capacity) maacutexima cantidad de agua que
puede contener un suelo b Carbono orgaacutenico total (TOC total organic carbon) c Nuacutemero maacutes
probable (MPN most probably number) teacutecnica cultivo-dependiente que estima el nuacutemero de
ceacutelulas capaces de crecer con una determinada fuente de carbono (ver apartado Anaacutelisis
bioloacutegicos) d EC50 es una medida de la eficacia de una determinada sustancia o de su toxicidad
y representa la cantidad de un compuesto necesaria para disminuir al 50 una funcioacuten En
nuestro caso indica la toxicidad del medio que disminuye a la mitad la actividad microbiana del
consorcio
La metodologiacutea utilizada para la extraccioacuten de HAP (capiacutetulos 1 2 y 3) y creosota
(capiacutetulo 4) se detalla en el apartado de material y meacutetodos de los capiacutetulos
correspondientes La cromatografiacutea liacutequida de alto rendimiento (HPLC high-performance
liquid chromatography) fue la teacutecnica utilizada para el anaacutelisis de los HAP en los capiacutetulos 1
y 2 siguiendo el protocolo descrito por Bautista et al (2009) El equipo de anaacutelisis HPLC
(Prestar 230 Varian Palo Alto CA USA) esta compuesto por una columna C18 en fase
reversa Luna C18 (2) (75 cm longitud x 46 mm diaacutemetro interno y 3 μm tamantildeo de partiacutecula
Phenomenex Torrance CA USA) y conectado a una matriz de fotodiodos de UVVis
Resumen Metodologiacutea general
41
(ultravioletavisible) y un detector de fluorescencia La fase moacutevil utilizada se compone de un
gradiente acetonitriloagua programado como se detalla a continuacioacuten gradiente isocraacutetico
6040 (0-2 min) gradiente de 7525 (2-14 min) gradiente isocraacutetico 7525 (14-15 min)
gradiente de 1000 (15-16 min) El volumen de inyeccioacuten de muestra es de 10 μl y el flujo de
elusioacuten en la columna de 08 mlmiddotmin-1 La deteccioacuten de los HAP se realiza a 254 nm El
posterior tratamiento de los datos se detalla en los respectivos capiacutetulos
El meacutetodo para la deteccioacuten de HAP en el capiacutetulo 3 y de creosota en el capitulo 4 fue
la cromatografiacutea de gases (GC Gas Chromatography) utilizando un cromatoacutegrafo de gases
(system Varian 3900 Palo Alto CA USA) con un detector con ionizador de llama (FID
Flame Ionization Detector) La metodologiacutea protocolo y posterior tratamiento de los datos se
detallan en el material y meacutetodos de los respectivos capiacutetulos
Anaacutelisis bioloacutegicos
La densidad celular es una teacutecnica utilizada en todos los ensayos que componen esta tesis y
por tanto la metodologiacutea y el posterior tratamiento de los datos estaacuten detalladamente
descritos en todos los manuscritos que conforman los capiacutetulos de la tesis
Las teacutecnicas cultivo dependientes desarrolladas en los ensayos han sido el NMP
descrito en los capiacutetulos 2 3 y 4 y el aislamiento de colonias aplicando la metodologiacutea
empleada por Molina et al (2009) y descrita en los capiacutetulos 2 y 3
Teacutecnicas moleculares
Extraccioacuten y amplificacioacuten de ADN
La extraccioacuten de ADN de muestras de cultivos liacutequidos y muestras de biomasa de una
colonia aislada (capiacutetulos 2 y 3) se realizoacute usando el kit de extraccioacuten fiacutesico-quiacutemico de ADN
bacteriano Microbial DNA isolation Kit (Laboratorios MoBio Solano Beach CA USA) Para
la extraccioacuten de ADN total de muestras de suelo (capiacutetulos 3 y 4) se usoacute el kit de extraccioacuten
fiacutesico-quiacutemico Power Soil DNA kit (Laboratorios MoBio Solano Beach CA USA) siguiendo
en ambos casos el protocolo recomendado por el fabricante
Resumen Metodologiacutea general
42
Para la amplificacioacuten de las secuencias de ADN se utilizaron varias parejas de
cebadores en funcioacuten de la teacutecnica posterior de anaacutelisis del producto de PCR La
amplificacioacuten del ADN se realizoacute con el fin de identificar las secuencias de las cepas
aisladas o para un posterior anaacutelisis del ADN total de una muestra mediante electroforesis
en gel con gradiente desnaturalizante (DGGE denaturing gradient gel electrophoresis)
Cuando fue necesario reamplificar material geneacutetico procedente de una banda de DGGE la
pareja de primers utilizada no presentaba cola de GC (guanina-citosina) En la Tabla 2 se
describen las caracteriacutesticas de los cebadores y en la Figura 11 se detallan las condiciones
del programa correspondiente a cada pareja de cebadores
Tabla 2 Caracteriacutesticas de los cebadores utilizados para la amplificacioacuten de ADN por PCR
Cebador Secuencia 5acute--3acute Nordm de bases
Tordf hibridacioacuten
(ordmC)
Programa de PCR (Figura
Teacutecnica de anaacutelisis del producto de
16F27 AGAGTTTGATCMTGGCTCAG 20 55 I Purificacioacuten Secuenciacioacuten16R1488 CGGTTACCTTGTTACGACTTCAGG 24 55 I
16F341 CCTACGGGAGGCAGCAG 17 54 II DGGE Clonacioacuten Ecoli 16R907 CCGTCAATTCCTTTRAGTTT 20 54 II
16F338 CTCCTACGGGAGGCAGCAG 19 55 II DGGE Clonacioacuten Ecoli 16R518 CGTATTACCGCGGCTGCTGG 20 55 II
ITS1F CTTGGTCATTTAGAGGAAGTAA 20 54 III Presencia material geneacutetico ITS4 TCCTCCGCTTATTGATATGC 20 54 III
Primer con posibilidad de antildeadir una secuencia de 40 bases (5acute-CGC CCG CCG CGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) rica en guanina (G) y citosina(C) unida al extremo 5acute- del
cebador necesaria para electroforesis en gel con gradiente desnaturalizantede
Resumen Metodologiacutea general
43
Figura 11 Condiciones de los programas de PCR I II y III a) Paso en el cual se procede a la
activacioacuten del principio activo de la polimerasa ExTaq-HS a una Tordf de activacioacuten de 94ordmC b) Tordf de
desnaturalizacioacuten c) Tordf de hibridacioacuten d) Tordf de polimerizacioacuten e) Tordf de extensioacuten f) Tordf final y de
conservacioacuten del producto de PCR
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 5 min
95 ordmC 1 min
54 ordmC 05 min
72 ordmC 15 min
72 ordmC 10 min
30 CICLOS
PROGRAMA PCR III
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR II
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
94 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR I
Resumen Metodologiacutea general
44
Electroforesis en gel con gradiente de desnaturalizacioacuten (DGGE) y clonacioacuten en
Escherichia coli
El estudio de la comunidad bacteriana se realizoacute mediante la teacutecnica DGGE ampliamente
descrita en los capiacutetulos 2 3 y 4 Las bandas maacutes predominantes fueron extraiacutedas del gel
eluiacutedas en de agua esterilizada y almacenadas a -20 ordmC para su posterior reamplificacioacuten y
clonacioacuten Las imaacutegenes de DGGE se analizaron graacutefica y estadiacutesticamente para diferenciar
entre las comunidades objeto de estudio y la influencia de los tratamientos en los cambios
de una comunidad El anaacutelisis graacutefico mediante el programa UN-Scan-It (v 60 Silk Scientific
US) permitioacute identificar el porcentaje de abundancia de cada banda con respecto de una
comunidad
La clonacioacuten en Ecoli se empleoacute debido a la imposiblidad de reamplificar el ADN
contenido en una banda cortada del gel de DGGE La metodologiacutea empleada para el
desarrollo de esta teacutecnica en los capiacutetulos 2 3 y 4 es la recomendada por el fabricante del
kit utilizado pGEM-T Easy Vector System II (Pomega)
Alineamiento de secuencias y anaacutelisis filogeneacuteticos
Las secuencias fueron editadas utilizando el programa Chromas Pro v142 que permite
ademaacutes visualizar y modificar posibles ambiguumledades en los nucleoacutetidos Las secuencias
fueron descargadas en las bases de datos disponibles (Genbank
(httpwwwncbinlmnihgovgenbank) y Ribosomal Sequence Data
(httprdpcmemsueduseqmatchseqmatch_introjsp)) a traveacutes de la opcioacuten BLAST con el
fin de aproximarnos a la identificacioacuten molecular de los organismos La secuencias fueron
alineadas utilizando el programa Bioedit v709 y posteriormente se elaboroacute una matriz de
datos a partir de la cual se establecieron las posibles relaciones filogeneacuteticos entre las
secuencias problema y aquellas descargadas de las bases de datos El programa utilizado a
tal efecto fue PAUP 40B10 (Swofford 2003)
Se utilizaron dos tipos de anaacutelisis para estimar las relaciones filogeneacuteticas y la
fiabilidad de las topologiacuteas obtenidas Por un lado se utilizoacute la Maacutexima Parsimonia estaacutendar
(Maxima Parsimonia de Fitch MP) un meacutetodo que elige el aacuterbol que requiere el menor
nuacutemero de cambios evolutivos para explicar las relaciones entre taxones a partir de la
informacioacuten generada por los sitios informativos el valor relativo de los diferentes caracteres
y de sus transformaciones Para evaluar la fiabilidad de las relaciones establecidas por
parsimonia se selecciono el meacutetodo Bootstraping (Felsenstein 1985) donde los caracteres
Resumen Metodologiacutea general
45
de las matrices se combinan al azar con las repeticiones necesarias considerando los
paraacutemetros establecidos en el anaacutelisis de parsimonia Asiacute el porcentanje con que aparece
un determinado grupo es una medida de la bondad de dicho grupo o rama Por otro lado la
diferencia entre secuencias (distancia geneacutetica) se computoacute en teacuterminos de nuacutemero de
nucleoacutetidos diferentes por sitio entre secuencias realizando un anaacutelisis de neighbour-joining
de acuerdo al algoritmo de Jukes amp Cantor (1969) Ambos tipos de anaacutelisis se llevaron a
cabo usando el software PAUP 40B10 (Swofford 2003)
Anaacutelisis estadiacutesiticos
Todos los capiacutetulos se disentildearon de forma que tras la finalizacioacuten del experimento los datos
pudieran ser tratados estadiacutesticamente El tratamiento estadiacutestico y los anaacutelisis realizados
con los datos de los ensayos estaacuten descritos en el apartado correspondiente de los
manuscritos que componen los artiacuteculos de la presente tesis Es necesario explicar
detalladamente el experimento que compone el capiacutetulo 1b disentildeado con un experimento
ortogonal del tipo L18 (37) (21) seleccionado del modulo de Statistica (Version 60) Este tipo
de disentildeo permitioacute hacer una combinacioacuten de muacuteltiples factores de forma reducida Es decir
un total de 18 experimentos representan todas las combinaciones posibles que se pueden
dar entre 8 factores siete de los cuales pueden tomar tres valores (37) diferentes (ej factor
Tordf valores 30ordmC 25ordmC y 20ordmC) y uno de ellos con dos valores (21) (ej factor concentracioacuten
de surfactante valores CMC y +20 CMC)
Para visualizar cambios en las comunidades microbianas (patrones univariantes) en
cada combinacioacuten de factores (ej tiempo tipo de consorcio temperatura) se realizoacute una
ordenacioacuten multivariante mediante un escalamiento multidimensional no-meacutetrico (MDS non-
parametric Multidimensional Scaling) usando el programa PRIMER (Clarke 1993) Este tipo
de anaacutelisis se realizoacute en los capiacutetulos 3 y 4 La ordenacioacuten se hizo sobre la base de la matriz
de dismilaridad de Bray-Curtis construida a partir de la transformacioacuten de los datos de
abundancia por la raiacutez cuarta para minimizar la influencia de los valores maacutes extremos
(Clarke 1993 Martiacuten Guirao 2007) Se usoacute el procedimiento SIMPER (Clarke 1993) para
identificar el porcentaje de contribucioacuten de cada banda a la disimilitud entre tratamientos
establecida en la matriz de Bray-Curtis Las bandas se consideraron influyentes cuando su
contribucioacuten se encontraba dentro de los primeros 70 (capiacutetulo 2) 60 (capiacutetulo 3) o 50
(capiacutetulo 4 Viejo 2009) del porcentaje medio de similaridaddisimilaridad acumulado entre y
dentro de la combinacioacuten de factores El criterio aplicado para escoger el porcentaje de
contribucioacuten limite se hizo en funcioacuten de la riqueza de bandas de forma que cuanto menor
fuera este paraacutemetro mayor el porcentaje liacutemite
Capiacutetulo
Publicado en Water Air amp Soil Pollution (2011) 217 365-374
Simarro R Gonzaacutelez N Bautista LF Sanz R amp Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene and
anthracene) biodegradation process by a bacterial consortium
Optimizacioacuten de los principales factores abioacuteticos de un proceso de biodegradacioacuten
de HAP (naftaleno fenantreno y antraceno) por un consorcio bacteriano
1a
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
49
Abstract
The aim of this work is to determine the optimum values for the biodegradation process of six
abiotic factors considered very influential in this process The optimization of a polycyclic
aromatic hydrocarbons (naphthalene phenanthrene and anthracene) biodegradation
process was carried out with a degrading bacterial consortium C2PL05 The optimized
factors were the molar ratio of carbonnitrogenphosphorus (CNP) the nitrogen source the
iron source the iron concentration the pH and the carbon source Each factor was optimized
applying three different treatments during 168 h analyzing cell density by spectrophotometric
absorbance at 600 nm and PAH depletion by HPLC To determine the optimum values of the
factors an analysis of variance (ANOVA) was performed using the cell density increments
and biotic degradation constants calculated for each treatment The most effective values of
each factor were a CNP molar ratio of 1002116 NaNO3 as nitrogen source Fe2(SO4)3 as
iron source using a concentration of 01 mmolmiddotl-1 a pH of 70 and a mixture of glucose and
PAH as carbon source Therefore high concentration of nutrients and soluble forms of
nitrogen and iron at neutral pH favour the biodegradation Also the addition of glucose to
PAH as carbon source increased the number of total microorganism and enhanced the PAH
biodegradation due to augmentation of PAH degrader microorganisms It is also important to
underline that the statistical treatment of data and the combined study of the increments of
the cell density and the biotic biodegradation constant has facilitated the accurate
interpretation of the optimization results For an optimum bioremediation process is very
important to perform these previous bioassays to decrease the process development time
and so the costs
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
51
Introduction
Polycyclic aromatic hydrocarbons (PAH) are persistent organic compounds with two or more
aromatic rings They are formed by incomplete combustion of fossil fuels and pyrolysis of
organic matter derived from human activities and as a result of natural events like forest fires
The toxic mutagenic and carcinogenic properties of PAH have concerned the Unites States
Environmental Protection Agency (US-EPA) proposing some of them as priority pollutants
(including naphthalene phenanthrene and anthracene) In addition the PAH solubility is very
low in aqueous medium (Luning Prak amp Pritchard 2002) affecting their degradation and
biomagnification within the ecosystems The microbial bioremediation removes or
immobilizes the pollutants reducing toxicity with a very low environmental impact Generally
microbial communities present in PAH contaminated soils are enriched by microorganisms
able to use them as only carbon source (Heitkamp amp Cerniglia 1988 Gallego et al 2007)
However this process can be affected by a few key environmental factors (Roling-Wilfred et
al 2002) that may be optimized to achieve a more efficient process The molar ratio of
carbon nitrogen and phosphorus (CNP) is very important for the metabolism of the
microorganisms and so for PAH degradation (Bossert amp Bartha 1984 Alexander 1994
Kwok amp Loh 2003) The molar ratio 100101 is frequently considered optimal for
contaminated soils (Bossert amp Bartha 1984 Alexander 1994) while other author have
reported negative or non-effects (Chaicircneau et al 2005) According to Leys et al (2005)
these contradictory results are due to the nutrients ratio required by PAH degrading bacteria
depends on environmental conditions type of bacteria and type of hydrocarbon In addition
the chemical form of those nutrients is also important being the soluble forms (ie iron or
nitrogen in form of phosphate nitrate and ammonium) the most frequent and efficient due to
their higher availability for microorganisms Depending on the microbial community and their
abundance another factor that may improve the PAH degradation is the addition of readily
assimilated such as glucose carbon sources (Zaidi amp Imam 1999)
Moreover the pH is an important factor that affects the solubility of both PAH and
many chemical species in the cultivation broth as well as the metabolism of the
microorganisms showing an optimal range for bacterial degradation between 55 and 78
(Bossert amp Bartha 1984 Wong et al 2001)
In general bioremediation process optimization may be flawed by the lack of studies
showing the simultaneous effect of different environmental factors Hence our main goal was
to set up the optimum values of six abiotic factors CNP molar ratio nitrogen source iron
source iron concentration pH and carbon source for the biodegradation of three PAH
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
52
(naphthalene phenanthrene and anthracene) at 25 ordmC In order to achieve the main objective
we analyzed the effects of the above factors on the microbial growth and the biotic
degradation rate
Materials and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all gt99 purity) were purchased from Sigma-
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) The consortium C2PL05
was not able to degrade PAH significantly without the addition of surfactants (data not
shown) Therefore surfactant Tween-80 (Sigma-Aldrich Steinheim Germany) was selected
as the most efficient biodegradable and non-toxic surfactant (Bautista et al 2009) for the
consortium C2PL05 Bushnell Haas Broth medium (BHB) was purchased from Panreac
(Barcelona Spain) and its composition is 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-
1 KHPO4 1 gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 This base composition was
modified in each experiment as required
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1g of soil (lt 2 mm) was resuspended in 10 ml
of phosphate buffer saline (PBS) and incubated during 12 h in an orbital shaker (Innova 40
New Brunswick Scientific Edison NJ USA) at 150 rpm and 25ordmC under dark conditions
After that 15 ml of the supernatant was inoculated in 50 ml of BHB broth (pH 70) 1 wt
Tween-80 as surfactant and naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1)
as carbon source The culture was incubated at 150 rpm and 25ordmC under dark conditions
until the exponential phase was completed This was confirmed by monitoring the cell density
by absorbance at 600 nm in a spectrophotometer (Spectronic GenesysTM UK) Then the
consortium was stored at 4 ordmC to stop its growth At the beginning of each experiment 500 μl
of the stored consortium was inoculated into the fermentation flasks To identify the microbial
consortium C2PL05 colonies from aliquots of the soil extract were isolated in BHB agar
plates with PAH as only carbon source to confirm that these colonies were PAH degraders
Eight colonies were isolated and transferred onto LB-glucose agar plates in order to increase
microbial biomass for DNA extraction Total DNA of the colonies was extracted using
Microbial DNA isolation kit (MoBio Laboratories) Amplification of the 16S rRNA coding
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
53
region of the DNA was performed as described by Vintildeas et al (2005) using the primers
16F27 and 16R1488 Sequences were edited and assembled using BioEdit 487 software
(Hall 1999) All isolated strains of the consortium C2PL05 were γ-proteobacteria and the
genera present were Enterobacter Pseudomonas and Stenotrophomonas In addition non
culture-dependent molecular techniques as denaturant gradient gel electrophoresis (DGGE)
was performed to know the total biodiversity of the microbial consortium C2PL05 16S rRNA
gen was amplified using the primers 341F-GC and 907R (GC clamp 5acute-CGC CCG CCG
CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995) About 6 of
polyacrylamide (3751 acrylamidebisacrylamide) gels with a 30-60 urea-formamide
denaturant gradient and 075 mm were used in 1xTAE buffer at 200V for 4h at 60 ordmC The
bands were excised and reamplificated to identify the DNA The two genera identified
coincided with genera Pseudomonas and Stenotrophomonas identified by culture-dependent
techniques (more details in Molina et al 2009)
Experimental design
A total of 6 abiotic factors were evaluated To obtain an optimum value three treatments
each in triplicate were performed for each factor The replicates were carried out in 100 ml
Erlenmeyer flasks with 50 ml of BHB medium (pH 70) Tween-80 (1wt) naphthalene
phenanthrene and anthracene (each at 500 mgmiddotl-1) and 500 microl of the C2PL05 consortium
The concentration of the inoculum was 315x106 cells ml-1 of the heterotrophic microorganism
and 695x105 cells ml-1 of the PAH degrading microorganism The number of the
microorganisms capable to degrade any carbon source present in the medium (heterotrophic
microorganisms) and microorganisms capable to degrade PAH as sole carbon source (PAH-
degrading bacteria) were measured by the most probably number (MPN) method (Wrenn amp
Venosa 1996) LB-glucose broth and BHB medium were used to determine heterotrophic
microorganism and PAH degrading microorganism respectively To maintain the same initial
number of cells in each experiment the absorbance of the inoculum was measured and
diluted if necessary before inoculation to reach an optical density of 16 AU The replicates
were incubated in an orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA)
at 150 rpm and 25 ordmC under dark conditions Previous to inoculate the consortium the
Erlenmeyer flasks were shacked overnight to solubilize most of the PAH Samples were
withdrawn at 0 15 24 39 48 64 72 159 and 168 h to monitor the PAH depletion and cell
growth
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
54
Treatment conditions
Composition of BHB base was 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-1 KHPO4 1
gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 The compounds MgSO4 and CaCl2 and their
concentration were constant for all treatments and KHPO4 and K2HPO4 were modified only in
concentration The other components were modified both the concentration and compounds
according to the requirements of the optimized factors PAH at 1500 mgmiddotl-1 (500 mgmiddotl-1 of
naphthalene phenathrene and anthracene) was used as carbon source for all treatments
except for those in which the carbon source was optimized and PAH were mixed with
glucose in a proportion of 50 PAH-glucose or only glucose was added In all cases an
overall carbon concentration of 01176 mmoll-1 was used Once a factor was optimized its
optimum value was kept for the subsequent factor optimization
The levels of each factor studied were selected as described below For the CNP
molar ratio the values employed were 100101 frequently described as optimal (Bossert
and Bartha 1984) 100505 and 1002116 To optimize the nitrogen source NaNO3
NH4(NO3) and (NH4)2SO3 were used The optimal iron source was selected amongst FeCl3
Fe(NO3)3 and Fe2(SO4)3 The concentration levels of the optimal iron form were 005 01 and
02 mmoll-1 and three different pH values were also tested 50 70 and 80 The effect of the
carbon source was determined by adding PAH as only carbon source PAH and glucose
(50 of carbon atoms from each source) or glucose as only carbon source
Bacterial growth
Bacterial growth during the PAH degradation process was monitored at 0 15 24 39 48 64
72 159 and 168 h by spectrophotometric absorbance of the culture media at 600 nm in a
UV-Vis spectrophotometer (Spectronic GenesysTM UK) From the above optical density data
the average of the cell density increments (CDI) was calculated by applying the following
equation
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
55
Kinetic degradation
Naphthalene phenanthrene and anthracene concentrations in the culture media were
analysed using a ProStar 230 HPLC system (Varian Palo Alto CA USA) with a reverse
phase C18 column following the method described in Bautista et al (2009) The
concentration of each PAH was calculated from a standard curve based on peak area using
the absorbance at 254 nm Depletion rate of each PAH (-ri) during the experiments was fitted
to a first order kinetic model (Equation 2)
iBiiAii
i CkCkdt
dCr Eq 2
where C is the concentration of the corresponding PAH kA is the apparent first-order
kinetic constant due to abiotic processes kB is the apparent first-order kinetic constant
due to biological processes t is the time elapsed and the subscript i corresponds to
each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1 wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40 New Brunswick Scientific Edison
NJ USA) at 150 rpm and 25 ordmC under dark conditions PAH concentration in the control
experiment were analysed using the HPLC system described previously The values of kA for
each PAH was calculated by applying eq 2 considering kB asymp 0 since no bacterial consortium
was inoculated
Statistical analysis
In order to evaluate the effects of the treatments on the kinetic biodegradation constant (kB)
and cell density increments (CDI) bifactorials analysis of variance (ANOVA) were used The
variances were checked for homogeneity by applying the Cochranacutes test When indicated
data were transformed to homogenize variances Student-Newman-Keuls (SNK) test was
used to discriminate among different treatments after significant F-test All tests were
performed with the software Statistica 60 for Windows
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
56
Results
Control experiments (Figure 1) show that phenathrene and anthracene concentration was
not affected by any abiotic process since no depletion was observed along the experiment
so that kA asymp 0 h-1 However in the case of naphthalene some degree of abiotic depletion was
measured during the controls yielding an apparent first-order abiotic rate constant of 27x10-
3 plusmn 7x10-5 h1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the optimisation experiments
0 100 200 300 400 500 600 700
20
40
60
80
100
Rem
aini
ng P
AH
(
)
Time (hour)
Figure 1 Naphthalene ( ) phenathrene ( ) and anthracene ( )
depletion due to abiotic processes in control experiments
Table 1 Analysis of variance (ANOVA) summary for the cell density increments (CDI) and the
biotic degradation constant (kB) MS is the means of squares and df degrees of freedom
CDI kB
Factor df MS F-value p-value df MS F-value p-value
CNP ratio 2 27middot10-1 238 4 57middot10-2 566 Error 6 11middot10-2 18 10middot10-3
N source 2 21middot10-1 234 4 90middot10-6 113
Error 6 10middot10-2 18 70middot10-7
Fe source 2 18middot10-2 51 4 30middot10-6 43
Error 6 36middot10-3 18 70middot10-8
Fe Concentration 2 45middot10-1 348 006 4 30middot10-6 38
Error 6 95middot10-2 18 10middot10-7
pH 2 30middot10-2 1103 4 15middot10-4 5
Error 6 27middot10-3 18 33middot10-5
GlucosePAHs 2 54middot10-1 45401 2 66middot10-4 7
Error 6 12middot10-3 12 93middot10-5
a Logarithmically transformed data to achieve homogeneity of variance
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
57
Cell density increments of the consortium for three different treatments of CNP molar
ratio are showed in Figure 2A According to statistical analysis of CDI there was significant
differences between CNP molar ratio (F26 = 238 p lt 001 Table 1) and SNK showed that
treatments with molar ratios of 100101 and 1002116 reached larger increases With
regard to the kinetic biodegradation constant (kB) the interaction between kB of the
treatments with each hydrocarbon was significant (F418 = 57 p lt 0001 Table 1) The SNK
test (Figure 2B) showed that the treatment 1002116 with naphthalene yielded the highest
value whereas the lowest were achieved with 100505 and 100101 for anthracene and
phenanthrene In addition within each PAH group the highest values were observed with
1002116 molar ratio Therefore although there are no differences for CDI between ratios
100101 and 1002116 1002116 molar ratio is the most effective for the PAH degradation
so that this ratio was considered as the optimal
171819202122232425
100101 1002116100505
bb
a
A
CNP molar ratio
CD
I
Naphthalene Phenanthrene Anthracene-35
-30
-25
-20
-15
-10
-05
00B
d
g
e
bc
f
ab
f
Log
k B (
h-1)
Figure 2 (A) Cell density increments of the consortium C2PL05 with the treatments 100505
100101 and 1002116 Error bars show the standard error (B) Differences between treatments
(100101 100505 and 1002116 ) and PAHs in the biodegradation kinetic constant (kB)
The letters show differences between groups (p lt 005 SNK) and the error bars the standard
deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
58
Figure 3A shows that the three different nitrogen sources added had significant effects
on CDI (F26 = 234 p lt 001 Table 1) The SNK test shows that the addition of NaNO3
significantly improved CDI The interaction between PAH and the nitrogen sources were
significant (F418 = 113 p lt 0001 Table 1) and the highest kB values were achieved with
NaNO3 for naphthalene phenanthrene and anthracene (Figure 3B) According to these
results NaNO3 is considered as the best form to supply the nitrogen source for both PAH
degradation and growth of the C2PL05 consortium
19
20
21
22
23
24
25
(NH4)
2SO
4NH4NO
3NaNO
3
a
b
a
A
Nitrogen source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
Bf
ba
e
bcb
dbc
a
kB (
h-1)
Figure 3 (A) Cell density increments of the consortium C2PL05 with the treatments NaNO3 NH4NO3
and (NH4)2SO4 Error bars show the standard error (B) Differences between treatments (NaNO3
NH4NO3 and (NH4)2SO4 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
59
CDI of the treatments performed with three different iron sources (Figure 4A) were
significantly different (F26 = 51 p lt 005 Table 1) Although no significant differences
between adding Fe2(SO4)3 or Fe(NO3)3 were observed the addition of Fe2(SO4)3 contributes
more to CDI than FeCl3 The kB (Figure 4B) showed significant differences in the interaction
between PAH and the different iron sources (F418 = 43 p lt 0001 Table 1) The highest kB
values were observed with Fe2(SO4)3 for the degradation of phenanthrene followed by FeCl3
degrading naphthalene and phenanthrene The lowest values of kB were observed with
Fe(NO3)3 degrading naphthalene and anthracene Nevertheless the most recalcitrant PAH
(phenanthrene and anthracene) showed the highest kB values with Fe2(SO4)3 in agreement
with the highest CDI values also obtained with Fe2(SO4)3
168
172
176
180
184
188
192
196
Fe(NO3)
3 Fe2(SO
4)
3FeCl
3
ab
b
a
A
Iron source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
B
c
a
b
c
b
d
b
a a
k B
(h-1
)
Figure 4 (A) Cell density increments of the consortium C2PL05 with the treatments FeCl3 Fe(NO3)3
and Fe2(SO4)3 Error bars show the standard error (B) Differences between treatments (FeCl3
Fe(NO3)3 and Fe2(SO4) ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
60
Concerning the effect of the iron concentration (Figure 5) supplied in the form of the
optimal Fe2(SO4)3 no significant differences in CDI were found for all three concentration
used (F26 = 348 p = 006 Table 1 Figure 5A) However the interaction between iron
concentration and kB of three PAH was significant (F418 = 38 p lt 0001 Table 1) reaching
the highest values for kB by using an iron concentration of 01 mmoll-1 degrading
naphthalene and phenanthrene (Figure 5B) The lowest values of kB were observed with 005
mmoll-1 and 02 mmoll-1 degrading phenanthrene and anthracene (Figure 4B) Since each
PAH showed the highest kB with 01 mmoll-1 this iron concentration was considered as the
most efficient for the PAH biodegradation process
005 01 02
38
40
42
44
46
48
50
a
a
a
A
Iron concentration (mmol l-1)
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
B
c
f
d
b
e
d
cb
a
k B (
h-1)
Figure 5 (A) Cell density increments of the consortium C2PL05 with the treatments 005 mmolmiddotl-1 01
mmolmiddotl-1 and 02 mmolmiddotl-1 Error bars show the standard error (B) Differences between treatments
(005 mmolmiddotl-1 01 mmolmiddotl-1 and 02 mmolmiddotl-1 ) and PAHs in the biodegradation kinetic
constant (kB) The letters show differences between groups (p lt 005 SNK) and the error bars the
standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
61
With reference to pH Figure 6A and statistical analysis (F26 = 1103 p lt 001 Table 1)
clearly show that the neutral pH of the medium favour the CDI of the consortium The kB of
the three different treatments (Figure 6B) also showed significant differences in the
interaction (F49 = 5 p lt 005 Table 1) The highest value of kB was observed for anthracene
degradation at neutral pH (Figure 6B) The other two PAH naphthalene and phenanthrene
did not show significantly differences between any treatments Therefore given that the
highest values of both parameters (CDI and kB) were observed at pH 7 this value will be
considered as the most efficient for the PAH biodegradation process
5 7 8
215
220
225
230
235
240
245
a
b
a
A
pH
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
25x10-2
30x10-2
B
b
a
ab ab
a
ab
c
ab ab
kB
(h-1
)
Figure 6 (A) Cell density increments of the consortium C2PL05 with the treatments pH 50 pH 70
and pH 80 Error bars show the standard error (B) Differences between treatments (pH 50 pH
70 and pH 80 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
62
The last factor analyzed was the addition of an easily assimilated carbon source
(Figure 7) Regarding to CDI values (Figure 7A) there were significant differences between
treatments (F26 = 45401 p lt 0001 Table 1) The addition of glucose as only carbon source
significantly improved CDI Figure 7B only show the kB of the treatments with PAH (100 or
50 of PAH) therefore the treatment with glucose as only carbon source was not included in
the ANOVA analysis The interaction between PAH and type of carbon source was
significant (F212 = 7 p lt 005 Table 1) The kB for the treatment with PAH and glucose
(5050) was significantly higher for phenanthrene and naphthalene (Figure 6B) although
there were no differences with the treatment for anthracene where PAH were the only carbon
source
PAHs (100)
PAHsGlucose (50)Glucose (100)
18
20
22
24
26
28
Carbon source
b
c
a
A
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-2
4x10-2
6x10-2
8x10-2
1x10-1
B
c
bb
b
b
a
k B (h
-1)
Figure 7 (A) Cell density increments of the consortium C2PL05 with the treatments PAHs (100)
PAHsglucose (5050) and glucose (100) Error bars show the standard error (B) Differences
between treatments (PAHs (100) and PAHs glucose (5050) ) and PAHs in the
biodegradation kinetic constant (kB) The letters show differences between groups (p lt 005 SNK)
and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
63
Discussion
It is important to highlight that the increments of the cell density is a parameter that brings
together all the microbial community whereas the biotic degradation constant is specific for
the PAH degrading microorganisms For that reason when the effect of the factors studied
on CDI and kB yielded opposite results the latter always prevailed since PAH degradation
efficiency is the main goal of the present optimisation study
With regard to the CNP molar ratio some authors consider that low ratios might limit
the bacterial growth (Leys et al 2005) although others show that high molar ratios such as
100101 are optimum for hydrocarbon polluted soils (Flathman et al 1994 Bouchez et al
1995 Eweis et al 1998) However in agreement with Leys et al (2005) our results
confirmed that the most effective molar ratio was the highest (1002116) This result
suggests that the supply of the inorganic nutrients during the PAH biodegradation process
may be needed by the microbial metabolism In addition the form used to supply these
nutrients can affect the metabolism of the microorganism (Carmichael amp Pfaender 1997) and
limit the amount of carbon that bacteria can assimilate limiting in turn the biodegradation
extent Our results showed that nitrate (sodium nitrate) as nitrogen source improved PAH
biodegradation as compared to ammonium This is likely due to the fact that nitrate is more
soluble and available for microorganisms than ammonium which has adsorbent properties
(Schlessinger 1991) The iron is other essential compound to stimulate the microbial activity
on PAH degradation (Dinkla amp Janssen 2003 Santos et al 2008)
On one hand iron acts as a cofactor of enzymes catalysing PAH oxidation (Dinkla amp
Janssen 2003) but it is also related with the production of biosurfactants (Santos et al
2008) These compounds are naturally produced by genera such as Pseudomonas and
Bacillus (Wei et al 2003) increasing the PAH solubility and therefore their bioavailability In
agreement with previous works (Dinkla amp Janssen 2003 Santos et al 2008) our results
confirmed that the addition of iron in a concentration of 01 mmoll-1 makes the
biodegradation more effective Santos et al (2008) stated that there is a limit concentration
above which the growth is inhibited due to toxic effects According to these authors our
results showed lower degradation and growth with the concentration 02 mmoll-1 since this
concentration may be saturating for these microorganisms However opposite to previous
works (Dinkla amp Janssen 2003 Santos et al 2008) the most effective iron form was
Fe2(SO4)3 for the PAH biodegradation likely due to the higher solubility which makes it more
available for the microorganism
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
64
The addition of easy assimilated carbon forms such as glucose for the PAH
degrading process can result in an increment in the total number of bacteria (Wong et al
2001) because PAH degrader population can use multiple carbon sources simultaneously
(Herwijnen et al 2006) However this increment in the microbial biomass was previously
considered (Wong et al 2001) because the utilization of the new carbon source may
increase the lag phase delaying the bacterial growth (Maier et al 2000) Our results
confirmed that PAH degradation was more efficient with the addition of an easy assimilated
carbon source probably because the augmentation of the total heterotrophic population also
enhanced the PAH degrading community Our consortium showed a longer lag phase during
the treatment with glucose than that observed during the treatment with PAH as only carbon
source (data not shown) These results are consistent with a consortium completely adapted
to PAH biodegradation and its enzymatic system requires some adaptation time to start
assimilating the new carbon source (Maier et al 2000)
Depending on the type of soil and the type of PAH to degrade the optimum pH range
can be very variable (Dibble amp Bartha 1979) Some acid resistant gram-positive bacteria
such as Mycobacterium sp show better PAH degradation capabilities under acid condition
because and low pH seems to render the mycobacterial more permeable to hydrophobic
substrates (Kim et al 2005) However other microorganisms belonging to Pseudomonas
genus prefer neutral pH conditions In agreement with previous works (ie Dibble amp Bartha
1979) our results confirmed that neutral pH is optimum for the biodegradation PAH
In summary the current work has shown that the optimization of environmental
parameters may significantly improve the PAH biodegradation process It is also important to
underline that the statistical analysis of data and the combined study of the bacterial growth
and the kinetics of the degradation process provide an accurate interpretation of the
optimisation results Concluding for an optimum bioremediation process is very important to
perform these previous bioassays to decrease the process development time and so the
associated costs
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Master en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
65
References
Alexander M 1994 Biodegradation and Biorremediation Academic Press New York
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse bacteria Int Biodeter
Biodegr 63 913-922
Bossert I amp Bartha R 1984 The fate of petroleum in soil ecosystems In Atlas RM (ed)
Petroleum microbiology Macmillan New York pp441-4473
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Carmichael LM amp Pfaender KF 1997 The effects of inorganic and organic supplements on
the microbial degradation of phenanthrene and pyrene in soils Biodegradation 8 1-
13
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge Appl Environ Microbiol 37 729-739
Dinkla EJT amp Janssen DB 2003 Simultaneous growth on citrate reduces the effects of
iron limitation during toluene degradation in Pseudomonas Microb Ecol 45 97-107
Eweis JB Ergas SJ Chang PY amp Schroeder ED 1998 Bioremediation Principles
McGraw-Hill Boston pp 136-236
Flathman PE Jerger DE amp Exner JH1994 Biorremediation-Field Experiences Lewis
Publishers Boca Raton pp 81-106 383-490
Gallego JL Garciacutea MJ Llamas JF Belloch C Pelaez AI amp Sanchez J 2007
Biodegradation of oil tank botton sludge using microbial consortia Biodegradation 18
269-281
Hall TA 1999 Bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 41 95-98
Heitkamp MA amp Cerniglia CE 1988 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from sediment below an Oil Field Appl Environ Microbiol 54
1612-1614
Kim YH Freeman JP Moody JD Engesse KH amp Cerniglia CE 2005 Effects of pH on
the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1
Appl Environ Microbiol 67 275-285
Kwok Chen-Ko amp Loh Kai-Che 2003 Effects of Singapore soil type on bioavalability of
nutrients in soil bioremediation Adv Environ Res 7 889-900
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
66
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Luning Prak DJ amp Pritchard PH 2002 Solubilization of polycyclic aromatic hydrocarbon
mixtures in micelar non-ionic surfactant solution Water Res 36 3463-3472
Maier MR Pepper LI amp Gerba PC 2000 Enviromental Microbiology Academic Press
Elsevier
Molina MC Gonzalez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz L 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Denaturing gradient gel
electrophoresis of PCR-amplified 16S Rdna a new molecular approach to analyse the
genetic diversity of mixed microbial communities In Akkermans ADL van Elsas JD
de Bruijn FJ (eds) Molecular microbial ecology manual Kluwer Academic Publishers
Dordrecht pp 1-23
Rolling-Wilfred FM Milner M Jones DM Lee K Daniel F Swanell-Richard JP amp Head
IM 2002 Robust hydrocarbon degradation and dynamic of bacterial communities
during nutrients-enhanced oil spillbiorremediation Appl Environ Microbiol 68 5537-
5548
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation an surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Vintildeas M Sabateacute J Guasp C Lalucat J y Solanas AM 2005 Culture-dependent and
independent aproaches establish the complexity of a PAH degrading microbial
consortium Can J Microbiol 51 897-909
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacillus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK Ma KK amp Fang M 2001 Isolation and optimization of
PAH-degradative bacteria from contaminated soil for PAH bioremediation Water Air
Soil Poll 13 1-13
Zaidi BR amp ImamSH 1999 Factors affecting microbial degradation of polycyclic aromatic
hydrocarbon phenanthrene in caribbean coastal water Mar Pollut Bull 38 738-749
Capiacutetulo
Aceptado en Water Air amp Soil Pollution (Febrero 2012)
Simarro R Gonzaacutelez N Bautista LF Molina MC amp Schiavi E
Evaluation of the influence of multiple environmental factors on the biodegradation
of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal
experimental design
Evaluacioacuten de la influencia de muacuteltiples factores ambientales en la biodegradacioacuten de dibenzofurano
fenantreno y pireno por un consorcio bacteriano usando un disentildeo experimental ortogonal
1b
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
69
Abstract
For a bioremediation process to be effective we suggest to perform preliminary studies in
laboratory to describe and characterize physicochemical and biological parameters (type and
concentration of nutrients type and number of microorganisms temperature) of the
environment concerned We consider that these studies should be done by taking into
account the simultaneous interaction between different factors By knowing the response
capacity to pollutants it is possible to select and modify the right experimental conditions to
enhance bioremediation
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
71
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic compounds composed of two
or more aromatics rings High molecular weight PAH (HMW-PAH) with four (ie pyrene) or
more aromatics rings and other heterocyclic aromatic compounds as dibenzofuran both with
high molecular mass are often more difficult to biodegrade that other low molecular weight
PAH (LMW-PAH) due to their lower solubility and biodegradability Many of them have toxic
mutagenic and carcinogenic properties and the effects of PAH as naphthalene or
phenanthrene in animals and humans their toxicity and carcinogenic activity has been
reported and well documented (Sudip et al 2002) In addition PAH are bioaccumulated in
the environment and trophic chains properties that increase with the numbers of rings There
is a natural degradation carried out by microorganism able to use PAH as carbon source
which represents a considerable portion of the bacterial communities present in polluted soils
(Heitkamp amp Cerniglia 1998) However this natural biodegradation may be affected by
environmental factors which optimization allows us to achieve a more efficient process
Temperature is a key factor in the physicochemical properties of PAH as well as in the
metabolism of the microorganisms Although it has been shown that biodegradation of PAH
is possible even at temperatures lower than 5 ordmC (Eriksson et al 2001) it is usually more
efficient at mild temperatures (15-25 ordmC) (Mohn amp Stewart 2000) The carbon nitrogen and
phosphorus (CNP) molar ratio is another important factor in biodegradation process
because affect the dynamics of the bacterial metabolisms changing the PAH conversion
rates and growth of PAH-degrading species (Leys et al 2004) The form in which these
essential nutrients are supplied affects the bioavailability for the microorganism being more
soluble and efficient the oxidated forms (such as nitrates) than reduced forms (such as
ammonium) (Schlessinger 1991)
Surfactants are compounds used to increase the PAH solubility although both
positive (Boochan et al 1998 Jin et al 2007) and negative effects (Boochan et al 1998
Laha amp Luthy 1992) on the biodegradation process has been reported The nature of the
effect depends on several factors such as the type and concentration of surfactant due to
the toxic properties of some of them (Jin et al 2007) and the increasing of toxicity of PAH
produced by increasing their solubility (Thibault et al 1996) Another factor considered is the
inoculum size related to the diversity and effectiveness of the biodegradation because in a
diluted inoculum the minority microorganisms which likely have an important role in the
biodegradation process can be removed (Szaboacute et al 2007) Moreover it has been
reported (Szaboacute et al 2007) that the addition of a readily metabolized carbon source (ie
glucose) improves the PAH degradation possibly due to the increased biomass although in
72
others cases (Wong et al 2000) this better bacterial growth reduced significantly PAH
degradation
We consider that the study of the individual effect of abiotic factors on the
biodegradation capacity of the microbial consortium is incomplete because the effect of one
factor can be influenced by other factors In this work the combination between factors was
optimized by an orthogonal experimental design fraction of the full factorial combination of
the selected environmental factors
Hence our two mains goals are to determine the optimal conditions for the
biodegradation of low (phenanthrene and dibenzophurane) and high (pyrene) molecular
weight PAH by a bacterial degrading consortium (C2PL05) and the study of the influence of
the factors (temperature CNP molar ratio type of nitrogen and iron source iron source
concentration carbon source surfactant concentration and inoculums dilution) in the
biodegradation In order to achieve these objectives we realized an orthogonal experimental
design to take into account all combination between eight factors temperature CNP molar
ratio nitrogen and iron source iron concentration addition of glucose surfactant
concentration and inoculum dilution at three and two levels
Material and methods
Chemicals and media
Dibenzofuran phenanthrene and pyrene (gt99 purity) were purchased from Sigma-Aldrich
Steinheim Germany) Stock mix of the three PAH was prepared by dissolving the necessary
amount in n-hexane (Fluka Steinheim Germany) In previously work (Bautista et al 2009)
we tested that the optimal surfactant for the consortium was the biodegradable and non
toxicTween-80 (Sigma-Aldrich Steinheim Germany) Bushnell-Haas Broth medium (BHB)
was purchased from Panreac (Barcelona Spain) and its original composition (02 g l-1
MgSO4middot7H2O 002 g l-1 CaCl2 2H2O 1 g l-1 KHPO4 1 g l-1 K2HPO4 1 g l-1 NH4NO3 005 g l-1
FeCl3) was modified according to the treatment (see Table 1)
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
73
Table 1 Experimental design
Treatment T
(ordmC) CNP (molar)
N source
Fe
source
Iron source concentration
(mM)
Glucose PAH ()
Surfactant concentration
Inoculum dilution
1 30 100505 (NH4)2SO3 Fe2(SO4)3 02 0100 CMC 10-3
2 20 1002116 (NH4)2SO3 FeNO3 005 0100 + 20CMC 10-2
3 25 100101 NaNO3 FeNO3 02 0100 + 20CMC 10-1
4 20 100505 NaNO3 Fe2(SO4)3 02 5050 + 20CMC 10-2
5 25 100505 NH4NO3 FeNO3 01 5050 CMC 10-2
6 30 100101 NH4NO3 Fe2(SO4)3 005 8020 + 20CMC 10-2
7 30 100101 NaNO3 FeCl3 01 0100 CMC 10-2
8 20 100505 NaNO3 FeCl3 005 8020 CMC 10-1
9 25 1002116 (NH4)2SO3 FeCl3 02 8020 CMC 10-2
10 20 1002116 NH4NO3 Fe2(SO4)3 01 0100 CMC 10-1
11 20 100101 NH4NO3 FeNO3 02 8020 CMC 10-3
12 25 100101 (NH4)2SO3 Fe2(SO4)3 005 5050 CMC 10-1
13 25 1002116 NaNO3 Fe2(SO4)3 01 8020 + 20CMC 10-3
14 30 1002116 NH4NO3 FeCl3 02 5050 + 20CMC 10-1
15 25 100505 NH4NO3 FeCl3 005 0100 + 20CMC 10-3
16 30 1002116 NaNO3 FeNO3 005 5050 CMC 10-3
17 30 100505 (NH4)2SO3 FeNO3 01 8020 + 20CMC 10-1
18 20 100101 (NH4)2SO3 FeCl3 01 5050 + 20CMC 10-3
Bacterial consortium
PAH-degrading consortium C2PL05 was isolated from a soil in a petrochemical complex in
Puertollano (Spain) and was identified and described in Molina et al (2009) All strains of
the consortium C2PL05 isolated by culture-dependent techniques were γ-Proteobacteria
and the strains presents belong to the genera Enterobacter Pseudomonas and
Stenotrophomonas (Molina et al 2009) In addition the diversity of the enriched microbial
consortium was characterised by a non culture-dependent molecular technique such as
denaturing gradient gel electrophoresis (DGGE) following the procedure described
elsewhere (Molina et al 2009) using the primers 341F-GC and 907R (GC clamp 5acute-CGC
CCG CCG CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995)
Experimental design
An orthogonal design form of L18 (37) (21) selected from the module of Statistica (Version 60)
was used to do the multi-factor combination A total of 18 experiments each in triplicate
were carried out in 100 ml Erlenmeyers flask with a total volume of 50 ml of Bushnell-Haas
Broth medium (BHB) (Panreac Barcelona Spain) with an original composition modified
74
according to the treatments requirements (see Table 1) The replicates were incubated in an
orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA) at 150 rpm under dark
conditions but prior to inoculate the consortium the flasks were shaken overnight to
equilibrate and solubilize most of the PAH In Table 1 shows a summary of environmental
conditions and incubation of each treatment Tween-80 concentration was 0012 mM the
critical micellar concentration (CMC) 100 of PAH was equivalent to 03 g l-1 (01 g l-1 of
each PAH) The initial cell concentration of the inoculum consortium was determined by the
most probably number (MPN) method (Wrenn amp Venosa 1983) The number of heterotrophic
microorganisms (315x106 cell ml-1) was measured with Luria Base broth (LB Panreac
Barcelona Spain) with glucose as carbon source and the PAH degrading microorganisms of
the consortium (695x105 cell ml-1) with BHB with PAH mix as carbon source
Cell density
Bacterial density during the PAH degrading process was monitored at 0 15 24 39 48 63
72 87 95 and 159 h by the increase in absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) Throughout the cell growth curve we
calculated the average of the cell densities increments (CDI) applying the equation 1
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and i
corresponds to each sample or sampling time The increments were normalized by
the initial absorbance measurements to correct the effect of the inoculum dilution
PAH extraction and analysis
At the end of each experiment (159 hours) PAH were extracted with dichloromethane and
the residue precipitated was dissolved in 1 ml of acetonitrile for high performance liquid
chromatography (HPLC) analysis using a ProStar 230 HPLC system (Varian Palo Alto CA
USA) with a reversed phase C18 column following the method previously described (Bautista
et al 2009) The residual concentration of each PAH was calculated from a standard curve
based on peak area at a wavelength of 254 nm The average percentage of phenanthrene
pyrene and dibenzofuran and average percentage of total PAH degradation (PD) for each
treatment are shown in Table 2
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
75
Statistical analyses
The effect of the individual parameters on the CDI and on the PD were analysed by a
parametric one-way analysis of variance (ANOVA) The variances were checked for
homogeneity by the Cochranacutes test Students-Newman-Keuls (SNK) test was used to
discriminate among different variables after significant F-test When data were not strictly
parametric Kruskal-Wallis test and Tukey-type multiple comparison test were used
The orthogonal design to determine the optimal conditions for PAH biodegradation is
an alternative to the full factorial test which is impractical when many factors are considered
simultaneously (Chen et al 2008) However the orthogonal test allows a much lower
combination of factors and levels to test the effect of interacting factors
Results and discussion
The consortium C2PL05 degrade phenanthrene pyrene and dibenfuran efficiently in 159 h
(Table 2) and also other PAH as naphthalene and anthracene (Molina et al 2009) The
study of the influence of each factor in the total PD (Figure 1) showed that only the carbon
source influenced in this parameter significantly (Table 3) Results concerning to carbon
source showed that PD were higher when PAH were added as only carbon source (100 of
PAH) The reason why the PD did not show statistical significance between treatments
except for the relative concentration of PAH-glucose may be due to significant changes
produced in PD at earlier times when PAH were still present in the cultivation media
However the carbon source incubation temperature and inoculum dilution were factors that
significantly influenced CDI (Table 3 Figure 2)
76
Table 2 Final percentage degradation of
phenanthrene (Phe) pyrene (pyr) and dibenzofuran
(Dib) and total percentage degradation (total PD) for
each treatment
percentage degradation Treatment Phe Pyr Dib Total PD
1 965 883 864 904 2 969 950 833 917 3 966 895 845 902 4 972 915 921 872 5 969 904 950 882 6 982 935 995 852 7 964 883 859 902 8 977 953 964 823 9 976 936 984 825 10 970 910 895 925 11 979 968 986 888 12 966 889 920 850 13 978 930 993 835 14 966 897 943 871 15 963 881 898 914 16 963 886 951 867 17 977 954 986 861 18 976 930 967 915
The conditions corresponding to listed treatments
are presented in Table 1
100
50
5
100
101
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
82
84
86
88
90
92 T (ordmC)
aa
a
aa
aa
aa
a
Tot
al P
D (
)
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
(SO
4)3
a
a
0acute05 0acute1
0acute2
Fe source
a
a
a
0 -
100
50 -
50
80 -
20
C Fe (mM)
a
b
c
CM
C
+ 2
0 C
MC
Gluc-PAHs
aa
10^-
1
10^-
2
10^-
3DilutionCMC
aa
a
Figure 1 Graphical analysis of average values of total percentage degradation (PD) under
different treatments and levels of the factors () represent the average of the total PD of the
treatments of each level Letters (a b and c) show differences between groups
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
77
Table 3 Analysis of variance (ANOVA) summary for the increments of cell density (CDI) and the total
percentage degradation (PD) of each factor MS is the mean of squares and df degrees of freedom
ANOVA of CDI ANOVA of total PD
Factor df MS F-value p-value df MS F-value p-value
T (ordmC) Error
2 056 1889 2 22 183 ns
51 002 51 12
Molar ratio CNP Error
2 003 069 ns 2 22 183 ns
51 005 51 12
N source Error
2 001 007 ns 2 214 177 ns 51 005 51 121
Fe source Error
2 003 066 ns 2 89 071 ns
51 005 51 126
Fe concentration Error
2 007 146 ns 2 118 095 ns 51 005 51 124
Glucose-PAH Error
2 024 584 2 1802
3085 51 004 51 395
8
CMC Error
1 001 027 ns 1 89 071 ns
52 005 52 125
Inoculum Dilutionb Error
2 331 a 2 113 091 ns 54 6614 51 125
a H-value obtained of Kruskal-Wallis test used for non parametric data Chi-square = 28 Overall
median = 044
p-value lt 001
p-value lt 0001
100
50
5
100
100
1
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
16
17
18
19
20
21
a
a
aa
a
aa
a
c
bCD
I
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
SO
4
Fe source
a
a
0acute05 0acute1
0acute2
C Fe (mM)
a
a
a
0-10
0
50-5
0
80-2
0
Gluc-PAH
a
b
c
CM
C
+ 2
0 C
MC
CMC
aa
10^-
1
10^-
2
10^-
3
00
05
10
15
20
25
30
35C
DI n
orm
aliz
ed
DilutionT (ordmC)
b
a
a
Figure 2 Graphical analysis of average values of cell density increments (CDI) and normalized cell
density increments (CDI normalized) of different treatments and levels of the factors () represent the
average of the CDI or CDI normalized of the treatments of each level Letters (a b and c) show
differences between groups
78
The temperature range considered in the present study might not affect the
biodegradation process since it is considered narrow by some authors (Wong et al 2000)
Nevertheless we observed significant differences in the process at different temperatures
showing an optimum at 25 ordmC for our microbial consortium growth (Figure 2) whereas when
consortium was incubated at 20 ordmC and 30 ordmC microorganisms remained in lag phase These
results were in agreement with the fact that respiration increases exponentially with
temperature (Q10 relationship) (Lloyd amp Taylor 1994) but increasing or decreasing
temperature beyond the optimal value will cause a reduction in microbial respiration We
suggest that moderate fluctuation of temperatures affect microbial growth rate but not
degradation rates because degrading population is able to degrade PAH efficiently in a
temperature range between 20-30 ordmC (Sartoros et al 2005)
The nutrient requirements for microorganisms increase during the biodegradation
process so a low CNP molar ratio can result in a reduced of the metabolic activity of the
degrader microorganisms and thus reduce their potential degrader (Leys et al 2004)
According to this author CNP ratios above 100101 provide enough nutrients to metabolize
the pollutants However our results showed that the CNP ratios supplied to the cultures
even the ratio 100505 did not affect the CDI and total PD This results indicate that the
consortium C2PL05 is able to degrade PAH even under low nutrients conditions due to its
high adaptation to the hard conditions of a chronically contaminated soil The results
concerning the addition of different nitrogen and iron sources did not show significant
difference in CDI and total PD Other works (Schelessinger 1991 Santos et al 2008) have
suggested that the addition of nitrogen in form of nitrates (Schelessinger 1991) and the iron
in form of sulphates or chlorides (Santos et al 2008) is more effective due to their high
solubility
The addition of readily biodegradable carbon source as glucose to a polluted
environment is considered an alternative to promote biodegradation The easy assimilation of
this compound result in an increase in total biomass (heterotrophic and PAH degrader
microorganisms) of the microbial population thereby increasing the degradation capacity of
the community Piruvate are a carbon source that promote the growth of certain degrading
strains as Pseudomonas putida (Lee et al 2003) whereas salicylate induces the synthesis
and activation of degradative enzymes (Chen amp Aitken 1999) Similarly to previous results
observed by Wong et al (2000) in the present study the addition of glucose to the cultures
had significant effects in total PD and CDI (Figure 1 Figure 2) Although the consortium
C2PL05 showed a significantly better growth with 80 of glucose the difference between
treatments (0100 5050 8020 of glucosePAH) showed that PD was higher when PAH
were added as only carbon source Previously it has been described that after a change in
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
79
the type of carbon source supplied to PAH-degrader microorganisms an adaptation period
for the enzymatic system was required reducing the mineralization rate of pollutants (Wong
et al 2000 Maier 2009 Simarro et al 2010) As glucose was added as additional carbon
source our results show an increase in CDI although the PD values decrease significantly
This indicated that glucose enhance the overall growth of consortium but decrease the
biodegradation rate of PAH-degrader population due to the adaptation of the corresponding
enzymatic system So in this case the addition of a readily carbon source retards the
biodegradation process The addition of surfactant to the culture media at concentration
above their CMC is essential to increase PAH degradation rate (Pantsyrnaya et al 2011)
However Yuan et al (2000) reported negative effects when the surfactant was added at
concentration above the CMC because the excess of micelles around PAH reduces their
bioavailability (Mulligan et al 2001) However our results showed that PD and CDI were not
affected by concentrations largely beyond the CMC Some non biodegradable surfactants
can be toxic to bacteria and therefore do not improve the biodegradation process (Bautista et
al 2009) Tween-80 was the optimal surfactant for the strains of the consortium C2PL05
(Bautista et al 2009) However the optimal type of surfactant is determined by the type of
degrading strains involved in the process (Bautista et al 2009) In addition it is important to
consider the possible use of surfactant as a carbon source by the strains preferentially to
PAHs which would reduce the rates of biodegradation (Kim amp Weber 2003)
Further dilution of the inoculum represents the elimination of minority species which
could result in a decrease in the degradation ability of the consortium if the eliminated
species represented an important role in the biodegradation process (Szaboacute et al 2007)
Our results concerning the inoculum concentration showed that this factor significantly
influenced in CDI but had no effect on total PD indicating that the degrading ability of the
consortium has not been altered by the dilution of the same In Gonzalez et al (2011) the
evolution and bacterial succession of the consortium C2PL05 by culture-dependent
techniques are described All of these identified strains were efficient in degradation of PAH
(Bautista et al 2009) but Enterobacter sp was dominant at the beginning of the degradation
process whereas Stenotrophomonas sp and Pseudomonas sp were less abundant In
addition DGGE fingerprint pattern studied and described in Molina et al (2009) showed a
low microbial diversity of the consortium C2PL05 typical of an enriched consortium from
chronically contaminated soil (Vintildeas et al 2005) The results present in this work suggest
that in cultures inoculated with the highest dilution of the consortium (10-3) the less abundant
microorganisms were eliminated reducing the competition for the dominant species which
can grow vigorously
80
The influence of some environmental factors on the biodegradation of PAH can
undermine the effectiveness of the process In this study the combination of all factors
simultaneously by an orthogonal design has allowed to establish considering the interactions
between them the most influential parameters in biodegradation process Finally we
conclude that the only determining factor in biodegradation by consortium C2PL05 is the
carbon source Although cell growth is affected by temperature carbon source and inoculum
dilution these factors not condition the effectiveness of degradation Therefore the optimal
condition for a more efficient degradation by consortium C2PL05 is that the carbon source is
only PAH
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Maacutester en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
81
References
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Boochan S Britz ML amp Stanley GA 1998 Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophila
Biotechnol Bioeng 59 482-494
Chen S-H amp Aitken MD 1999 Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
EnvironSci Technol 33 435ndash439
Chen J Wong MH Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAHs) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in Artic Tundra soil Appl EnvironMicrobiol 67 5107-
5112
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438-9446
Heitkamp MA amp Cerniglia CE 1998 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from Sediment below an oil field Appl EnvironMicrobiol 54
1612-1614
Jin D Jiang X Jing X amp Ou Z 2007 Effects of concenrtration head group and structure of
surfactants on the biodegradation of phenanthrene J Hazard Mater 144 215-221
Kim HS amp Weber WJ 2003 Preferential surfactant utilization by a PAH-degrading strain
effects on micellar solubilization phenomena Environ Sci Technol 37 3574-3580
Laha S amp Luthy RG 1992 Effect of non-ionic surfactants on the solubilization and
mineralization of phenanthrene in soil-water systems Biotechnol Bioeng 40 1367-
1380
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegradation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Leys MN Bastiaens L Verstraete W amp Springael D 2004 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Lloyd J amp Taylor JA 1994 On the temperature dependence of soil respiration Funct Ecol
8 315-323
82
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mulligan CN Young RN amp Gibbs BF 2001 Surfactant enhanced remediation of
contaminated soil a review Eng Geol 60 371-380
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Molecular microbial ecology manual
(Eds Akkermans ADL van Elsas JD Bruijn FJ) Kluwer Academic Publishers
Dordrecht pp 1-23
Pantsyrnaya T Blanchard F Delaunay S Georgen JL Geacuteudon E Guseva E amp Boudrant
J 2011 Effect of surfactants dispersion and temperature on solubility and
biodegradation of phenanthrene in aqueous media Chemosphere 83 29-33
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation and surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Sartoros C Yerushalmi L Beroacuten L amp Guiot S 2005 Effects of surfactant and temperature
on biotransformation kinetics of anthracene and pyrene Chemistry 61 1042-1050
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Sudipt KS Om VS amp Rakesh KJ 2002 Polycyclic aromatic hydrocarbons environmental
pollution and bioremediation Trends Biotechnol 20 243ndash248
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquatic Microbl Ecol 47 1-10
Thibault SL Anderson M amp Frankenberger WTJr 1996 Influence of surfactant on pyrene
desorption and degradation in soils Appl Environ Microbiol 62 283-287
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Poll 139 1-13
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
83
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon degrading bacteria by most-probably-number (MPN) Can J Microbiol
4 252-258
Yuan SY Wei SH amp Chang BV 2000 Biodegradation of polycyclic aromatic
hydrocarbons by a mixed culture Chemosphere 41 1463-1468
Capiacutetulo
Publicado en Bioresource Technology (2011) 102 9438-9446
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA
Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process
Efecto de los surfactantes en la biodegradacioacuten de HAP por un consorcio bacteriano y dinaacutemica de la comunidad
bacteriana durante el proceso
2
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
87
Abstract
The aim of this work was to evaluate the effect of a non-biodegradable (Tergitol NP-10) and
a biodegradable (Tween-80) surfactant on growth degradation rate and microbial dynamics
of a polycyclic aromatic hydrocarbon (PAHs) degrading consortium (C2PL05) from a
petroleum polluted soil applying cultivable and non cultivable techniques Growth and
degradation rate were significantly lower with Tergitol NP-10 than that with Tween-80
Toxicity did not show any significant reduction with Tergitol NP-10 whereas with Tween-80
toxicity was almost depleted (30) after 40 days Regarding to the cultured bacteria
Pseudomonas and Stenotrophomonas groups were dominant during PAH degradation with
Tergitol NP-10 whereas Enterobacter and Stenotrophomonas were dominant with Tween-80
DGGE analyses (PRIMER and MDS) showed that bacteria composition was more similar
between treatments when PAHs were consumed than when PAHs concentration was still
high Community changes between treatments were a consequence of Pseudomonas sp
Sphingomonas sp Sphingobium sp and Agromonas sp
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
89
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic pollutants composed of two
or more fused aromatic rings produced by natural and anthropogenic sources Besides
being toxic carcinogenic and mutagenic compounds the semi-volatile properties of some
PAH make them highly mobile throughout the environment (air soil and water) In addition
PAH have a high trophic transfer and biomagnification within the ecosystems due to the
lipophilic nature and the low water solubility that decreases with molecular weight (Clements
et al 1994) The importance of preventing PAH contamination and the need to remove PAH
from the environment has been recognized institutionally by the Unites States Environmental
Protection Agency (US-EPA) which has proposed 16 PAH as priority pollutants including
naphthalene phenanthrene and anthracene Currently governmental agencies scientist and
engineers have focused their efforts to identify the best methods to remove transform or
isolate these pollutants through a variety of physical chemical and biological processes
Most of these techniques involve expensive manipulation of the pollutant transferring the
problem from one site or phase to another (ie to the atmosphere in the case of cremation)
(Haritash amp Kausshik 2009) However microbial degradation is one of the most important
processes that PAH may undergo compared to others such as photolysis and volatilization
Therefore bioremediation can be an important alternative to transform PAH to less or not
hazardous forms with less input of chemicals energy and time (Haritash amp Kaushik 2009)
Most of the contaminated sites are characterized by the presence of complex mixtures
of pollutants Microorganisms are very sensitive to low concentrations of contaminants and
respond rapidly to environment perturbations (Andreoni et al 2004) Therefore microbial
communities chronically exposed to PAH tend to be dominated by those organisms capable
of use PAH as carbon and energy source (Gallego et al 2007) Even in areas previously
unpolluted there is a proportion of microbial community composed by PAH degrading
bacteria able to degrade PAH (Surridge et al 2009) These microbial communities subjected
to a polluted stress tend to be less diverse depending on the complexity of the composition
and the time of exposure (MacNaughton et al 1999) The biodegradation of hazardous
compounds by bacteria fungi and algae has been widely studied and the success of the
process will be due in part to the ability of the microbes to degrade all the complex pollutant
mixture However most of the PAH degradation studies reported in the literature have used
versatile single strains or have constructed an artificial microbial consortium showing ability
to grow with PAH as only carbon source by mixing together several known strains (Ghazali et
al 2004) Nevertheless pure cultures and synthetic microbial consortia do not represent the
natural behaviour of microbes in the environment since the cooperation among the new
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
90
species is altered In addition changes in microbial communities during pollutant
biotransformation processes are still not deeply studied Microbial diversity in soil
ecosystems can reach values up to 10 billion microorganisms per gram and possibly
thousands of different species although less than 10 can be culturables (Torsvik amp Ovreas
2002) Therefore additional information on biodiversity ecology dynamics and richness of
the degrading microbial community can be obtained by non-culturable techniques such as
DGGE In addition small bacteria cells are not culturable whereas large cells are supposed
to account 80 of the total bacterial volume (Nannipieri et al 2003) Therefore despite their
low proportion culturable bacteria can provide essential information about the structure and
functioning of the microbial communities With the view focused on the final bioremediation
culture-dependent techniques are necessary to obtain microorganisms with the desired
catabolic traits for bioaugmentation processes in polluted soils The PAH degradation is
limited by their low aqueous solubility but surfactants which are amphypatic molecules
enhance the solubility of hydrophobic compounds (Kolomytseva et al 2009) Previous works
(Bautista et al 2009) have shown that efficiency of a consortium named C2PL05 composed
by PAH degrading bacteria was significantly higher using surfactants
One of the main goals of the current work was to understand if culturable and non
culturable techniques are complementary to cover the full richness of a soil microbial
consortium A second purpose of the study was to describe the effect of different surfactants
(biodegradable and non-biodegradable) on growth rate PAH degradation rate and toxicity
reduction of a bacterial consortium (C2PL05) The microbial consortium C2PL05 was
isolated from a soil chronically exposed to petroleum products collected from a
petrochemical complex Finally the work is also aimed to describe the microbial dynamics
along the biodegradation process as a function of the surfactant used to increase the
bioavailability of the PAH
Material and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all 99 purity) were purchased from Sigmandash
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) Reagent grade
dichloromethane and n-hexane were supplied by Scharlau Chemie (Barcelona Spain)
Surfactants (Tween-80 and Tergitol NP-10) used were supplied by Sigma-Aldrich (Steinheim
Alemania) Bushnell-Haas Broth medium (BHB) was purchased from Panreac (Barcelona
Spain) and its composition is 02 g l-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 10 gmiddotl-1 KHPO4
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
91
10 gmiddotl-1 K2HPO4 10 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 Luria-Bertani media (LB) glucose and
phosphate buffer saline (PBS) were purchased from Panreac (Barcelona Spain)
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1 g of sieved soil (lt2 mm) was resuspended in
10 ml of PBS and incubated during 12 h in an orbital shaker (Innova 40 New Brunswick
Scientific Edison NJ USA) at 150 rpm and 25 ordmC under dark conditions After that 15 ml of
the supernatant was inoculated in 50 ml of BHB broth (pH 70) containing 1 wt Tween-80
as surfactant and naphthalene phenanthrene and anthracene (each at 250 mg l-1) as carbon
source Then the culture was incubated at 150 rpm and 25 ordmC under dark conditions until the
exponential phase was completed This was confirmed by monitoring the cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK) Then the consortium was stored at 4 ordmC to
stop growth At the beginning of each experiment 500 μl of the stored consortium (asymp 16 AU)
was inoculated in Erlenmeyer flasks
Experimental design and treatments conditions
To evaluate the influence of Tween-80 and Tergitol NP-10 (biodegradable and non-
biodegradable surfactant respectively) on the degrading capacity of the consortium C2PL05
as well as the evolution of its microbial community two different treatments each in triplicate
were carried out The replicates were performed in 100 ml Erlenmeyer flasks with 50 ml of
BHB medium (pH 70) Tween-80 or Tergitol NP-10 as surfactants (1 vv) a mixture of
naphthalene phenanthrene and anthracene in n-hexane (final concentration 500 mgmiddotl-1) and
500 microl of the C2PL05 consortium (88middot108 heterotrophic cellsmiddotml-1 and 44middot107 PAH degrading
cellsmiddotml-1 for the treatments with Tween-80 73middot105 heterotrophic cellsmiddotml-1 and 24middot103 PAH
degrading cellsmiddotml-1 for treatment with Tergitol NP-10) The replicates were incubated in an
orbital shaker (Innova 40) at 150 rpm and 25 ordmC under dark conditions during 45 days
Previously to inoculate the consortium the Erlenmeyer flasks were shaked overnight to
reach the solubility equilibrium of PAH and to allow the complete evaporation of n-hexane
Samples vigorously shaking to ensure homogeneity were withdrawn twice a day for 45 days
except for the initial 24 hours where the sampling frequency was higher Cell growth PAH
(soluble and precipitated) toxicity and number of heterotrophic and PAH degrading cells
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
92
were measures in all samples To study the dynamic of the microbial consortium through
cultivable and non-cultivable methods samples were withdrawn at 0 15 and 30 days
Bacterial growth MPN and toxicity assays
Bacterial growth was monitored by changes in the absorbance of the culture media at 600
nm using a Spectronic Genesys spectrophotometer According to the Monod equation
(Equation 1) the specific growth rate micro is essentially equal to micromax when substrate limitation
is avoided
SK
S
S
max
(Equation 1)
Therefore from the above optical density data the maximum specific growth rate (micromax)
was estimated as the logarithmized slope of the exponential phase applying the following
equation (Equation 2)
Xdt
dX (Equation 2)
where micromax is the maximum specific growth rate Ks is the half-saturation constant S
is the substrate concentration X is the cell density t is time and micro is the specific
growth rate In order to evaluate the ability of the consortium to growth with
surfactants as only carbon source two parallel treatments were carried out at the
same conditions than the two treatments above described but in absence of PAH
Heterotrophic and PAH-degrading population from the consortium C2PL05 were
enumerated during the PAH degrading process comparing the effect of Tergitol NP-10 and
Tween-80 as surfactants The estimation was performed by using a miniaturized MPN
technique in 96-well microtiter plates with eight replicate wells per dilution Total
heterotrophic microbial population was enumerated in 180 μl of Luria Bertani (LB) medium
with glucose (15 gmiddotl-1) and 20 microl of the microbial consortium PHA-degrading population were
counted in BHB medium (180 microl including the surfactant) 20 microl of a mixture of phenanthrene
anthracene and naphthalene in hexane (each at a final concentration of 500 mgmiddotl-1) and 20 microl
of the microbial consortium in each well The MPN scores were transformed into density
estimates accounting for their corresponding dilution factors
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
93
The toxicity was monitored during PAH degradation and estimations were carried out
using the Microtox assay with the bioluminescent bacterium Vibrio fischeri Three controls
considered as 0 inhibition were prepared with the photobacterium and 2 NaCl (vv) and
three blanks as 100 inhibition containing only 2 NaCl (vv) Samples were salted with
NaCl (2 vv final concentration) and the toxicity was expressed as the percentage of the V
fischeri inhibition after 15 min of incubation at 15 ordmC To study the toxicity of the medium
caused by PAH when the surfactants were not added toxicity evolution was measured from
a treatment with PAH as carbon source and degrading consortia but without surfactant under
same conditions previously described
PAH monitoring
In order to compare the effect of the surfactant on the PAH depletion rate naphthalene
phenanthrene and anthracene concentrations in the culture media were analysed using a
reversed-phase C18 column (Luna C18(2) 75 cm length x 46 mm ID 3 microm particle size
Phenomenex Torrance CA USA) following the method described elsewhere (Bautista et
al 2009) The concentration of each PAH was calculated from a standard curve based on
peak area at 254 nm The apparent first-order kinetic constant (kB) due to biotic processes
was calculated by applying Equation 3
iBiiAii
i CkCkdt
dCr (Equation 3)
where C is the PAH concentration kA is the apparent first-order kinetic constant due to
abiotic processes kB is the apparent first-order kinetic constant due to biological
processes t is the time elapsed and the subscript i corresponds to each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40) at 150 rpm and 25ordmC under dark
conditions PAH concentration in the control experiments were analyzed using the HPLC
system described previously The values of kA for each PAH were calculated by applying Eq
2 considering kB asymp 0 since no bacterial consortium was inoculated The amount of
precipitated and bioadsorbed PAH was measured after centrifugation of the samples Then
dichloromethane was added to the pellet and this extraction was repeated three times and
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
94
the fractions pooled The solvent was evaporated using a nitrogen flow and the extract was
dissolved into a known volume of acetonitrile for HPLC analysis
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
Samples from cultures of the bacterial consortium C2PL05 during the PAH degrading
process were collected to identify the effect of the surfactants (Tergitol NP-10 and Tween-80)
To get about 20-30 colonies isolated at each collecting time samples of each treatment were
streaked onto Petri plates with BHB medium and purified agar and were sprayed with a
mixture of naphthalene phenanthrene and anthracene in n-hexane (final concentration 500
mgl-1) as carbon source The Petri plates were incubated at 25 ordmC under dark conditions
The isolated colonies were transferred onto LB agar-glucose plates in order to increase
microbial biomass for DNA extraction and stored in 50 glycerol (vv) at -80 ordmC In total 91
degrading colonies from the treatment with Tween-80 and 83 degrading colonies from the
treatment with Tergitol NP-10 were isolated
Total DNA was extracted using Microbial DNA isolation kit (MoBio Laboratories
Solano Beach CA USA) to perform the molecular identification of the PAH-degrader
isolated cultured (DIC) Amplification of the 16S rRNA coding region of the DNA was
performed as described by Vintildeas et al (2005) using the primers 16F27 (5rsquo-
AGAGTTTGATCMTGGCTCAG-3rsquo) and 16R1488 (5rsquo-TTACCTTGTTACGACTTCAGG-3rsquo) and
sequenced using the same primers Sequences were edited and assembled using
ChromasPro software version 142 (Technelysium Pty Ltd Tewantin Australia)
All of the 16S rRNA gene sequences were edited and assembled by using BioEdit
software version 487 BLAST search (Madden et al 1996) was used to find nearly identical
sequences for the 16S rRNA sequences determined Sequences were aligned using the Q-
INS-i algorithm (Katoh amp Toh 2008) of the multiple sequence alignment software MAFFT
version 6611 aligning sequences in a single step Sequence data obtained and 34
sequences downloaded from GenBank were used to perform the phylogenetic trees
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates by using PAUP
version 40B10 Maximum parsimony (MP) was also analyzed using PAUP 40B10 as is
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
95
described in Molina et al (2009) Sequences of Aquifex piruphilus were used as out-group
according to previous phylogenetic affiliations (Vintildeas et al 2005)
Denaturing gradient gel electrophoresis from microbial consortium during PAH degrading
process
Non culture dependent molecular techniques such as denaturing gradient gel
electrophoresis (DGGE) were performed to know the effect of the surfactant on the total
biodiversity of the microbial consortium C2PL05 during the PAH degradation process and
compared with the initial composition of the consortium The V3 to V5 variable regions of the
16S rRNA gene were amplified using the primers set 16S 518F and 16S 338R-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primers 338R-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded onto a 10
(wtvol) polyacrilamide gels that was 075 mm tick with a denaturing gradient of 35-65
(100 denaturant contained 7 M urea and 40 formamide) DGGE was performed in 1xTAE
buffer (20 M Tris-acetate 100 mM Na2EDTA pH 74) using a DGGE 2401 system (CBS
Scientific Co Del Mar CA USA) at 80 V and 60 ordmC for 16 h Gels were stained for 45 min in
1xTAE buffer containing Syber-Gold (500 μlmiddotl-1) and viewed under UV light Predominant
bands in DGGE gel were excised with a sterile razor blade and diluted in 50 μl of deionized
water overnight at 4ordmC Due to impossibility of reamplified bands DNA of the bands was
cloned in the pGEM-T Easy Vector (Promega Madison WI) Sequence of this PAH-degrader
uncultured bacterium (DUB) were edited and assembled as described above and included in
the matrix to perform the phylogenetic tree as described previously using the identification
code DUB
Statistical analyses
The maximum specific growth rate (micromax) and the kinetic constant of PAH biodegradation (kB)
were evaluated by both one and two-way analysis of variance (ANOVA) using Statistica 60
software (Statsoft Inc Tulsa OK USA) to determine differences between PAH (naphthalene
phenanthrene and anthracene) and surfactants (Tween-80 and Tergitol NP-10) Prior to
analyses Cochranrsquos C-test was used to check the assumption of homogeneity of variances
Student-Newman-Keuls test (SNK) was used to discriminate among different treatments after
significant F-test Differences in microbial assemblages were graphically evaluated for each
factor combination (surfactant and time) with non-metric multidimensional scaling (MDS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
96
using PRIMER software SIMPER method was used to identify the percent contribution of
each band to the dissimilarity or similarity in microbial assemblages between and within
combination of factors Based on Viejo (2009) bands were considered ldquohighly influentialrdquo if
they contributed to the first 70 of cumulative percentage of average dissimilaritysimilarity
betweenwithin combination of factors
Results and discussion
Bacterial growth and toxicity media during biodegradation of PAH
Since some surfactants can be used as carbon sources cell growth of the consortium was
measured with surfactant and PAH and only with surfactant without PAH to test the ability of
consortium to degrade and grow with both surfactants (Figure 1A) The microbial consortium
C2PL05 growth was significantly lower with Tergitol NP-10 than that reached with Tween-80
which showed the best cell growth with a maximum density (Figure 1A) In addition the
growth curve with PAH and Tergitol NP-10 showed a longer latent phase (36 hours) than
with PAH and Tween-80 (lt 12 hours) The specific growth rate (micromax) of the consortium
C2PL05 was significantly higher (Table 1A) with Tween-80 than that with Tergitol NP-10 The
results showed that Tween-80 was biodegradable for consortium C2PL05 since that
surfactant was used as the only carbon source (Figure 1A) Finally when using Tergitol NP-
10 as the only carbon source growth was not observed so that this surfactant was not
considered biodegradable for the consortium
Toxicity test (bioluminescence inhibition in Vibrio fischeri) indicates that high values
observed during the PAH degrading process with Tergitol NP-10 is caused at the initial time
by both PAH and surfactant (Figure 1B) However when PAH are totally consumed (40-45
days) toxicity still remained high and constant which means that toxicity is only due to the
Tergitol NP-10 (Figure 1B) The toxicity of PAH + biodegradable surfactant (Tween-80)
treatment decreased as the PAH and the surfactant were consumed and was almost
depleted (30) after 40 days of cultivation The toxicity showed a slight increment at the
beginning of the degradation process (Figure 1B) as a consequence of the potential
accumulation of intermediate PAH degradation products (Molina et al 2009)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
97
00
02
04
06
08
10
12
14
16
18
0 5 10 15 20 25 30 35 40 45
30
40
50
60
70
80
90
100
Tox
icity
(
)
Time (day)
B
A
Abs
orba
nce 60
0 nm
(A
U)
Figure 1 (A) Cell density of the consortium C2PL05 with PAH and Tween-80 () with
Tween-80 () with PAH and Tergitol NP-10() and with Tergitol NP-10 () (B)
Toxicity of the cultivation media during degradation of PAH by the consortium C2PL05
grown with Tween-80 () Tergitol NP-10 () and of the control experiment PAHs
without surfactants ()
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
98
The residual total concentration of three PAH of the treatments with surfactants and
the treatments without any surfactants added is shown in Figure 2 The consortium was not
able to consume the PAH when surfactants were not added PAH biodegradation by the
consortium C2PL05 was higher and faster (15 days) with Tween-80 than with Tergitol NP-10
(40 days) In all cases when surfactant was used no significant amount of PAH were
detected in precipitated or bioadsorbed form at the end of each experiment which means
that all final residual PAHs were soluble
0 5 10 15 20 25 30 35 40 45
0
10
20
30
40
50
60
70
80
90
100
Res
idua
l con
cent
ratio
n of
PA
Hs
()
Time (days)
Figure 2 Residual total PAH concentration (wt) in the treatment with Tween-80
() Tergitol NP-10 () and without surfactant ()
According to previous works (Bautista et al 2009 Molina et al 2009) these results
confirm that this consortium is adapted to grow with PAH as only carbon source and can
degrade PAH efficiently when surfactant is added According to control experiments (PAH
without consortium C2PL05) phenathrene and anthracene concentration was not affected by
any abiotic process (kA asymp 0 h-1) in the case of naphthalene some degree of abiotic depletion
was measured during the controls yielding an apparent first-order abiotic rate constant of
27middot10-3 plusmn 7middot10-5 h-1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the treatments so this not influence in the high
biodegradation rate of naphthalene for Tween-80 treatments The biotic depletion rate (kB) of
the three PAH was significantly higher for Tween-80 than that calculated for Tergitol NP-10
(Table 1B) There were no significant differences between PAH for Tergitol NP-10 (2 x 10-3 plusmn
4 x 10-4) whereas in the case of Tween-80 the value of kB for naphthalene (3 x 10-2 plusmn 6 x 10-4)
was higher than that for phenanthrene and anthracene (1 x 10-2 plusmn 4 x 10-4)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
99
Table 1 Analysis of variance (ANOVA) for the effects of surfactants on the specific
growth rate micromax (A) and for the effects of the surfactants and PAH on the biotic
degradation rate kB (B) of the C2PL05 consortium SS is the sum of squares and df
the degrees of freedom
Effect (A) SS df F-value p-value
Surfactant 16 1 782 0001
Error 0021 2
Effect (B) SS df F-value p-value
PAH 15middot10-4 2 779 0001
Surfactant 82middot10-4 1 4042 0001
PAH x Surfactant 12middot10-4 2 624 0001
Error 203middot10-7 12
Molecular characterization of the cultured bacteria of the consortium C2PL05 and dynamics
during the PAH degradation
The identification of cultured microorganisms and their phylogenetic relationships are keys to
understand the biodegradation and ecological processes in the microbial consortia From the
consortium C2PL05 grown with Tween-80 91 strains were isolated and sequenced From
them 7 different genotypes of PAH-degrading cultures (DIC-1 JA DIC-2 JA DIC-5 JA DIC-6
JA DIC-7 JA DIC-8JA and DIC-9JA) were identified by 16S rRNA For the treatment with
Tergitol NP-10 83 strains were isolated and sequenced and 6 different genotypes were
identified (DIC-1 RS DIC-2 RS DIC-3 RS DIC-4 RS DIC-5 RS and DIC-6 JA) One of the
isolated cultures from Tergitol NP-10 showed an identical sequence to one of the strains
grown with Tween-80 therefore the previous code (DIC-6JA) was kept Table 2 show a
summary of the PAH-degrader cultures identification The aligned matrix contained 1576
unambiguous nucleotide position characters with 424 parsimony-informative Parsimony
analysis of the data matrix yielded 10 parsimonious trees with CI = 0609 and RI = 0873 In
the parsimonic consensus tree 758 of the clades were strongly supported by boostrap
values higher or equal to 70 (Figure 3) All cultivable strains identified were γ-
proteobacteria (gram-negative) and were located in three clades Pseudomonas clade
Enterobacter clade and Stenotrophomonas clade These results are consistent with those of
Vintildeas et al (2005) who observed a strong dominance of gram negative bacteria in PAH
contaminated soil during the bioremediation process In Pseudomonas clade (Figure 3) DIC
are located in three clearly groups So DIC-2RS and DIC-3RS were grouped with P
frederiksbergensis which has been previously described in polluted soils (ie Holtze et al
2006) showing ability to reduce the oxidative stress generated during the PAH degrading
process DIC-1JA DIC-2JA (Tween-80) and DIC-1RS (Tergitol NP-10) were nested in very
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
100
solid group characterized by the presence of the type strain P koreensis previously studied
as an agricultural soil species (Kwon et al 2003) and DIC-5RS was located in P putida
group well known by their capacity to degrade high molecular weight PAH (Samantha et al
2002) to produce surfactants (Kruijt et al 2009) and to resist high temperature and salinity
(Egamberdieva amp Kucharova 2009) So several species of Pseudomonas (ie P putida P
fluorescens) have been widely studied in bioremediation (Molina et al 2009) and the present
results confirmed that it was the most representative group with the non biodegraded
surfactant treatment DIC-7JA DIC-8JA and DIC-9JA (Tween-80) which were identified as E
cloacae (Table 2) belonged to the Enterobacter clade with a strongly statistic support (Figure
3) In this clade DIC-4RS (Tergitol NP-10) is genetically related with E ludwigii which has
been recently described as relevant medical species (Hoffman et al 2005) but completely
unknown his PAH degrading capacity Enterobacter genus has been traditionally studied by
its animal gut symbiotic function but rarely recognized as a soil PAH degrading group
(Toledo et al 2006) In this phylogenetic tree E cloacae and E ludwiggi were not resolved
This result is according to Roggenkamp (2007) who consider necessary to use more
molecular markers within Enterobacter taxonomical group in order to contrast the
phylogenetic relationships In addition Enterobacter genera may not be a monophyletic
group (Kampfer et al 2005) Therefore more phylogenetic studies need to be done to clarify
the species concept within this group Finally DIC-5JA (Tween-80) and DIC-6JA isolated
from experiments using both surfactants (Tween-80 and Tergitol NP) are clearly belong to
type strain Stenotrophomonas clade genetically close to S maltophiliaT (Table 2) which has
been described as PAH-degrader (Zocca et al 2004)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
101
Figure 3 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) from the consortium C2PL05 with Tergitol NP (DIC-1JA ndash DIC-9JA)
and Tween-80 (DIC-1RS ndash DIC-5RS) and PAH-degrader uncultured bacteria (DUB) obtained from
DGGE of the consortium with both surfactant at 0 15 and 30 days of the process Boostrap values of
neighbourjoining and parsimonus higher than 50 are showed on the branch of the tree (NJMP) No
incongruence between parsimony and neighbour joining topology were detected Pseudomonas
genus has been designated as P Pantoea genus as Pa Sphingobium as S and Sphingomonas as
Sp Xantomonas as X and Xyxella as Xy T= type strain
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
102
Table 2 Bacteria identification and percentage of similarity from the GenBank data base Degrading
uncultured bacteria (DUB) form DGGE bands and degrading isolates cultured (DIC)
Colonies identified by cultivable techniques
DIC simil Mayor relationship with bacteria
of GenBank(acc No) Phylogenetic group
DIC-1RSb 980 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ)
DIC-2RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-3RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-4RS b 990 Enterobacter ludwigii (AJ853891) Enterobacter cloacae (EU733519)
Enterobacteriaceae (γ)
DIC-5RS b 990 Pseudomonas putida (EU046322) Pseudomonadaceae (γ) DIC-6JA-6RS c 1000 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-1JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-2JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-5JA a 9964 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-7JA a 9985 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-8JA a 9993 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-9JA a 100 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ)
Identification by non-cultivable techniques
DUB Band
simil Mayor relationship with bacteria
of GenBank (acc No) Phylogenetic group
DUB-1RS a 1 970 Uncultured Nitrobacteria sp (AM990004) Caulobacteraceae (α) DUB-2RS b 21 980 Bradyrhizobium sp (HQ171485) Bradyrhizobiaceae (α) DUB-3RS b 24 940 Uncultured bacterium (AY939443) -- DUB-4RS b 24 100 Uncultured Pseudomonas sp (HM561497) Pseudomonadaceae (γ) DUB-10RSb 28 980 Uncultured Sphingomonas sp (HM438638) Sphingomonadaceae(α) DUB-11RSa 28 960 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-6RS b 29 980 Pseudomonas stutzeri (HQ130335) Pseudomonadaceae (γ) DUB-8RS b 29 980 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-5RS b 29 990 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-7RS b 29 980 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-9RS b 30 970 Bacterium (AJ295668) --
a DIC or DUB belonging to treatments with Tween-80 b DIC or DUB belonging to treatments with Tergitol NP-10 c DIC or DUB belonging to treatments with Tween-80 and Tergitol NP-10
With respect to the dynamics of the microorganisms isolated from the microbial
consortium C2PL05 (Figure 4) Pseudomonas (DIC-1RS DIC-2RS and DIC-5RS Figure 4A
4B) with a percentage around 60 and Stenotrophomonas (only DIC-6JA Figure 4A and
4D) with presence of 90 were dominant groups during the PAH degrading process with
Tergitol NP-10 at 0 and 30 days in the case of Pseudomonas and at 15 days in the case of
Stenothrophomonas Enterobacter (DIC-4RS Figure 4A 4D) only was present at the end of
the process with a percentage around 40 With Tergitol NP-10 Pseudomonas sp group
was dominant coincident with the highest relative contribution of PAH degrading bacteria to
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
103
total heterotrophic bacteria at the beginning (33 of contribution) and at the end of the
degradation process (41) However Enterobacter (DIC-7JA DIC-8JA and DIC-9JA Figure
4E and 4H) with a maximum presence of 98 at 0 days and Stenotrophomonas (DIC-6JA
Figure 4E and 4G) with a maximum presence of 85 at the end of the process were
dominant with the biodegradable Tween-80 Thus Enterobacter sp seems to start the PAH
degradation process and Stenotrophomonas to finish it but at 15 days three groups coexist
within a contribution ranging 20 to 50 (Figure 4E) Therefore in agreement with other
authors (Colores et al 2000) the results of the present work confirm changes in the
bacterial (cultured and non-cultured) consortium succession during the PAH degrading
process driven by surfactant effects According to Allen et al (1999) the diversity of the
bacteria cellular walls may explain the different tolerance to grow depending on the
surfactant used Previous works (Piskonen amp Itaumlvaara 2004) have shown the capacity of
some bacteria to use both surfactants (Tergitol NP-10 and Tween-80) as carbon sources
However in agreement with recent studies (Bautista et al 2009) the present work confirms
that Tergitol NP-10 is not degradable by the consortium C2PL05 These results showed a
drastic change of the consortium composition after the addition of surfactant
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
104
0 15 30
0102030405060708090
100
102030405060708090
100
D
C
B
A
0 15 30
F DIC-1JA DIC-2JA
E
G DIC-6JA DIC-5JA
0 15 30
H
Time (day)
DIC-7JA DIC-8JA DIC-9JA
Pse
udom
onas
ribot
ypes
(
)
DIC-1RS DIC-2RS DIC-3RS DIC-5RS
102030405060708090
100
Ste
notr
opho
mon
as
ribot
ypes
(
)
DIC-6JA
0 15 30
102030405060708090
100
Ent
erob
acte
r rib
otyp
es (
)
DIC-4RS
Time (days)
Tot
al s
trai
ns (
)
Figure 4 (A) Dynamics of the microbial consortium C2PL05 during PAH degradation process with
Tergitol NP-10 and (E) with Tween-80 as surfactants Isolated and identified genus were
Pseudomonas () Stenotrophomonas () and Enterobacter () Dynamics and succession of
the (B) Pseudomonas (C) Stenotrophomonas and (D) Enterobacter ribotypes with Tergitol NP-10
as surfactant Dynamics and succession of the (F) Pseudomonas (G) Stenotrophomonas and (H)
Enterobacter ribotypes
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
105
Biodiversity and evolution of the non-cultivable bacteria of the consortium during PAH
degradation
The most influential DGGE bands to similarity 70 of contribution according to the results of
PRIMER analyses were cloned and identified allowing to know the bands and species
responsible of similarities and dissimilarities SIMPER procedure (Clarke 1993) was used to
identify the percentage contribution () that each band made to the measures of the Bray-
Curtis similarity between treatments at each surfactant (Tween-80 and Tergitol-NP) and time
(initial time after 15 and 30 days) Bands were selected as lsquoimportantrsquo to be identified if they
contributed to the first 70 of cumulative percentage of average similarity between
treatments Summary of the identification process are shown in Table 2 Phylogenetic
relationship of these degrading uncultured bacteria was included in the previous
parsymonious tree (Figure 3) In total 11 uncultured bacteria were identified DUB-4RS
DUB-6RS DUB-8RS and DUB-11RS were located in the Pseudomonas clade but these
uncultured bacteria were no grouped with a particular species of the genus DUB-5RS DUB-
7RS were identified as Sphingobium sp and DUB-10RS as Sphingomonas sp and located
in the Sphingobium and Sphingomonas clade respectivelly DUB-2RS was nested in
Bradyrhizobium clade because was identified as Bradyrhizobium sp and this clade was
supported by the type strain B japonicum In the same way DUB-1RS identified as
Uncultured Nitrobacteria was located in the Nitrobacteria clade belonged to N
hamadeniensis type strain Finally DUB-3RS and DUB-9RS were not identified with a
particular genus so they were located in a clade composed by uncultured bacteria The
phylogenetic relationship of these degrading uncultured bacteria allows expanding
knowledge about the consortium composition and process development Some of them
belong to α-proteobacteria DUB-5RS and DUB-7RS were related to Sphingobium group and
DUB-10RS with Sphingomonas clade thought this relationship should be confirmed
considering the low boostrap values Sphingomonas is a genus frequently isolated as PAH
degrader (Jing et al 2007) and important in the degradation of phenanthrene metabolites
(Tao et al 2007) Similarly Sphingobium sp has been described as PAH degrader
specifically in phenanthrene degradation process (Jing et al 2007) DUB-2RS belonged to
Bradyrhizobiaceae phylogenetic group and although Bradyrhizobium are genera barely
described as PAH degrading bacteria some studies based on PAH degradation by chemical
oxidation and biodegradation process have described that this plant-associated bacteria are
involved in the degradation of extracting agent used in PAH biodegradation techniques in
soils (Rafin et al 2009) DUB-1RS is a genotype related to Nitrobacteria clade However
Nitrobacteria has not been described as PAH degrader but this bacteria transform nitrites in
nitrates from the oxidation of nitrites (Modrogan et al 2010) and it is likely involved in the
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
106
nitrites oxidation process when the bioavailability of PAH in the media are low and so it is
not toxic for this bacteria Finally DUB-8RS DUB-6RS and DUB-11RS showed a high
similitude with Pseudomonas strain though the phylogenetic relationship with Pseudomonas
clade of DUB-11RS should be confirmed
Analysis of DGGE gel (Figure 5) showed that treatment with Tergitol NP-10 had very
few changes during biodegradation process whereas when the consortium was grown with
the biodegradable surfactant Tween-80 more changes were observed Similarity (Table 3)
between treatments were compared and analyzed by type of surfactant (Tween-80 vs
Tergitol NP-10) or by sampling time (15 days vs 30 days) The MDS analysis (Table 3)
showed the lowest values of Bray Curtis similarity coefficient between the consortium at
initial time (T0 not exposed to PAH and surfactants) with the PAH and Tween-80 after 15
days (16) and 30 days (7) However the similarity of T0 with PAH and Tergitol NP-10 after 15
days (22) and 30 days (26) was much higher Similarity between time treatments (15 and 30
days) within Tergitol NP-10 (56) was higher than with Tween-80 (32) The similarity within
treatments with Tween-80 was mainly due to the bands 1 and 29 (Table 3 Uncultured
Nitrobacteria and Sphingobium and Pseudomonas respectively see Table 2) whereas the
similarity within Tergitol NP-10 treatment was due to bands 1 and 30 (Table 3 Uncultured
Nitrobacteria and Uncultured bacteria respectively see Table 2)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
107
Figure 5 Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen fragments
from the consortium C2PL05 with initial inoculum (lane 1) with Tween-80 at 15 (lane 2) and 30 (lane 4)
days with Tergitol NP-10 at 15 (lane 3) and 30 (lane 5) days and molecular weight markers (lane 0)
According to PRIMER analysis similar bands between treatments (15 and 30 days) with Tergitol NP-
10 () and between treatments (15 and 30 days) with Tween-80 () are shown
1 Uncultured Nitrobacteria sp(DUB-1RS) 21 Bradyrhizobium sp (DUB-2RS) 24 Uncultured bacterium (DUB-3RS)
Uncultured Pseudomonas (DUB-4RS) 28 Uncultured Sphingomonas sp (DUB-10RS)
Pseudomonas sp (DUB-11RS) 29 Pseudomonas stutzeri (DUB-6RS) Pseudomonas sp
(DUB-8RS) Sphingobium sp(DUB-5RS DUB-7RS)
30 Uncultured Bacterium (DUB-9RS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
108
Table 3 Bands contributing to approximately the first 70 of cumulative percentage
of average similarity () Bands were grouped by surfactant and time
Band Tween-80 TergitolNP-10 15 days 30 days 1 3828 2105 2707 3014 29 2969 1509
30 2469 19
24 881 3447
27 845
21 516
Cumulative similarity () 3168 4479 4479 3391 Cloning was not possible
The genera identified in this work have been previously described as capable to
degrade the three PAH completely and efficiently with a reduction of the toxicity (Bautista et
al 2009) In the case of the treatment with Tween-80 the lower biodiversity may be caused
by a few dominant species of these genera driven during the PAH degradation process by
antagonist and synergic bacterial interactions and not by differences in the functional
capacities However when consortium grows with a non-biodegradable surfactant there is
higher biodiversity of species and interaction because the activity of various functional
groups can be required to deal the unfavorable environmental conditions
Conclusions
The choice of surfactants to increase bioavailability of pollutants is critical for in situ
bioremediation because toxicity can persist when surfactants are not biodegraded
Nevertheless surfactants affect the dynamics of microbial populations in a stable PAH-
degrading consortium From the application point of view the combination of culturable and
non culturable identification techniques may let to optimize the bioremediation process For
bioaugmentation processes culturable tools help to select the more appropriate bacteria
allowing growing enough biomass before adding to the environment However for
biostimulation process it is important to know the complete consortium composition to
enhance their natural activities
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
109
Acknowledgment
Authors are deeply indebted to Raquel Sanz Laura Saacutenchez and Laura Garciacutea and for their
support during the development of the experiments Authors also gratefully acknowledged
the financial support from the Spanish Ministry of Environment (Research project 1320062-
11) and Fundacioacuten Alfonso Martiacuten Escudero Authors also thank Repsol-YPF for providing
the soil samples This work is framed within the Official Maacutester en Ciencia y Tecnologiacutea
Ambiental from Universidad Rey Juan Carlos
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
110
References
Allen CRC Boyd DR Hempenstall F Larkin MJ amp Sharma D 1999 Contrasting effects
of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons
to cis-dihydrodiols by soil bacteria Appl Environ Microbiol 65 1335-1339
Andreoni V Cavalca L Rao MA Nocerino G Bernasconi S DellrsquoAmico E Colombo M
amp Gianfreda L 2004 Bacterial communities and enzyme activities of PAH polluted
soils Chemosphere 57 401-412
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 30 1ndash10
Clements WH Oris JT amp Wissing TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Lepomis macrochirus
Archiv Environ Contam Toxicol 26 261ndash266
Colores GM Macur RE Ward DM amp Inskeep WP 2000 Molecular analysis of
surfactant-driven microbial population shifts in hydrcarbon-contaminated soil Appl
Environ Microbiol 66 2959-2964
Egamberdieva D A amp Kucharova Z 2009 Selection for root colonising bacteria stimulating
wheat growth in saline soils Biol Fert Soils 45 563ndash571
Gallego RJS Garciacutea-Martiacutenez MJ Llamas JF Belloch C Pelaacuteez AI amp Saacutenchez J
2007 Biodegradation of oil tank bottom sludge using microbial consortia
Biodegradation 18 269ndash281
Ghazali FM Rahman RNZA Salleh AB amp Basri M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hydrocarbons (PAH) A review J Hazard Mater 169 1-15
Hoffmann H Stindl S Stumpf A Mehlen A Monget D Heesemann J Schleifer KH amp
Roggenkamp A 2005 Description of Enterobacter ludwigii sp Nov a novel
Enterobacter species of clinical relevance Syst Appl Microbiol 28 206ndash212
Holtze MS Nielsen P Ekelund F Rasmussen LD amp Johnsen K 2006 Mercury affects
the distribution of culturable species of Pseudomonas Appl Soil Ecol 31 228ndash238
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor R 1969 Evolution of protein molecules in Mammalian protein
metabolism (H Munro ed) Academic Press New York
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
111
Katoh K amp Toh H 2008 Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMC Bioinformatics 9 paper
212
Kampfer P Ruppel S amp Remus R 2005 Enterobacter radicincitans sp Nov a plant
growth promoting species of the family Enterobactriaceae Syst Appl Microbiol 28
213ndash221
Kolomytseva MP Randazzo D Baskunov BP Scozzafava A Briganti F amp Ludmila A
2009 Role of surfactants in optimizing fluorene assimilation and intermediate
formation by Rhodococcus rhodochrous VKM B-2469 Bioresource Technol 100
839-844
Kruijt M Tran H amp Raaijmakers JM 2009 Functional genetic and chemical
characterization of biosurfactants produced by plant growth-promoting Pseudomonas
putida J Appl Microbiol 107 546-556
Kwon SW Jong WS Kim S Park IC Yoon SH Park DH Lim CK amp Go SJ 2003
Pseudomonas koreensis sp Nov Pseudomonas umsongensis sp Nov and
Pseudomonas jinjuensis sp Nov novel species from farm soils in Korea Int J Syst
Evol Microbiol 53 21ndash27
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang Y amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Modrogan C Diaconu E Orbulet OD amp Miron AR 2010 Forecasting Study for Nitrate Ion
Removal Using Reactive Barriers Rev Chim 6 580-584
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions Eur J Soil Sci 54 655-670
Piskonen R amp Itaumlvaara M 2004 Evaluation of chemical pretreatment of contaminated soil
for improved PAH bioremediation Appl Microbiol Biotechnol 65 627-634
Rafin C Veignie E Fayeulle A amp Surpateanu G 2009 Benzo[a]pyrene degradation using
simultaneously combined chemical oxidation biotreatment with Fusarium solani and
cyclodextrins Bioresource Technol 100 3157-3160
Roggenkamp A 2007 Phylogenetic analysis of enteric species of the family
Enterobacteriaceae using the oric-iocus Syst Appl Microbiol 30 180-188
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
112
Samantha SK Singh OV amp Jain RK 2002 Polycyclic aromatic hydrocarbons
environmental pollution and bioremediation Trends Biotechnol 20 243-248
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil in Singh
A Kuhad RC Ward OP (Eds) Adv Appl Biorem p 103-121 Springer Berlin
Tao X-Q Lu G-N Dang Z Yi X-Y amp Yang C 2007 Isolation of ohenanthrene-degrading
bacteria and characterization of phenanthrene metabolites Worl J Biotechnol 23
647-6554
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities Syst Appl Microbiol 29 244ndash252
Torsvik V amp Ovreas L 2002 Microbial diversity and function in soil from genes to
ecosystems Curr Opin Microbiol 5 240ndash245
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Mar Eco- Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Zocca C Gregori SD VisentiniF amp Vallini G 2004 Biodiversity amongst cultivable
polycyclic aromatic hydrocarbon-transforming bacteria isolated from an abandoned
industrial site FEMS Microbiol Lett 238 375-382
Capiacutetulo
Enviado a FEMS Microbiology Ecology en Diciembre 2012
Simarro R Gonzaacutelez N Bautista LF amp Molina MC
High molecular weight PAH biodegradation by a wood degrading
bacterial consortium at low temperatures
Biodegradacioacuten de hidrocarburos de alto peso molecular por un consorcio bacteriano
degradador de madera a bajas temperaturas
3
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
115
Abstract
The aim of this work was to evaluate the ability of two bacterial consortia (C2PL05 and
BOS08) extracted from very different environments to degrade low (naphthalene
phenanthrene anthracene) and high (pyrene and perylene) molecular weight polycyclic
aromatic hydrocarbons (PAH) at high (15-25ordmC) and low (5-15ordmC) temperature ranges
C2PL05 was isolated from a soil in an area chronically and heavily contaminated with
petroleum hydrocarbons and BOS08 from decomposing wood in an unpolluted forest free of
PAH Bacterial consortia were described by cultivable and no-cultivable techniques (DGGE)
PAH-degrading bacterial population measured by most probable number (MPN)
enumeration increased during the exponential phase Toxicity estimated by MicrotoxTM
method was reduced to low levels and the final PAH depletion determined by high-
performance liquid chromatography (HPLC) confirmed the high degree of low and high
molecular weight PAH degradation capacity of both consortia The PAH degrading capacity
was also confirmed at low temperatures and specially by consortium BOS08 where strains
of Acinetobacter sp Pseudomonas sp Ralstonia sp and Microbacterium sp were identified
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
117
Introcuduction
Polycyclic aromatic hydrocarbons (PAH) constitute a diverse class of organic compounds
formed by two or more aromatic rings in several structural configurations having
carcinogenic mutagenic and toxic properties Therefore environment contamination by PAH
is currently a problem of concern and it has been shown that bioremediation is the most
efficient practice retrieving the original conditions of the ecosystem (Haritash amp Kaushik
2009) However the high molecular weight PAH (HMW-PAH) such as pyrene
benzo[a]pyrene or benzo[b]fluoranthene are generally recalcitrant and resistant to microbial
attack due to their low solubility and bioavailability Therefore these compounds are highly
persistent in the environment and bioaccumulated in organisms (Lafortune et al 2009)
Studies on PAH biodegradation with less than three rings have been the subject of many
reviews (ie Sutherland et al 1995) However there is a lack of knowledge about the
HMWndashPAH biodegradation (Kanaly amp Harayama 2000)
Microbial communities play an important role in the biological removal of pollutants in
soils (MacNaughton et al 1999) Therefore changes in environmental condition may alter
species diversity of the soil microbiota and their metabolic rates (Margesin amp Schinner
2001) In areas chronically polluted by PAH there are abundant bacteria able to degrade
those toxic contaminants by using them as sole carbon and energy sources (Taketani et al
2010) Recent works (Tian et al 2008 Surridge et al 2009 Couling et al 2010) have
reported the potential ability to degrade PAH by microorganisms apparently not previously
exposed to those toxic compounds This is extensively known for lignin degrading white rot-
fungi that produce a set of extracellular enzymes such as oxidases and peroxidases (Wong
2009) with low substrate specificity that expand their oxidative action beyond lignin being
capable to degrade other complex phenolic compounds and PAH (ie Canet et al 2001)
Although less extensively than in fungus PAH degradation capacity have been also reported
in this type of environment in bacteria belonged to genera Pseudomonas (Zimmermann
1990 McMahon et al 2007) However according to Couling et al (2010) the wide-spread
capacity to degrade PAH by microbial communities even from unpolluted soils can be
explained by the fact that PAH are ubiquitously distributed by natural process throughout the
environment at low concentration enough for bacteria to develop degrading capacity
Regardless of these issues there are some abiotic factors such as temperature that
may greatly influence biodegradation process It has been shown (Mohn amp Stewart 2000)
that although biodegradation of PAH is more efficient in the range 20-30 ordmC it can be carried
out even in colder (lt5 ordmC) environments (Eriksson et al 2001) At low temperature diffusion
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
118
and solution rates and so bioavailability of PAH decreases (Haritash amp Kaushik 2009)
Simultaneously the microbial metabolism is slowed-down increasing the lag period (Atlas amp
Bartha 1972 Eriksson et al 2001) However and according to the hypothesis that
degrading microorganisms are present in most of ecosystems there are degrading bacteria
adapted to low temperatures (Yakimov et al 2003 Brakstad amp Bonaunet 2006) that can
express degrading capacity So the study of biodegradation at low temperatures is important
since the temperature of more than 90 of the seawater volume is below 5 ordmC In addition
PAH and anthropic discharges sometimes have occurred and may occur in sea water (Bode
et al 2006 Soriano et al 2006) or in cold and even extreme environments such as in
Alaska (Bence et al 1996)
The main goal of this work was to study the effect of low temperature on HMW-PAH
degradation rate by two different consortia isolated from two different environments one from
decay wood in an unpolluted forest (consortium BOS08) and other from a polluted soil
exposed to hydrocarbons The purpose of the present work was also to describe the
microbial dynamics along the biodegradation process as a function of temperature and type
of consortium used
Materials and methods
Chemicals and media
Naphthalene phenanthrene anthracene pyrene and perylene (all gt99 purity) purchased
from Sigma-Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) were prepared
in a stock solution in n-hexane (Fluka Steinheim Germany) to get a final concentration of
002 gl-1 for naphthalene phenanthrene and anthracene 001 gl-1 for pyrene and 0005 gl -1
for perylene Tween-80 purchased from Sigma-Aldrich was added according to previously
work (Bautista et al 2009) Composition of optimized Bushnell Haas Broth medium (BHB)
(Simarro et al 2010) was 02 g l -1 MgSO4middot7H2O 002 g l -1 CaCl2 2H2O 0088 g l -1 KHPO4
0088 g l -1 K2HPO4 209 g l -1 NaNO3 0015 g l -1 Fe2(SO4)3
Physicochemical characterization of soils and isolation of bacterial consortia
Consortia C2PL05 was isolated from a permanently polluted soil from a petroleum refinery
(Ciudad Real Spain) with a range of environmental temperatures from 10 ordmC in winter to 25
ordmC in summer The consortium BOS08 was extracted from dead wood in a pristine Atlantic
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
119
forest in Fragas do Eume Galicia Spain (latitude 43ordm 4175acute north longitude 8ordm 0683acute west)
with oaks as the dominant flora species and with a range of temperatures of 10 ordmC in winter
and 18 ordmC in summer To obtain the microbial consortia sieved soil and the wood sample
were suspended in PBS (110) and stirred overnight at 25 ordmC Then 15 ml of each extract
was inoculated in 50 ml of BHB (pH 70) with Tween-80 1 (vv) as surfactant and
naphthalene phenanthrene anthracene pyrene and perylene (each at 500 mg l -1) as carbon
sources Each culture were incubated in an orbital shaker at 150 rpm 25 ordmC and dark
conditions until the exponential phase was completed (asymp 5 days) monitoring cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK)
Sieved (lt2 mm) river sand was used as substrate Prior to use it was burned at 550
ordmC in a furnace to remove organic matter and microorganisms Water holding capacity (WHC)
of the river sand was measured following the method described by Wilke (2005)
Experimental design and treatments conditions
15 microcosms (triplicates by five different incubation times) were performed with consortium
C2PL05 at high temperature range (H) 16 hours with light at 25 ordmC followed by 8 hours in
the dark at 15 ordmC Another 15 microcosms with consortium C2PL05 were incubated at low
temperature range (L) 16 hours with light at 15 ordmC followed by 8 hours in the dark at 5 ordmC
The same experiments were performed with consortium BOS08 Microcosms were incubated
in suitable chambers equipped with temperature lightdarkness cycle and humidity (60)
control systems Each microcosms contained 90 g of sterilized sand 18 ml of BHB (60 of
WHC) with Tween-80 1 (vv) 2 ml of PAH stock solution in n-hexane (final amount of PAH
per tray of 20 mg of naphthalene 20 mg of phenanthrene 20 mg of anthracene 10 mg of
pyrene and 5 mg of perylene) and 35 ml of bacterial consortium (0088 AU = 275x104
cellsmiddotml -1 for C2PL05 and 0051 AU = 286 x 104 cellsmiddotml-1 for BOS08)
Bacterial growth MPN and toxicity assays
Bacterial density during the PAH degrading process was monitored at 0 11 33 66 101 and
137 days by changes in the absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) From the absorbance data the
intrinsic growth rate in the exponential phase was calculated by applying Equation 1
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
120
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time Increments were normalized by
absorbance measurements at initial time (day 0) to correct the inoculum dilution effect
Heterotrophic and PAH-degrading population from the consortia were estimated by a
miniaturized most probably number technique (MPN) in 96-well microtiter plates with eight
replicate wells per dilution (Wrenn amp Venosa 1996) Total heterotrophic microbial population
was estimated in 180 μl of Luria Bertani (LB) medium with glucose (15 gl -1) and 20 microl of the
microbial consortium PAH-degrading population in the inoculum was estimated in 180 microl of
BHB medium containing Tween-80 (1 vv) 10 microl of PAH stock mix solution as only carbon
source (n-hexane was allowed to evaporate prior to inoculation) and 20 microl of the microbial
consortium in each well
Toxicity during the PAH degradation was also monitored through screening analysis of
the samples following the MicrotoxTM method with the luminescent bacterium Vibrio fischeri
following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15 ordmC
Monitoring of PAH biodegradation
To confirm that consortium BOS08 was not previously exposed to PAH samples were
extracted with acetone and n-hexane according to Joslashrgensen et al (2005) and the
identification was performed by GC-MS analysis of the extract A gas chromatograph (model
CP3800 Varian Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary
column (15 m length 025 mm ID 025 μm film thickness) was coupled to a quadruple
mass-spectrometer detector (Model 1200L Varian) The stationary phase was composed by
phenyl (5) and dimethylpolysiloxane (95) as carried gas ice in the mobile phase
Temperature gradient program used was initial temperature of 80 ordmC for 2 min temperature
increase to 300 ordmC at the rate of 1 ordmC min-1 final temperature of 300 ordmC for 15 min with a
final duration of the method of 39 min In addition total petroleum hydrocarbons (TPH) in
both soils were extracted and quantified as is described previously
PAH from microcosms were extracted and analyzed at initial and final time to estimate
the total percentage of PAH depletion by gas cromatography using the gas cromatograph
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
121
equiped and protocol described previuosly For this 100 g of soil from each replicate were
dried overnight at room temperature and PAH were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inyect 05 μl in
the FDI chromatograph
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
To identify cultivable microorganisms samples from each microcosm were collected at zero
33 and 101 days of the biodegradation process To extract the microorganisms 15 g of soil
were suspended in PBS (110) and incubated overnight in an orbital shaker at 150 rpm
maintaining the same temperature and light conditions than during the incubation process
To get about 10 PAH-degrading colonies isolated 100 ml of the supernatant were placed
onto Petri plates with BHB medium and purified agar and were sprayed with a stock mix
solution of naphthalene phenanthrene anthracene pyrene and perylene (final concentration
500 mgL-1) as carbon source and incubated at the same temperature conditions
Total DNA of the PAH-degrading isolated cultures (DIC) was extracted using Microbial
DNA kit (MoBio Laboratories Solano Beach CA USA) and amplified using primers 16S F27
and 16S R1488 (Lane et al 1991) according to the ExTaq HS DNA polymerase protocol
(Molina et al 2009) Sequences were edited and assembled using ChromasPro software
version 142 (Technelysium Pty Ltd Tewantin Australia) to check for reading errors and
when possible resolving ambiguities BLAST search (Madden et al 1996 available at URL
httpncbinlmnihgovBLAST) was used to find nearly identical sequences for the 16S
rRNA sequences determined Sequences were aligned using the Q-INS-i algorithm (Katoh amp
Toh 2008a) of the multiple sequence alignment software MAFFT version 6611 (Katoh amp
Toh 2008b) aligning sequences in a single step
All identified sequence (by culture and no-culture techniques) and more similar
sequences downloaded from GenBank were used to perform the phylogenetic tree
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates using PAUP
40B10 (Swofford 2003) In addition maximum parsimony (MP) was also analyzed (Molina
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
122
et al 2009) Sequences of Aquifex piruphilus and Hydrogenobacter hydrogenophylus were
used as out-group
Denaturing gradient gel electrophoresis (DGGE) from microbial consortia during PAH
degrading process
A non culture-dependent molecular techniques as DGGE was performed to know the effect
of the temperature on total biodiversity of both microbial consortia during the PAH
degradation process by comparing the treatment at zero 33 and 101 day with the initial
composition of the consortia Total DNA was extracted from 025 g of the samples using
Microbial Power DNA isolation kit (MoBio Laboratories Solano Beach CA USA) and
amplified using the primers set 16S 338F-GC and 16S 518R according to ExTaq HS DNA
polymerase protocol (Promega Corp Madison WI USA) PCR product was loaded onto a
10 (wv) polyacrilamide gel with a denaturing gradient from 35 to 65 denaturant Gel
were stained with Syber-Gold and viewed under UV light and predominant bands in DGGE
gel were excised Due to impossibility to reamplify bands DNA of the bands was cloned in
the pGEM-T Easy Vector (Promega Madison WI) PAH-degrader uncultured bacterium
(DUB) were edited and assembled as described above and included in the matrix to perform
the phylogenetic tree Images of DGGE were digitalized and processed using the UN-Scan-It
gel analysis software version 60 (Silk Scientific US)
To identifiy the presence of fungi in the consortium BOS08 during the process total
DNA was extracted from the samples using Microbial Power DNA isolation kit (MoBio
Laboratories Solano Beach CA USA) and amplified with the primers set 18S ITS1F and
ITS4 according to Quiagen Multiplex PCR kit protocol DNA of Clitocybe metachroa was
extracted using DNeasy Plant Mini Kit (Quiagen) from the mushroom for use as PCR
positive PCR products were visualized under UV light on an agarose gel (1 ) using Syber-
Gold as intercalating agent
Statistical analysis
In order to evaluate the effects of inocula type and temperature on the final percentage of
PAH depletion and on the intrinsic growth rate (μ) bifactorial analysis of variance (ANOVA)
were used The variances were checked for homogeneity by the Cochranacutes test Student-
Newman-Keuls (SNK) test was used to discriminate among different treatments after
significant F-test representing this difference by letters in the graphs Data were considered
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
123
significant when p-value was lt 005 All tests were done with the software Statistica 60 for
Windows Differences in microbial assemblages were graphically evaluated for each factor
combination (time type of consortium and temperature) with a non-metric multidimensional
scaling (MDS) using PRIMER software (Clarke 1993) SIMPER method was used to identify
the percent contribution of each band from DGGE to the dissimilarity or similarity in microbial
assemblages between and within combination of factors Based on Viejo (2009) bands were
considered ldquohighly influentialrdquo if they contributed to the first 60 of cumulative percentage of
average dissimilaritysimilarity betweenwithin combination of factors
Results
Hydrocarbons in soils
Figure 1 shows GC-MS analysis of the extracted hydrocarbons from samples where both
consortia were isolated Soil samples where C2PL05 consortium was isolated contained 64
wt of total petroleum hydrocarbons (TPH) However no traces of PAH or any other
petroleum hydrocarbons were detected within samples where BOS08 consortium was
obtained
0 5 10 15 20 25 30 35
BO S08
C 2PL05
tim e (m in)
Figure 1 GC-MS total ion chromatogram from solvent extracted hydrocarbons in soils where
consortia C2PL05 and BOS08 were isolated
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
124
Cell growth intrinsic growth MPN and toxicity assays
Figure 2 (A B) shows the growth of both microbial consortia during PAH biodegradation
process Lag phases were absent and long exponential phases (until day 66 approximately)
were observed in all treatments except with the C2PL05 consortium at low temperature
(finished at day 11) In general higher cell densities were achieved in those microcosms
incubated in the higher temperature range Despite similar cell densities reached with both
consortia and both temperature levels the values of the intrinsic growth rate (μ) during the
exponential phase (Table 1) showed significant differences between consortia and
temperatures of incubation but not in their interaction (Table 2A) Differences between
treatments showed that the highest μ was obtained at high temperatures (25 ordmC-15 ordmC) and
with BOS08 consortium
Figure 2 (C D) showed that the initial number of PAH-degrading bacteria were at least
one order of magnitude lower than heterotrophic bacteria in both consortia The highest
heterotrophic bacteria concentration was reached after 33 days of incubation approximately
to a final value of 108- 109 cells g-1 soil (four orders of magnitude above the initial values)
The highest contribution of PAH-degrading bacteria to total heterotrophic bacteria was
observed at 33 days of incubation No differences were observed between temperature
ranges From 33 days both type of populations started to decrease but PAH-degrading
bacteria of consortia increased again at 101 days reaching values at the end of the process
similar to the initial ones
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
125
0 11 33 66 101 137
005
010
015
020
025
030
035
0 11 33 66 101 137
0 33 101 137102
103
104
105
106
107
108
109
0 33 101 137Time (day)Time (day)
Time (day)
Abs
orba
nce 6
00nm
(A
U)
Time (day)
DC
BA
cell
g so
il
Figure 2 Cell growth of consortia C2PL05 (A) and BOS08 (B) at high () and low () temperature
range during PAH biodegradation and MPN for consortia C2PL05 (C) and BOS08 (D) of heterotrophic
(squares) and PAH-degrading (circles) cultivated at high (filled symbols) and low (empty symbols)
temperature range
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
126
Table 1 Intrinsic growth rate (μ) and biodegradation percentage of phenanthrene (Phe) anthracene
(Ant) pyrene (Pyr) perilene (Per) and total PAH (Tot) at final time for consortia C2PL05 and BOS08 at
high (H) and low (L) temperature range Superscript letters (a to c) show differences between groups
(plt005 SNK) and plusmn SD the standard deviation
μ
Treatment d-1x10-3 plusmnSD x10-3
C2PL05 H 158 b 09 C2PL05 L 105 a 17
BOS08 H 241 c 17
BOS08 L 189 b 12
PAH biodegradation ()
Treatment Phe plusmn SD Ant plusmn SD Pyr plusmn SD Per plusmn SD Total plusmn SD
C2PL05 H 954 plusmn 04 993 plusmn 01 270 plusmn 62 986 plusmn 01 989 c plusmn 04
C2PL05 L 801 plusmn 61 459 plusmn 158 470 plusmn 118 538 plusmn 190 543 a plusmn 109
BOS08 H 938 plusmn 27 993 plusmn 04 472 plusmn 130 864 plusmn 61 866 bc plusmn 60
BOS08 L 940 plusmn 31 579 plusmn 31 542 plusmn 102 691 plusmn 137 677 ab plusmn 77
Table 2 Analysis of variance (ANOVA) of the effects on μ (A) total PAH biodegradation (B) and
biodegradation of pyrene and perilene (C) SS is the sum of squares and df the degree of freedoms
Factor df SS F
p-value
A) μ
Temperature a 1 36 x 10-3 5931 Consortium b 1 83 x 10-5 136
Temperature x Consortium 1 20 x 10-4 343 ns
Error 8 49 x 10-5 0001
B) Total PAH biodegradation ()
Treatment c 3 3526 73
Error 8 1281
C) Biodegradation of pyrene and perilene ()
Treatment c 3 11249 11 ns
PAH d 1 85098 251
Treatment x PAH 3 31949 31 ns
Error 16 54225
a high (15-25ordmC) or low (5-15ordmC) temperature range b consortium C2PL05 or BOS08 c C2PL05 at
high and temperature range or BOS08 at high and low temperature range d naphthalene
phenanthrene anthracene pyrene and perylene p lt 005 p lt 001 p lt 0001
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
127
With regard to toxicity values (Figure 3) complete detoxification were achieved at the
end of each treatment except for consortium C2PL05 (percentage of toxicity 40) incubated
at low temperature (Figure 3A) When consortium BOS08 was incubated at low temperature
there was a time period between 11 and 66 days that toxicity increased (Figure 3B)
0 11 33 66 101 137
0
20
40
60
80
100
0 11 33 66 101 137
BA
Time (day)
Tox
icity
(
)
Time (day)
Figure 3 Toxicity of microcosms with consortium C2PL05 (A) and BOS08 (B) incubated at high ()
and low () temperature range during PAH biodegradation process
Biodegradation of PAH
PAH biodegradation results are shown in Table 1 PAH depletion showed significantly
differences (Table 2B) within the consortium C2PL05 with highest values at high temperature
and the lowest at low temperature (Table 1) Those differences were not observed within the
BOS08 consortium and PAH depletion showed average values between values of C2PL05
depletion Regarding each individual PAH naphthalene was completely degraded at final
time 80 of phenanthrene was depleted in all treatments and anthracene and perylene
were further reduced at high (gt85) rather than low temperature (gt50) However pyrene
was significantly less consumed by the consortia than perylene (Table 1 and Table 2C)
Phylogenetic analyses
Phylogenetic relationships of the degrading isolated cultures and degrading uncultured
bacteria are shown in Figure 4 The aligned matrix contains 1349 unambiguous nucleotide
position characters with 505 parsimony-informative and 173 characters excluded Parsimony
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
128
analysis of the data matrix yielded 87 parsimonious trees with CI = 0756 RI = 0945 and a
length of 1096 Figure 4 also shows the topology of the neighbour joining tree
Inconsistencies were not found when analysing boostrap values of neighbour joining (NJ)
and maximum parsimony (MP)
Figure 4 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) and degrading uncultured bacteria (DUB) obtained from DGGE of the
consortia and cultivable identification process at day 0 33 and Boostrap values of neighbour joining
(NJ) and parsimonious (MP) are showed on the branch of the tree (NJMP) No incongruence between
parsimony and neighbour joining topology were detected Pseudomonas genus has been designated
as P Psychrobacter genus as Ps Acinetobacter as A and Ralstonia as R T= type strain
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
129
DIC-46-RS (Rhodococcus sp) DIC-47RS (Bacillus psychrodurans) and DUB-25RS
(Microbacterium sp) were not included in the phylogenetic tree due to their high phylogenetic
distance with most of the DIC and DUB Phylogenetic tree was composed by bacteria
belonged to γ- and β-Proteobacteria Group of γ- Proteobacteria was composed by
Acinetobacter clade Psychrobacter clade and Pseudomonas clade whereas β-
Proteobacteria group was only composed by Ralstonia clade Within Acinetobacter clade
although the identity approximation (BLAST option Genbank) reported A johnsonii and A
haemolyicus such as the species closest to some of the DIC and DUB the incorporation of
the types strains in the phylogenetic tree species do not showed a clear monophyletic group
Thus and as a restriction molecular identification of these strains (Table 3) was exclusively
restricted to genus level that is Actinobacter sp A similar criteria was taken for
Pseudomonas clade where molecular identifications carry out through BLAST were not
supported by the monophyletic hypothesis when type strains were included in the analysis
Psycrobacter clade sister group of Acinetobacter clade are represented by Psychrobacter
urativorans type strain (DQ143924T) in which DIC-14RS and DIC-23RS are nested β-
Proteobacteria is only composed by Ralstonia clade confirmed by RinsidiosaT (FJ772078T)
although DICs included in this clade are more related with the strain Ralsonia sp AF488779
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
130
Table 3 Identification and similarity () to bacteria from GenBank of cultivable strains
and DGGE bands (non-cultivable bacteria)
Days Consortium Temperature Strains Molecular Identification
(genera) 33
C2PL05
15 ordmC-5 ordmC
DIC-7RS DIC-8RS DIC-9RS DIC-11RS DIC-10RS DIC-12RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-13RS DIC-14RS DIC-15RS DIC-46RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Psychrobacter urativorans Pseudomonas sp Rhodococcus sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-16RS DIC-17RS DIC-18RS DIC-19RS DIC-20RS DIC-21RS DIC-22RS DUB-25RS DUB-26RS
Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-23RS DIC-47RS DUB-22RS DUB-23RS DUB-24RS DUB-25RS DUB-26RS
Psychrobacter urativorans Bacillus psychrodurans Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
101
C2PL05
15ordmC-5ordmC
DIC-24RS DIC-25RS DIC-26RS DIC-27RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-28RS DIC-29RS DIC-30RS DIC-31RS DIC-32RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-33RS DIC-34RS DIC-35RS DIC-36RS DIC-37RS DIC-38RS DIC-39RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
131
25 ordmC-15 ordmC
DIC-40RS DIC-41RS DIC-42RS DIC-43RS DIC-44RS DIC-45RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
Diversity and evolution of cultivated and uncultivated bacteria and dynamics during PAH
biodegradation
PCR analysis to identify fungal DNA in BOS08 was negative for the initial period of the
biodegradation process at both temperatures ranges Fungal DNA was only positive at high
temperatures and the end of the biodegradation process (101 and 137 days)
A minimum of 10 colonies were isolated and molecularly identified from the four
treatments at days 33 and 101 by cultivated methods The most influential bands of DGGE
to 60 of contribution to similarity (Figure 5 Table 4) according to the results of PRIMER
analysis were cloned and identified with the except of bands 2 4 27 and 36 that were not
cloned after several attempts likely due to DNA degradation The results of the identification
by cultivated and uncultivated methods (Table 3 Figure 5) show that different strains of
Acinetobacter (DUB-26RS uncultured Acinetobacter sp) and Microbacterium bands 24
(DUB-26RS uncultured Acinetobacter sp) and 22 (DUB-25RS Microbaterium sp)
respectively were always present in both consortia (Figure 5) both at high and low
temperatures However it should be also noted that Rhodococcus sp strains are unique to
C2PL05 consortium whereas Ralstonia sp and Bacillus sp were only found in BOS08
consortium being all of the above DIC strains (Table 3) In depth analysis of the community
of microorganisms through DGGE fingerprints and further identification of the bands allowed
to establish those bands responsible for the similarities between treatments (Table 4) and the
most influential factor MDS (Figure 6) shows that both time and temperature have and
important effects on C2PL05 microbial diversity whereas only time had effect on BOS08
consortium Both consortia tend to equal their microbial compositions as the exposed time
increase (Figure 6) The highest average of similarity (5327 ) was observed at day 101
being bands 36 4 (unidentified) and 24 (DUB-26RS Acinetobacter sp) responsible for that
similarity The lowest similarity (3543 ) was observed within the consortium C2PL05 (Table
4) being the high abundance of the band 20 (DUB-24RS Pseudomonas sp) and the lack of
the band 22 (DUB-25R Microbacterium sp) responsible of the dissimilarity Concluding it
can be observed that bands 20 (DUB-24RS Pseudomonas sp) 22 (DUB-25R
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
132
Microbacterium sp) 24 (DUB-26RS Acinetobacter sp) 36 and 4 (both unidentified) were
the most responsible for the similarity or dissimilarity between bacterial communities of
different treatments Another band showing lower contribution to these percentages but yet
cloned was band 12 from which two genotypes were identified (DUB-22RS and DUB-23RS)
as Pseudomonas sp Regarding to identification of DIC strains (Table 3) Rhodococcus sp
was exclusive of C2PL05 consortium and Ralstonia sp and Bacillus sp were only found in
BOS08 consortium
Table 4 Bands contribution to 60 similarity primer between treatments grouped by time type
of bacterial consortium and incubation temperature Average similarity of the groups determine
by SIMPER method
Time (day) Consortium Temperature
Band DUB 0 33 101 C2PL0 BOS0 High Low
22 DUB-25RS 2855 2789 2581 20 DUB-24RS 2993 2521 1797 2366
36 Unidentified 3546 1029 210
4 Unidentified 2855 1120 2362 1755 2315 175
27 Unidentified 139
2 Unidentified 1198
24 DUB-26RS 929
Cumulative similarity () 5710 5781 5595 6081 6134 5710 524Average similarity () 4433 4070 5327 3543 4660 4433 405
Unidentified bands from DGGE after several attempts to clone
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
133
Figure 5 Denaturant gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen
fragments from the consortium C2PL05 (line 1 to 5) and consortium BOS08 (line 6 to 10) Line 0
contains the molecular weight markers lines 1 and 6 correspond to initial time lines 2 and 7 to
high temperature range at day 33 lines 3 and 8 to high temperature range at day 101 lines 4
and 9 to low temperature range at day 33 and lines 5 and 10 to low temperature range at day
101
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
134
Figure 6 Multidimensional scaling (MDS) plot showing the similarity
between consortia BOS08 (BO) and C2PL05 (C2) incubated at low
(superscript L) and high (superscript H) temperature at day 0 33 and
101(subscripts 0 1 and 2 respectively)
Discussion
PAH degradation capability of bacterial consortia
Consortium BOS08 was isolated from a pristine soil since hydrocarbons and especially PAH
were not detected Opposite results were observed for samples where consortium C2PL05
was extracted with a large amount (64 wt) of petroleum compounds (ltC40) measured
However both consortia proved to be able to efficiently degrade HMW-PAH even at low
temperature range (5-15 ordmC) However both consortia have shown lower pyrene than
perylene depletion rates despite the former has lower molecular size and higher aqueous
solubility and bioavailability and lower hydrophobicity Previous work (Alves et al 2005)
have reported that UV and visible light can activate the chemical structure of some PAH
inducing changes in toxicity However whereas these authors classified phototoxicity of
pyrene and perylene as positive other phototoxic classifications (Mekenyan et al 1994)
consider pyrene as extremely toxic and perylene as moderately toxic So the high toxicity
level of pyrene due to phototoxic effect may explain the lower depletion rates of pyrene
opposite to that expected from their physicochemical properties above mentioned
Contrary to previous works (Spain amp ven Veld 1983 Jhonsen amp Karlson 2005) the
consortium BOS08 has not needed the pre-exposure to PAH to induce microbial adaptation
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
135
and consequently degradation of those pollutants In agreement with previous works
(Margesin amp Schinner 2001) our results have showed that the addition of PAH to the forest
consortium BOS08 was rapidly followed by an initial increase of PAH degrading bacteria
Considering the origin of consortium BOS08 extracted from a soil rich in organic matter and
decaying wood is possible that biodegradation process may be associated with wood
degrading bacteria and fungi However results confirmed that initial conditions when PAH
concentration was high fungi were not present Fungi appeared just at the end of the
biodegradation process (101 and 137 days) and only at high temperature when high PAH
concentration was already depleted and toxicity was low These results therefore confirm
that biodegradation process was mainly carried out by bacteria when PAH concentration and
toxicity were high
PAH degradation ability is a general characteristic present in some microbial
communities when community is exposed to PAH (Macleod amp Semple 2002 Jhonsen amp
Karlson 2005 Tian et al 2008) Microbial consortia were obtained from highly different
levels of contamination However although high differences were observed at the initial
microbial composition of both consortia they share some strains (Microbacterium sp and
Acinetobacter sp) The lower diversity found within the C2PL05 consortium (more details in
Molina et al 2009) obtained from a chronically and heavily polluted area with petroleum
hydrocarbons is typical of aged soils exposed to PAH These pollutants drive the selection of
specific bacteria that are able to degrade them (Vintildeas et al 2005)
Most of the identified species by DGGE (culture-independent rRNA approaches) in this
work were γ-proteobacteria (Pseudomonas and Acinetobacter) except DUB-26RS 98
similar to Microbacterium sp belonging to Actinobacteria phylum In agreement with previous
works (Harayama et al 2004) identification results retrieved by culture-dependent methods
showed some differences from those identified by the culture-independent rRNA
approaches DIC identified by culturable techniques belonged to a greater extend to
Proteobacteria phylum γ-Proteobacteria (Pseudomonas Pshycrobacter Acinetobacter) and
β-Proteobacteria (Ralstonia) Only two cultivable strains DIC-46RS and DIC-47RS identified
as Rhodococcus sp and Bacillus psychrodurans belonged to Actinobacteria and Firmicutes
phylum respectively Genera as Bacillus Pseudomonas and Ralstonia were identified within
the consortium BOS08 obtained from decaying wood in a pristine forest These genera are
typical from decomposing wood systems and have been previously mentioned as important
aerobic cellulose-degrading bacteria such as Bacillus sp (Lynd et al 2002) or degraders of
the highly oxidized oxalate (Pseudomonas sp Ralstonia sp) which is released by white-rot
fungi during degradation of lignocellulose (Dutton amp Evans 1996) Lignin is one of the most
slowly degraded components of dead plants and the major contributor to the formation of
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
136
humus as it decomposes The breakdown of lignin is mediated by extracellular enzymes
such as laccase lignin peroxidise and manganese peroxidase (Hatakka 1994 Hatakka
2001) The lack of specificity and the high oxidant activity of these enzymes make them able
to degrade different components as PAH (ie Pickard 1999) For this reason Bacillus
Pseudomonas and particularly Ralstonia identified within the consortium BOS08 and
typical from decomposing wood systems have been also previously identified as degrader of
aromatic compounds (Zhuang et al 2002 Chauhan et al 2008 Luo et al 2009) While
many eukaryotic laccases have been identified and studied laccase activity has been
reported in relatively few bacteria these include some strains identified in our decomposing
wood consortium BOS08 such as Ralstonia sp and Bacillus sp and others like Azospirillum
lipoferum Marinomonas mediterranea Amycolatopsis sp Streptomyces coelicolor
Arthrobacter cholorophenolicus and Rhodococcus opacus (McMahon et al 2007 Dawkar et
al 2009 Brown et al 2011)
HMW-PAH degradation at low temperatures
In the last 10 years research in regard to HMW-PAH biodegradation has been carried out
mainly through single bacterial strains or artificial microbial consortia and at optimal
temperatures (Kanaly amp Harayama 2000 Kanaly amp Harayama 2010) However there is a
lack of knowledge focused on HMW-PAH biodegradation at difficult conditions such as low
temperatures by full microbial consortia Temperature is a key factor in physicochemical
properties of PAH and in the control of PAH biodegradation metabolism in microorganisms
The diffusion rate of PAH into the aqueous phase increases with temperature and so PAH
bioavailability (Haritash amp Kaushik 2009) and PAH metabolism rate (Leahy amp Colwell 1990)
In agreement with previous results (Eriksson et al 2001) PAH biodegradation rates were
significantly higher at moderate temperatures (15-25 ordmC) because metabolic activity
diffusion and mass transfer was facilitated However there are also microorganisms with
capacity to efficiently degrade HMW-PAH even at lower temperatures (Margesin et al 2002)
as microorganisms present at both consortia (BOS08 and C2PL05)
Genera as Acinetobacter and Pseudomonas identified from both consortia growing at
low temperature have been previously reported as typical strains from cold and petroleum-
contaminated sites being capable to grow using solely hydrocarbons (MacCormack amp Fraile
1997 Eriksson et al 2003 Margesin et al 2003) According to previously works that
considered this genera as cold-tolerant (Margesin et al 2003 Ma et al 2006) our results
showed that they grow and efficiently degrade HMW-PAH at low temperature range (5-15 ordmC)
but with significantly lower rates than those at higher temperature In addition whereas time
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
137
was an influence factor in bacterial communities distribution temperature only affected to
C2PL05 consortium Possibly these results can be related with the environmental
temperature of the sites where consortia were extracted Whereas bacterial community of
BOS08 are adapted to temperatures below 20 ordmC all year C2PL05 consortium is adapted to
a range with maximum temperatures above 20 ordmC Hence although this consortium had cold-
tolerant species that degrade at low temperatures their probably less proportion than in the
BOS08 consortium resulted in differences between percentages of PAH depletion and
evolution of the bacterial community in function of temperature Therefore the cold-adapted
microorganisms are important for the in-situ biodegradation in cold environments
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (Projects 11-37320053-
B and 0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
138
References
amp Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int Biodet
Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bode A Gonzaacutelez N Lorenzo J Valencia J Varela MM amp Varela M 2006 Enhanced
bacterioplankton activity after the Prestige oil spill off Galicia NW Spain Aquatic
Microb Ecol 43 33-41
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0ndash5degC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Brown ME Walker MC Nakashige TG Iavarone AT amp Chang M 2011 Discovery and
characterization of heme enzymes from unsequenced bacteria Application to microbial
lignin degradation J Am Chem Soc 4518006-18009
Canet R Birnstingl JG Malcolm DG Lopez-Real JM amp Beck AJ 2001 Biodegradation
of polycyclic aromatic hydrocarbons (PAH) by native microflora and combinations of
white-rot fungi in a coal-tar contaminated soil Bioresource Technol 76113-117
Chauhan A Fazlurrahman Oakeshot JG amp Jain RK 2008 Bacterial metabolism of
polycyclic aromatic hydrocarbons strategies for bioremediation Indian J Microbiol 48
95-113
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158 3411-
3420
Dawkar VV Jadhav UU Telke AA amp Govindwar SP 2009 Peroxidase from Bacillus sp
VUS and its role in the decolorization of textile dyes Biotechnol Bioprocess Eng 14
361-368
Dutton MV amp Evans CS 1996 Oxalate production by fungi its role in pathogenicity and
ecology in the soil environment Can J Microbiol 42 881ndash895
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
139
Eriksson M Jong-Ok Ka amp Mohn WW 2001 Effects of low temperature and freeze-thaw
cycles on hydrocarbon biodegradation in Arctic Tundra soil Appl Environ Microbiol
675107-5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Harayama S Kasai Y amp Hara A 2004 Microbial communities in oil-contaminated seawater
Curr Opin Biotechnol 15 205-214
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycoilyclic aromatic
hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microb Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M Steinbuchel A(eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Johonsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-
does it depend on PAH exposure Microb Ecol 50 488ndash495
Joslashrgensen KS Jaumlrvinen O Sainio P Salminen J amp Suortti AM 2005 Quantification of
soil contamination In Margesin R Schinner F (eds) Manual of soil analysis
monitoring and assessing soil bioremediation Springer Berlin pp 97-119
Kanaly RA amp Harayama S 2000 Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059ndash2067
Kanaly RA amp Harayama S 2010 Advances in the field of high-molecular-weight polycyclic
aromatic hydrocarbon biodegradation by bacteria Microb Biotechnol 3 136ndash164
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Lafortune I Juteau P Deacuteziel E Leacutepine F Beaudet R amp Villemur R 2009 Bacterial
diversity of a consortium degrading high-molecular-weight polycyclic aromatic
hydrocarbons in a two-liquid phase biosystem Microb Ecol 57 455-468
Lane DJ 1991 16S23S sequencing In E Stackebrandt and M Goodfellow (ed) Nucleic
acid techniques in bacterial systematic John Wiley amp Sons Chischester UK
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environments
Microbiol Rev 54 305-315
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
140
Luo YR Tian Y Huang X Yan CL Hong HS Lin GH amp Zheng TL 2009 Analysis of
community structure of a microbial consortium capable of degrading benzo(a)pyrene
by DGGE Marine Poll Bull 58 1159-1163
Lynd LR Weimer PJ van Zyl WH amp Pretorius IS 2002 Microbial cellulose utilization
fundamentals and biotechnology Microbiol Mol Biol Rev 66 506ndash577
MacCormack WP amp Fraile ER 1997 Characterization of a hydrocarbon degrading
psychrotrophic Antarctic bacterium Antarct Sci 9 150-155
Macleod CJA amp Semple KT 2002 The adaptation of two similar soils to pyrene catabolism
Environ Pollut 119357-364
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Madden TL Tatusov RL Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts Extremophiles
7451ndash458
McMahon AM Doyle EM Brooksm S amp OacuteConnor KE 2007 Biochemical
charcaterization of the coexisting tyrosinase and laccase in the soil bacterium
Pseudomonas putida F6 Enzyme Microb Tech 401435-1441
Mekenyan OG Ankly GT Veith GD amp Call DJ 1994 QSAR for photoinduced toxicity I
Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere
28 567
Microbics Corporation 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mohn WW amp Stewart GR 2000 Limiting factors for hydrocarbon biodegradation at low
temperature in Artic soils Soil Biol Biochem 321161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Pickard MA Roman R Tinoco R Vazquez-Duhalt R 1999 Polycyclic aromatic
hydrocarbon metabolism by white rot fungi and oxidation by Coriolopsis gallica UAMH
8260 laccase Appl Environ Microbiol 65 3805-3809
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
141
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Soriano JA Vintildeas L Franco MA Gonzaacutelez JJ Ortiz L Bayona JM amp Albaigeacutes J 2006
Spatial and temporal trends of petroleum hydrocarbons in wild mussels from the
Galician coast (NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-
90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil In Singh
A Kuhad RC Ward OP (eds) Adv Appl Biorem 103-121 Springer Berliacuten
Sutherland JB Rafii F Khan AA amp Cerniglia CE 1995 Mechanisms of polycyclic
aromatic hydrocarbon degradation p 269ndash306 In L Y Young and C E Cerniglia
(ed) Microbial transformation and degradation of toxic organic chemicals Wiley-Liss
New York NY
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of Xiamen
China Marine Pollut Bull 56 1184-1191
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-95
Wong WSD 2009 Structure and action of ligninolytic enzymes Appl Biochem Biotechnol
157 174-209
Wrenn BA amp Venosa AD 1996 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
142
Yakimov MM Giuliano L Gentile G Crisafi E Chernikova TN Abraham W-R Luumlnsdorf
H Timmis KN amp Golyshin PN 2003 Oleispira antarctica gen nov sp nov a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water Int J
System Evol Microbiol 53779-785
Zhuang W-Q Tay J-H Maszenan AM amp Tay STL 2002 Bacillus naphthovorans spnov
from oil contaminated tropical marine sediments and its role in naphthalene
biodegradation ApplMicrobiol Biotechnol 58547-553
Zimmermann W 1990 Degradation of lignin by bacteria J Biotechnol 13119-130
Proteobacteria
Capiacutetulo
Manuscrito ineacutedito
Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez M amp Peacuterez L
Assessment the efficient of bioremediation techniques (biostimulation bioaugmentation
and natural attenuation) in a creosote polluted soil change in bacterial community
Evaluacioacuten de la eficacia de teacutecnicas de biorremediacioacuten (bioestimulacioacuten bioaumento y
atenuacioacuten natural) en un suelo contaminado con creosota cambios en la comunidad bacteriana
4
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
145
Abstract
The aim of the present work was to assess different bioremediation treatments
(bioaugmentation bioestimulation combination of both and natural attenuation) applied to a
creosote polluted soil with a purpose of determine the most effective technique in removal of
pollutant Toxicity microbial respiration degradation of creosote and PAH (antharcene
phenathrene and pyrene) as well as evolution of bacterial communities by non culture-
dependent molecular technique DGGE were analyzed Results showed that creosote was
degraded through time without significant differences between treatments but PAH were
better degraded by treatment with biostimulation Low temperatures at which the process
was developed negatively conditioned the degradation rates and microbial metabolism as
show our results DGGE results revealed that biostimulated treatment displayed the highest
microbial biodiversity However at the end of the bioremediation process no treatment
showed a similar community to autochthonous consortium The degrader uncultured bacteria
identified belonged to Pseudomonas Sphingomonas Flexibacter all of them involved in
degradation process Particularly interesting was the identification of two uncultured bacteria
belonged to genera Pantoea and Balneimonas did not previously describe as such
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
147
Introduction
Creosote is a persistent chemical compound derived from burning carbons as coal between
900-1200 ordmC and has been used as a wood preservative It is composed of approximately
85 polycyclic aromatic hydrocarbons (PAH) 10 phenolic compounds and 5 nitrogen
and sulfur PAH are a class of fused-aromatic compounds toxic mutagenic bioaccumulative
and persistent in the environment and so the United State Environmental Protection Agency
(US EPA) considered that the removal of these compounds is important and priority Against
physical and chemical methods bioremediation is the most effective versatile and
economical technique to eliminate PAH Microbial degradation is the main process in natural
decontamination and in the biological removal of pollutants in soils chronically contaminated
(MacNaughton et al 1999) in which degrading-bacteria are abundant (Taketani et al
2010) However recently works have reported (Tian et al 2008 Couling et al 2010) the
potential ability to degrade PAH of microorganisms from soils apparently not exposed
previously to those toxic compounds The technique based on this degradation capacity of
indigenous bacteria is the natural attenuation This technique avoid damage in the habitat
(Dowty et al 2001) allowing to retrieve the original conditions of the ecosystem converting
the toxic compounds into harmless (Kaplan amp Kitts 2004 Haritash amp Kaushik 2009)
However this method require a long period or time to remove the toxic components because
the number of degrading microorganisms in soils only represents about 10 of the total
population (Yu et al 2005a) Many of the bioremediation studies are focused on the
bioaugmentation which consist in the inoculation of allochthonous degrading
microorganisms (ie Atagana 2006) However bioaugmentation is a complicate technique
to study because a negative or positive effect depends on the interaction between the
inocula and the indigenous population due to the competition for resources mainly nutrients
(Yu et al 2005b) Other bioremediation techniques as biostimulation consist in to empower
the degrading capacity of the indigenous community by the addition of nutrients to avoid
metabolic limitations (ie Vintildeas et al 2005)
However inconsistent results have been reported with all these previuos treatments
Previous studies have shown that biodegradation rates can be increased (Mills et al 2004)
and have no effect influenced negatively with biostimulation (Yu et al 2005a Chen et al
2008) Similar enhance of biodegradation rates (Atagana et al 2006) and not significant
differences (Vintildeas et al 2005 Yu et al 2005b) have been described with bioaugmentation
It is necessary taking in to account that each contaminated site can respond in a different
way (Vintildeas et al 2005) therefore to carry out an in situ bioremediation process it will be
necessary to design a laboratory-scale assays to determine what technique is more efficient
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
148
on the biodegradation process and the effect on the microbial diversity In addition
previously works (Gonzalez et al 2011) showed that although PAH were completely
consumed by microorganisms toxicity values remained above the threshold of the non-
toxicity Although most of the work not perform toxicity assays these are necessary to
determine effectiveness of a biodegradation The main goal of the present study is to
determine through a laboratory-scale assays the most effective bioremediation technique in
decontamination of creosote contaminated soil evaluating changes in bacterial community
and the toxicity values
Materials and methods
Chemical media and inoculated consortium
The fraction of creosote used in this study was composed of 26 of PAH (naphthalene
05 phenanthrene 51 anthracene 122 pyrene 31 dibenzofurane 13 and
acenaphthene47) Creosote was diluted in acetonitrile (purchased form Sigma Aldrich
Steinheim Germany) in a stock solution of a final concentration of 0439 gmiddotml-1 containing
0117 g PAHmiddotml-1 The culture mediums LuriandashBertani (LB) and Bushnell-Haas Broth (BHB)
were purchased from Panreac (Barcelona Spain) Biostimulated treatments were amended
with BHB as inorganic nutrients source which composition was optimized for PAH-degrading
consortium (C2PL05 consortium) in a previously work (Simarro et al 2010) with the optimum
composition 02 gmiddotlminus1 MgSO4 7H2O 002 gmiddotlminus1 CaCl2 2H2O 0281 gmiddotlminus1 KHPO4 0281 gmiddotlminus1
K2HPO4 002 gmiddotlminus1 NH4NO3 0195 gmiddotlminus1 Fe2(SO4)3 According to Bautista et al(2009) Tween-
80 was the optimal surfactant for PAH biodegradation by bacteria and was added in a critical
micellar concentration (CMC) of 300 μlmiddotml-1 (0012 mM) Bioaugmented treatments were
inoculated with the PAH-degrading consortium C2PL05 extracted from a permanently PAH
contaminated soil from a refinery in Ciudad Real (Spain) and previously identified and
described in Molina et al(2009)
Experimental design
Five different treatments in microcosms designated as T1 to T5 (see Table 1) were carried
out each in duplicate for five sampling times zero 6 40 145 and 176 days from December
2009 to May 2010 In total 40 microcosms containing 550g of natural soil samples collected
from an uncontaminated area of Rey Juan Carlos University in Madrid (Spain) were carried
out The soil obtained from the first top 20 cm and sieved by 2 mm was located in plastic
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
149
trays and randomly arranged outdoor in terrace and protected with a plastic to avoid the rain
and snow on them Each tray except the treatment T1 contained 56 ml of a creosote
solution in n-hexano (0439 g ml-1) with final amount of creosote per tray of 25 g
Microcosms were maintained at 40 of water holding capacity (WHC) considered as
optimum during bioremediation process (Vintildeas et al 2005) For biostimulation microcosms
samples were hydrated with the required amount of the optimum BHB while in treatment no
biostimulated samples were hydrated with only mili-Q water Bioaugmented treatments were
inoculated with 5ml of the consortium C2PL05 (2015x107 plusmn 427x106 cellsmiddotg soil-1 of
heterotrophic microorganisms and 177x105 plusmn 101x105 cellsmiddotg soil-1 of creosote-degrading
microorganisms)
Table 1 Summary of the treatment conditions
Code Treatments Conditions
T1 Untreated soil (control) Uncontaminated soil
T2 Natural attenuation Contaminated soil with 56 ml creosote moistened 40WHC
with 1054 ml mili-Q water
T3 Biostimulation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1104 ml BHB
T4 Bioaugmentation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml mili-Q water 5 ml consortium
C2PL05
T5 Biostimulation
+ Bioaugmentation
Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml BHB inoculated with 5 ml
Characterization of soil and environmental conditions
The water holding capacity (WHC) was measured following the method described by Wilke
(2005) and the water content was calculated through the difference between the wet and dry
weigh after drying at 60ordmC during 1 hour pH was measured using a GLP 21 micro pHmeter
(Crison Barceona Spain) resuspending 1 g of the soil in mili-Q water (110) and incubating it
in an orbital shaker at 150 rpm at 25 ordmC during 1 h Temperature which the experiments were
developed was recorded on a temperature loggers (Tidbit Loggers Onset Computer
Pocasset Mass) located in the site
Total heterotrophic microorganisms (HM) and creosote-degrading microorganisms
(C-DM) of the microbial population of the natural soil was counted using a miniaturized most
probable number technique (MPN) in 96-well microtiter plates with eight replicates per
dilution (Wrenn amp Venosa 1996) The number of cells was calculated with Most Probable
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
150
Number Calculator software Version 404 (Klee 1993)To extract the microorganisms from
the soil 1 g of soil was resuspended in 10 ml of phosphate buffer saline (PBS) and was
shaker at 150 rpm at 25 ordmC during 24 h The HM were determined in 180 μl of LB medium
with glucose (15 gl-1) and C-DM were counted in 180 μl of BHB medium with 10 μl of
creosote stock solution as carbon source
Respiration and toxicity assays
To measure the respiration during the experiments 10 g of soil moistened with 232 ml of
mili-Q water (to maintain a water capacity of 40 WHC) was incubated in duplicate in a
desiccator during 14 days at 25ordmC Replicates contained 14 ml of NaOH 02 M to absorb the
CO2 produced by microorganisms The vials were periodically replaced and checked
calorimetrically with HCl (01M) and phenolphthalein as indicator The test was doing with
BaCl2 (01 M) in excess to ensure the precipitation of carbonates The numbers of moles of
CO2 produced were calculated as a difference between initial moles of NaOH in the
replicates and moles of NaOH checked with HCl (moles of NaOH free)
The toxicity evolution during the PAH degradation was also monitored through a short
screening of the samples with the Microtox TM method with the luminescent bacterium Vibrio
fischeri following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15ordmC
Monitoring the removal of creosote and polycyclic aromatic hydrocarbons
Organic compounds were extracted and analyzed from the microcosms samples at 0 6 40
145 and 176 days by gas chromatography-mass spectrometry (GC-MS) to estimate the
creosote and percentage of PAH depletion A gas cromatograph (model CP3800 Varian
Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary column (15 m
length 025 mm ID 025 μm film thickness) was coupled to a quadruple mass-spectrometer
detector (Model 1200L Varian) The stationary phase was composed by phenyl (5) and
dimethylpolysiloxane (95) as carried gas ice in the mobile phase Temperature gradient
program used was initial temperature of 80 ordmC for 2 min temperature increase to 300 ordmC at
the rate of 1ordmC min-1 final temperature of 300 ordmC for 15 min with a final duration of the
method of 39 min Organic compounds were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inject 05 μl in
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
151
the FDI chromatograph The concentration of each PAH and creosote was calculated from
the chromatograph of the standard curves
DNA extraction molecular and phylogenetic analysis for characterization of the total
microbial population in the microcosms
Non culture-dependent molecular techniques as denaturing gradient gel electrophoresis
(DGGE) was performed to identify non-culture microorganisms and to compared the
biodiversity between treatments and its evolution at 145 and 176 days of the process Total
community DNA was extracted from 25 g of the soil samples using Microbial Power Soil
DNA isolation kit (MoBio Laboratories Solano Beach CA USA) In total suitable yields of
high molecular-weight DNA (5-20 μgg of soil-1) were obtained The V3 to V5 variable regions
of the 16S rRNA gene were amplified using the primers set 16S 518R and 16S 338F-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primer 338F-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded on to a 10
(wtvol) polyacrylamide gels that was 075mm tick and the denaturing gradients used ranged
from 35 to 65 denaturant (more details in Gonzalez et al 2011) Gel were stained with
Syber-Gold and viewed under UV light and predominant bands were excised and diluted in
50μl of mili-Q water Due to impossibility of reamplified bands DNA of the bands was cloned
in the pGEM-T Easy Vector (Promega Madison WI) Plasmids were purified using the High
Pure plasmid Isolation Kit (Roche) and sequenced using the internal primers 338F and 518R
Creosote-degrader uncultured bacterium (DUB) were edited and assembled using version
487 of the BioEdit program (Hall 1999) BLAST search (Madden et al 1996) was used to
find nearly identical sequences for the 16S rRNA sequences determined All DUB identified
sequence and 25 similar sequences downloaded from GenBank were used to perform the
phylogenetic tree Sequences were aligned using the Q-INS-i algorithm (Katoh amp Toh 2008a)
of the multiple sequence alignment software MAFFT version 6611 (Katoh amp Toh 2008b)
aligning sequences in a single step Sequence divergence was computed in terms of the
number of nucleotide differences per site between of sequences according to the Jukes and
Cantor algorithm (1969) The distance matrix for all pair wise sequence combinations was
analyzed with the neighbour-joining method (NJ) of phylogenetic tree construction with 1000
bootstrap replicates by using version PAUP 40B10 (Swofford 2003) In addition maximum
parsimony (MP) was also analyzed (Molina et al 2009) Sequences of Sphirochatea
americans belonged to Sphirochaetes phylum were used as out-group (Gupta amp Griffiths
2002) Images of DGGE were digitalized and DGGE bands were processed using the UN-
Scan-It gel analysis software version 60 (Silk Scientific US)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
152
Statistical analysis
In order to evaluate the effects of treatments on intrinsic growth rate (μ) toxicity degradation
of organic compounds and respiration analysis of variance (ANOVA) were used The
variances were checked for homogeneity by the Cochranacutes test Student-Newman-Keuls
(SNK) test was used to discriminate among different treatments after significant F-test
representing these differences by letters in the graphs Data were considered significant
when p-value was lt 005 All tests were done with the software Statistica 60 for Windows
Differences in microbial assemblages by biostimulation by bioaugmentation and by time
(145 and 176 days) were graphically evaluated with a non-metric multidimensional scaling
(MDS) using PRIMER software (Clarke 1993) The previous period to 145 days was
considered a period of cold conditions and the time from 145 to 176 days a period of higher
temperatures SIMPER method was used to identify the percent contribution of each band to
the similarity in microbial assemblages between factors Bands were considered ldquohighly
influentialrdquo if they contributed to the first 60 of cumulative percentage of average similarity
betweenwithin combination of factors In addition Shannon index (Hacute) was calculated from
DGGE bands applying equation 2 to estimate the ecological diversity of each treatment at
136 and 145 days
Equation 2
where pi is the proportion in the gel of the band i with respect to the total of all bands
detected calculated as coefficient between band intensity and total intensity of all
bands (Baek et al 2007)
Results
Physical chemical and biological characteristics of the natural soil used for the treatments
pH of the soil was slightly basic 84 and the water content of the soil was 10 although the
soil had a high WHC (521) possibly due to their sandy character Initial proportion of C-DM
from natural soil represented only 088 of the total heterotrophic population with a number
of microorganisms two order of magnitude higher (201 x 107 plusmn 427 x 106 cells g soil-1)
Figure 1 shows that the evolution of the monthly average temperature observed during the
experiment and the last 30 years Average temperature decreased progressively from
October to January from 16 ordmC to a minimum average of 6 ordmC starting to increase
progressively to reach a mean value of 21 ordmC in June
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
153
October
November
DecemberJanuary
FebruaryMarch
April MayJune
468
10121416182022
0 day
40 day
145 day
176 day
6 dayT
empe
ratu
re (
ordmC)
Month
Figure 1 evolution of the normal values of temperature (square) and evolution of
the monthly average temperature observed (circle) during the experiment
Respiration of the microbial population
Table 2A shows the ANOVA results concerning to the accumulated values of CO2 produced
for each treatment in each time period (from 0- to 6 days from 40 to 145 days and from 145
to 176 days) Due to interval time was the only significant factor (Table 2A) differences in
percentage of accumulative CO2 by sampling times (6 40 145 and 176 days) were analyzed
and showed in Figure 2 Differences between sampling times showed that the accumulated
percentage of CO2 was significantly higher at 176 days than at other time
6 40 145 17600
10x10-4
20x10-4
30x10-4
40x10-4
50x10-4
a a
b
aCO
2 mol
esg
of
soil
Time (days)
Figure 2 accumulated CO2 issue at 6 40 145 and 176 days Error bars show the
standard deviation and the letters show significant differences between groups
(plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
154
Toxicity assays
Changes on the toxicity during the creosote degradation process (Figure 3A) showed that all
treatments had a similar evolution T1 (uncontaminated) was not toxic (lt20 ) but toxicity of
treatments with creosote increased constantly from initial value of 26 to a values higher
than 50 Only during last period of time (145 to 176 days) toxicity started to decrease
slightly Despite similar toxicity values reached with the treatments interaction between time
periods (0 to 6 days 40 to 145 days and 145 to 176 days) and treatments showed significant
differences (Table 2B) Differences between groups by both significant factors (Figure 3B)
showed that toxicity of all treatments in first time period was significantly lower than in the
other periods Differences in toxicity between the two last periods were only significant for
treatment T4 in which toxicity increase progressively from the beginning
0 6 20 40 56 77 84 91 98 1051121251321411760
10
20
30
40
50
60
70
80
90
100 BA
Tox
icity
(
)
Time (days)T2 T3 T4 T5
c
c
c
b
c
bc
bcbc
aa
aa
Treatment
Figure 3 (A) evolution of the toxicity () of the treatment T1 (square) T2 (circle) T3 (triangle) T4
(inverted triangle) and T5 (rhombus) during the experiment (B) percentage of toxicity of the treatment
in the interval times 1 (black bars) from 0- to 6 days interval 2 (with bars) from 6 to 40 days and
interval 3 (gray bars) from 40 to 176 days Error bars show the standard deviation and letters
differences between groups
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
155
Biodegradation of creosote and polycyclic aromatic hydrocarbons
The results concerning the chromatography performed on the microcosms at 0 40 145 and
176 days are shown in Figure 4 Creosote depletion during first 40 days was very low
compared with the intensive degradation occurred from 40 to 145 days in which the greatest
amount of creosote was eliminated (asymp 60-80) In addition difference between residual
concentration of PAH at final time by type of PAH (phenanthrene anthracene and pyrene)
and treatment were analyzed (Table 2C) Both factor were significantly influential although
was not the interaction between them Differences by PAH (Figure 4B) showed that
anthracene degradation was significantly higher than other PAH and differences by
treatments (Figure 4C) showed that difference were only significant between treatment T3
and T2 lower in the treatment T3
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
156
T1 T2 T3 T4 T50000
0005
0010
0015
0020
0025
0030
0035
0040
g cr
eoso
te
g so
il
Phenanthrene Anthracene Pyrene0
102030405060708090
100
C
aab
abb
a
bb
B
A
Ave
rage
res
idua
l con
cenr
atio
n of
PA
H (
)
T2 T3 T4 T50
102030405060708090
100
Tot
al r
esid
ual c
once
ntra
tion
of
PA
H (
)
Figure 4 (A) creosote depletion during the experiment at sampling times 6 days (black
bars) 40 days (with bars) 145 days (grey bars) and 176 days ( ) (B) average residual
concentration at 176 days of the identified PAH (phenanthrene anthracene and pyrene)
and (B) average residual concentration of the identified PAH as a function of applied
treatment (C) Error bars show the standard error and the letters show significant
differences between groups (plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
157
Table 2 Analysis of variance (ANOVA) of the effects on the μ of the
heteroptrophic population (A) μ of the creosote degrading microorganisms (B)
accumulated value of CO2 (C) toxicity (D) and residual concentration of PAH (E) SS is
the sum of squares and df the degree of freedoms
Factor df SS F P
C) Accumulated value of CO2 (n=40) Time interval 3 65-5 3112
Treatment 4 60-6 202 ns
Interval x Treatment 12 11-5 134 ns
Error 20 14-5
D)Toxicity (n=24) Time interval 2 907133 11075
Treatment 3 12090 098 ns
Interval x Treatment 6 122138 497
Error 12 49143
E) Residual concentration of the PAH (n=24) Treatment 3 95148 548
PAH 2 168113 1452
Treatment x PAH 6 17847 051 ns
Error 12 69486
p-value lt 005
p-value lt 001
p-value lt 0001
Diversity and evolution of the uncultivated bacteria and dynamics during the PAH
degradation
The effects of different treatments on the structure and dynamics of the bacterial community
at 145 days and 176 days were analyzed by DGGE (Figure 5) At 145 days 8 bands (3 4 10
810 16 17 26 and 27 see Figure 5) were cloned and 6 different genotypes (DUB 12-RS to
DUB-17RS) were identified whereas at 176 days 5 bands (4 112 113 22 and 26 see
Figure 5) and 6 different genotypes (DUB-12RS DUB-13RS DUB-18RS DUB-19RS DUB-
20RS and DUB-21RS) were identified Most influential bands considered as 60 of
contribution to similarity according to the results of PRIMER analysis is showed at the Table
3 Similarities between treatments at 145 and 176 days were compared and analyzed as a
function of the addition of nutrients (biostimulated vs no biostimulated treatments) and the
addition of degrading consortium C2PL05 (bioaugmentated vs no bioaugmentated
treatments) The addition of nutrients was the factor that best explained differences between
treatments and so results in Table 3 are as a function of the addition of nutrients At 145
days no-biostimulated treatments T1 T2 and T4 were only similar in 402 whereas
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
158
biostimulated treatments (T3 and T5) were 6567 (Table 3) The patter were slightly
opposite at 176 days where no-biostimulated treatments were more similar (7026 ) than
biostimulated treatments (average similarity 4384 ) In addition at 145 days (Figure 6A)
natural attenuation (T2) was the only similar treatment to microbial community from the
uncontaminated treatment (T1) However at 176 days (Figure 6B) bacterial communities
from all treatments were highly different to the treatment T1 and there was no defined group
In addition PRIMER analysis allowed us to estimate the Shannon diversity index (Hacute) for
each treatments at 145 and 176 days indicating that the bacterial diversity increased for the
treatments T1 (3328) T3 (4154) and T5 (3739) remarkably higher in the treatment T4
Table 3 Bands contribution to 60 similarity primer between treatments grouped by
treatments biostimulated and no biostimulated at 145 days and 176 days Average
similarity of the groups determined by SIMPER method
145 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
3 DUB-12RS
DUB-17RS 2875
16 DUB-17RS 1826
17 DUB-12RS
DUB-16RS 1414
18 Unidentified 3363
19 Unidentified 3363
Cumulative similarity () 6725 6115 Average similarity () 402 6567
176 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
11 Unidentified 2116 13 Unidentified 2078 1794
23 Unidentified 2225 2294
26 DUB-13RS 1296
Cumulative similarity () 6418 5383 Average similarity () 7026 4384
bands from DGGE unidentified after several attempts to clone
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
159
Figure 5 Denaturing gradient gel electrophoresis (DGGE) at 145 days (A) and 176 days (B) of PCR-
amplified 16S rDNA gen fragments from the consortium C2PL05 (lane B) control experiment (lane C)
treatment with natural attenuation T1 (lane T1)biostimulated treatment T2 (lane T2) bioaugmentated
treatment T3 (lane T3) bioaugmentated treatment T4 (lane T4) and biostimulated and
bioaugmentated treatment t5 (lane T5) Lane A is the molecular weigh marker Numbers are the
bands cloning
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
160
Figure 6 proximity analysis (MDS) based on the Bray-Curtis dissimilarity
matrix of each treatment from the bands obtained in DGGE at 145 days (A)
and 176 days (B)
Phylogenetic analyses
Phylogenetic relationships of the degrading uncultured bacteria are shown in Figure 7 The
aligned matrix contained 1373 unambiguous nucleotide position characters with 496
parsimony-informative Parsimony analysis of the data matrix yielded 87 parsimonious trees
with CI = 0671 RI = 0767 and a length of 1452 Figure 6 also shows the topology of the
maximum parsimony (MP) tree with the bootstrap values of the maximum parsimony and
neighbour joining analyses Inconsistencies were not found between parsimony and
neighbour joining (NJ) topology
Phylogenetic tree was composed by bacteria belonged to Proteobacteria (α- and γ-
Proteobacteria) and Bacteroidetes phylum From DUB-12RS to DUB-17RS were located in
the Pseudomonadaceae clade in which it can be observed five clearly species groups DUB-
13RS and DUB-15RS identified as Pseudomonas trivialensis (HM134251) and P poae
(HM640290) respectively were in an undifferentiated group supported by P trivialensis and
P poae type-strains DUB-14RS similar to P viridiflava (HM190224) formed a group
supported by P viridiflavaT (HM190229) DUB-12RS 98 similar to P fluorescens (GQ
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
161
496662) was grouped with P fluorescensT (D84013) DUB-16RS was identified as
uncultured Pseudomonas sp (HQ677222) and classified in an indefinite group Finally the
last group of the Pseudomonadaceae clade was formed by DUB17-RS 98 similar to P
parafulva (HQ406758) and grouped with P parafulvaT (D84015) DUB-21RS was nested in
the Enterobacteriaceae clade due to it was identified with 99 of similarity as Pantoea
Brenneri (HM163514) This clade is supported by types-strains of other species of Pantoea
as Pantoea agglomeransT (FJ613819) and other enteric bacteria as Enterobacter cloacaeT
(AJ251469) DUB nested in Enterobacteriaceae and Pseudomonadaceae clade were γ-
Proteobacteria In α-Proteobacteria class are included Rhizobiales and
Sphingomonadaceae clades In the first clade formed by uncultured Balneimonas and
Rihzobiales bacterium supported by Balneimonas floculansT was nested DUB-19-RS 99
similar to an uncultured Balneimonas strain (HM799006) In Sphingomonadaceae clade was
nested DUB-20RS identified as uncultured Sphingomonadales bacterium DUB-18RS was
similar in 99 to Uncultured Flexibacteriaceae bacterium and was nested in Cytophagaceae
clade belonging to Bacteroidetes phylum
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
162
Figure 7 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrading uncultured bacteria (DUB) obtained from DGGE of the treatments 145 and 176 days of the
process Boostrap values of neighbourjoining and parsimony higher than 50 are showed on the
branch of the tree (NJMP) No incongruence between parsimony and neighbour joining topology were
detected Pseudomonas genus has been designated as P Pantoea genus as Pa Balneimonas as B
and Bacteriovorax as Ba Hidrogenymonas as H Flexibacerium as F T= type strain
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
163
Discussion
The estimated time of experimentation (176 days) was considered adequate to the complete
bioremediation of the soil according to previous studies developed at low temperatures (15
ordmC ndash 5 ordmC) in which toxicity was reduced below 20 in 101 days and PAH were removed in
137 days above 60 (Simarro et al under review) However our results confirm that
toxicity evaluation of the samples is necessary to know the real status of the polluted soil
because despite creosote was degraded almost entirely (Figure 4A) at the end of the
experiment toxicity remained constant and high during the process (Figure 3A) Possibly the
low temperatures under which was developed the most of the experiment slowed the
biodegradation rates of creosote and its immediate products which may be the cause of
such toxicity In addtion the most removal of creosote (Figure 4A) and higher respiration
rates (Figure 2) occurred from 40 days when temperature began to increase Hence our
results according to other authors (Margesin et al 2002) show that biodegradation at low
temperatures is possible although with low biodegradation rates due to slowdown on the
diffusion rate PAH bioavailability and metabolisms rates (Haritash amp Kaushik 2009 Leahy amp
Colwell 1990)
As in a previously work (Margesin amp Schinner 2001) no significant differences were
observed between treatments in degradation of creosote The final percentage of creosote
depletion above 60 in all treatments including natural attenuation confirm that indigenous
community of the soil degrade creosote efficiently Concurring with these results high
number of creosote-degradaing microorganisms were enumerated in the natural soil at the
time in which the disturbance occurred There is much controversy over whether
preexposure to a pollutant is required for degradation (Johnsen amp Karlson 2005) or if it is a
characteristic intrinsically present in some species of the microbial community that is
expressed when community is exposed to a pollutant (Tian et al 2008 Spain amp van Veld
1983) According to Tian et al 2008) and similarly as in previuosly work in which a wood
degrading consotium from a free polluted soil degraded PAH efficiently bacterial consortium
from natural soil never preexposed to creosota was able to efficiently degrade the
contaminant
Traditionally is widely tested (Yachi amp Loreau 1999) and accepted that higher
diversity leads to greater protection against disturbances (Vilaacute 1998) because the
functionality is higher Bacterial diversity of the biostimulated treatments (T3 and T5) notably
increased during the biodegradation process and showed (T3) a significantly enhance of the
PAH depletion Hence the higher biodiversity of the biostimulated treatment could contribute
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
164
to the increased of PAH degradation Overall the soil microbial community was significantly
altered in the soil with the addition of creosote is evidenced by the reduction of the size or
diversity of the various population of the treatments precisely in treatments no biostimulated
Long-term exposure (175 days) of the soil community to a constant stress such as creosote
contamination could permanently change the community structure as it observed in DGGEN
AND mds Bioaugmentation (T4 and T5) not resulted in a significant increase of the reduction
of creosote or PAH possibly due to the high adaptability of the indigenous consortium to
degrade PAH The relationship between inoculated and autochthonous consortium largely
condition the results of bioaugmentation Some authors (ie Herwijnen et al2005 Andrenoi
amp Gianfreda 2007) purpose that this technique only has positive effects when indigenous
consortium is no capable to degrade The indigenous microbial community demonstrated
capacity to degrade creosote explains the ineffectiveness of bioaugmentation A study of the
bacterial communities during a bioremediation process is important because such as
demonstrate our results bioremediation techniques cause changes in microbial communities
Most of the DUB identified have been previously related with biodegradation process
of PAH creosote andor diesel 60 of the DUB identified (DUB-12RS to DUB17RS)
belonged to Pseudomonas genus widely studied in bioremediation (ie Ma et al 2006
Molina et al 2009) Our results showed that it was the unique representative group at 145
days and the most representative at 176 days of the biodegradation process However in
this work it has been identified some species of Pseudomonas grouped in P trivialis P poae
and P Viridiflava clades (DUB-13RS DUB-15RS and DUB-14RS respectively) less
commonly described in biodegradation process (ie Bogan et al 2003) α-Proteobacteria
class was composed by DUB-19RS (Uncultured balneimonas) and DUB-20RS (Uncultured
Sphingomonadales bacterium) DUB-18RS belonged to phylum Bacteroidetes previously
identified in degradation of high-molecular-mass organic matter in marine ecosystems in
petroleum degradation process at low temperatures and in PAH degradation during
bioremediation of creoste-contaminated soils (Cotrell amp Kiechman 2000a Brakstad et al
2006 Vintildeas et al 2005) Something important to emphasize is the identification of the
Pantoea brenneri (DUB-21RS Enterobacteriaceae clade) and an uncultured Balneimonas
bacteria (DUB-19RS Metylbacteriaceae Rhizobiales clade) as creosote degrader because
have not been previously described as such However very few reports have indicated the
ability to degrade PAH of some genera of the enteric bacteria group as Enterobacter (Molina
et al 2009) Klebsiella (Grant et al 1967) or Escherichia (Diaz et al 2001)
In conclusion temperature is a very influential factor in ex situ biodegradation process
that control biodegradation rates toxicity reduction availability of contaminant and bacterial
metabolisms and so is an important factor to take into account during bioremediation
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
165
process Biostimulation was the technique which more efficiently removed PAH compared
with natural attenuation In this work bioaugmentation not resulted in an increment of the
creosote depletion probably due to the ability of the indigenous consortium to degrade
Bioremediation techniques produce change in the bacterial communities which is important
to study to evaluate damage in the habitat and restore capability of the ecosystem
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
166
References
Andreoni V amp Gianfreda L 2007 Bioremediation and monitoring of aromatic-polluted
habitats Appl Microbiol Biotechnol 76 287-308
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Baek SH Kim KH Yin CR Jeon CO Im WT Kim KK amp Lee ST 2003 Isolation and
characterization of bacteria capable of degrading phenol and reducing nitrate under
low-oxygen conditions Curr Microbiol 47462-466
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Behrendt U Ulrich A amp Schumann P 2003 Fluorescent pseudomonas associated with the
phyllosphere of grasses Pseudomonas trivialis sp nov Pseudomonas poae sp nov
and Pseudomonas congelans sp nov Int J Syst Evol Microbiol 53 1461ndash1469
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0-5 ordmC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Bodour AA Wang JM Brusseau ML amp Maier RM 2003 Temporal changes in culturable
phenatrhene degraders in response to long-term exposure to phenantrhene in a soil
column system Environ Microbiol 5 888-895
Bogan BW Lahner LMamp Sullivan WR 2003 Degradation of straight-chain aliphatic and
high molecular weight polycyclic aromatic hydrocarbons by a strain of Mycobacterium
austroafricanum J Appl Microbiol 94 230-239
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Pollut Bull 57 695-702
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Austral Ecol 18 117-143
Cotrell MT amp Kirchman DL 2000 Natural assemblages of marine proteobacteria and
members of Cytophaga-Flavobacter cluster consuming low- and high molecular
weight dissolved organic matter Appl Environ Microbiol 66 1692-1697
Couling NR Towel MG Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158
3411-3420
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
167
Diaz E Fernandez A Prieto MA amp Garcia JL 2001 Bioremediation of aromatic
compounds by Eschericlia coli Microbiol Mol Biol Rev 65 523-569
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosm
simulation Marine Environ Res 52 195-211
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grant DJW 1967 Kinetic aspect of the growth of Klebsiella aerogenes with some
benzenoid carbon sources J Gen Microbiol 46 213-224
Hall TA 1999 bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 4195-98
Haritash AK Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJWuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kaplan CW Kitts CK 2004 Bacterial succession in a petroleum land treatment unit Appl
Environ Microbiol 70 1777-1786
Karen M amp Chistoserdov AY 2001 Phylogenetic analysis of the sucession of bacterial
communities in the Great South Bay (Long Island) Microb Ecol 35 85-95
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Klee AJ 1993 A computer program for the determination of the most probable number and
its confidence limits J Microbiol Methods 18 91-98
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Loacutepez Z Vila J Ortega-Calvo JJ amp Grifoll M 2008 Simultaneous biodegradation of
creosote-polycyclic aromatic hydrocarbons by a pyrene-degrading Mycobacterium
Appl Microbiol Biotechnol 78 165-172
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
168
MaY Wang L amp Shao Z 2006 Pseudomonas the dominant polycyclic aromatic
hydrocarbon-degrading bacteria isolated from Antarctic soils and the role of large
plasmids in horizontal gene transfer Environ Microbiol 8 455ndash465
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Methods
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
McConkey BJ Duxbury CL Dixon DG amp Greenberg BM 1997 Toxicity of a PAH
photooxidation product to the bacteria Photobacterium phosphoreum and the
duckweed Lemna gibba Effects of phenanthrene and its primary photoproduct
phenanthrenequinone Environ Toxicol Chem 16 892-899
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill App
Environ Microbiol 65 3566-3574
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2011 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Pollut 217 365-374Surridge
AKJ Wehner FC amp Cloete TE 2009 Bioremediation of polluted soil En Singh A
Kuhad RC Ward OP (eds) Adv Appl Biorem p103-121 Springer Berliacuten
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull 56 1184-1191
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
169
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol Progr Ser 390 55-65
Vilagrave M 1998 Efectos de la diversidad de especies en el funcionamiento de los ecosistemas
Orsis 13 105-117
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-97
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Yachi S amp Loreau M 1999 Biodiversity and ecosystem productivity in a fluctuating
environment The insurance hypothesis Proc Natl Acad Sci USA 96 1463-1468
Yu SH Ke L Wong YS amp Tam NFY 2005a Biodegradation of polycyclic aromatic
hydrocarbons (PAHs) by a consortium enrichment from mangrove sediments Environ
Int 32 149-154
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005b Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
bull Discusioacutengeneral
II
Discusioacuten general
173
Discusioacuten general
Temperatura y otros factores ambientales determinantes en un proceso de
biodegradacioacuten
El resultado final de la aplicacioacuten directa de teacutecnicas de biorremediacioacuten en un medio
contaminado estaacute fuertemente influenciado por los paraacutemetros ambientales Por este motivo
son numerosos los estudios (ej Chaicircneau et al 2005 Cheung amp Kinkle 2005 Leys et al
2005 Chen et al 2008) realizados para optimizar y en la medida de lo posible modificar
tanto los factores bioacuteticos como abioacuteticos Frecuentemente la optimizacioacuten se ha llevado a
cabo considerando exclusivamente un solo factor implicado por ejemplo la temperatura
(Torres et al 2005) la concentracioacuten de nutrientes y la relacioacuten CNP (Leys et al 2005) o
el tipo de nutrientes y los surfactantes adicionados (Cheung amp Kinkle 2005) Pocos son los
estudios en los que se valoran dos o tres factores conjuntamente (Kaumlstner et al 1998
Cheung amp Kinkle 2005) y menos auacuten en los que se combinan maacutes de cuatro paraacutemetros
variables Chen et al (2008) destacoacute la importancia de evaluar en el proceso de
optimizacioacuten tanto los efectos individuales como los derivados de la interaccioacuten entre
factores mediante un meacutetodo factorial completo La optimizacioacuten de un proceso de
biorremediacioacuten previo a la aplicacioacuten in situ es fundamental y un disentildeo ortogonal del
experimento va a permitir ademaacutes considerar los efectos sineacutergicos y antagoacutenicos
derivados de la interaccioacuten entre las variables bioacuteticas y abioacuteticas (Chen et al 2008) Los
resultados obtenidos en los dos trabajos de optimizacioacuten que componen el capiacutetulo 1
demuestran que los factores ambientales significativamente influyentes en la tasa de
biodegradacioacuten (kB) de HAP son diferentes cuando se fijan como constantes todos los
paraacutemetros excepto uno (capiacutetulo 1a) que cuando todos los paraacutemetros se consideran
variables y se combinan en un anaacutelisis ortogonal (capiacutetulo 1b) Sin embargo los resultados
obtenidos de un anaacutelisis factorial no invalidan la optimizacioacuten individual la cual es necesaria
y maacutes adecuada en casos en los que tan soacutelo interesa estudiar la influencia de un
determinado factor en el proceso de biodegradacioacuten En algunos casos determinados
paraacutemetros ambientales fijos e inamovibles (ej bajas temperaturas) dificultan el proceso de
biodegradacioacuten y mediante la optimizacioacuten individual y posterior modificacioacuten de otros
factores del medio (ej nutrientes fuente de carbono) se consigue aumentar la eficacia del
proceso Ademaacutes como resultado de la optimizacioacuten indiviadual de factores realizada en el
capiacutetulo 1a de la presente tesis se obtuvo un medio de crecimiento oacuteptimo (capiacutetulo 1) que
que se usoacute en ensayos y experimentos posteriores (capiacutetulos 3 y 4)
Discusioacuten general
174
Dada la elevada variabilidad de resultados que se pueden obtener en la eficacia de
biodegradacioacuten en funcioacuten de los factores ambientales y sus modificaciones proponemos
que los ensayos de optimizacioacuten del proceso para determinar las condiciones oacuteptimas del
mismo es fundamental para maximizar la eficacia (tiempo y costes) de la aplicacioacuten in situ
De entre todos los factores ambientales limitantes de la biodegradacioacuten de
hidrocarburos del petroacuteleo como son los HAP la temperatura es uno de los que maacutes
condiciona la eficacia del mismo (Chen et al 2008) En la presente tesis los procesos de
biodegradacioacuten realizados a bajas temperaturas (capiacutetulo 3 y 4) con el objetivo de evaluar la
influencia de este factor en la eficacia de degradacioacuten y en la comunidad bacteriana
muestran que la degradacioacuten del contaminante es menor a temperaturas inferiores a 15ordmC
(Margesin et al 2002) La notable ralentizacioacuten de las tasas de crecimiento bacteriano y
degradacioacuten a temperaturas bajas (capiacutetulos 3 y 4) fue debida a la menor solubilidad de los
HAP (Haritash amp Kaushik 2009) y al decrecimiento del metabolismo microbiano (Leahy amp
Colwell 1990) Los estudios centrados en la obtencioacuten de la temperatura oacuteptima durante los
procesos de degradacioacuten de HAP por un consorcio bacteriano (Capiacutetulos 1a 1b y 3) han
determinado que no existe un valor oacuteptimo sino maacutes bien un rango oacuteptimo que oscila entre
los 20ordmC y los 30ordmC Tal y como concreta Chen et al (2008) son las fluctuaciones amplias
de temperatura lo que dificulta el proceso de biodegradacioacuten Cuando el rango de variacioacuten
es estrecho y ademaacutes se encuentra dentro de los valores oacuteptimos la influencia es
significativamente despreciable (capiacutetulo 1b) Sin embargo hay que tener presente que
existen ecosistemas susceptibles de ser contaminados en zonas cuyas condiciones
climaacuteticas son extremas Histoacutericamente grandes desastres ecoloacutegicos se han producido en
aacutereas cuyas temperaturas medias estaacuten muy por debajo del rango oacuteptimo como es el caso
del petrolero Exxon Vadez en Alaska (Bence et al 1996) o el Prestige en Espantildea (Soriano
et al 2006) A pesar de la evidente importancia de este aspecto poco se sabe sin embargo
de la degradacioacuten de HAP a temperaturas friacuteas comprendidas entre los 5 ordmC-15 ordmC la cual
es posible gracias a la presencia de especies psicrotolerantes y psicroacutefilas (ldquocold-adaptedrdquo)
(Margesin amp Schinner 2001) Alguna de estas especies que han adquirido o que poseen
intriacutensecamente la capacidad para degradar hidrocarburos pertenecen a los geacuteneros
Pseudomonas Acinetobacter o Pshycrobacter (Eriksson et al 2003 Margesin et al 2003)
La identificacioacuten de estos geacuteneros en los consorcios bacterianos (C2PL05 y BOS08)
posiblemente ha sido determinante en los procesos de biodegradacioacuten a bajas temperaturas
(capiacutetulos 3 y 4) ya que aunque con menores tasas que a temperaturas altas la
biodegradacioacuten ha sido posible Estas especies son claves para el mantenimiento de dicha
comunidad ya que su actividad metaboacutelica durante periodos de bajas temperaturas o en
ambientes permanentemente friacuteos permite la mineralizacioacuten de los hidrocarburos y
subsecuente formacioacuten de otros compuestos maacutes sencillos y faacuteciles de degradar por el resto
Discusioacuten general
175
de las especies del consorcio o la comunidad (Pelz et al 1999) La utilizacioacuten de consorcios
bacterianos adaptados a climas friacuteos compuestos por especies con capacidad degradadora
puede ser una medida de actuacioacuten fundamental en aacutereas extremas Ademaacutes a partir de
estas cepas psicrotolerantes y psicroacutefilas se estaacuten aislando enzimas oxidativas capaces de
trabajar a bajas temperaturas con un importante potencial en procesos biotecnoloacutegicos
(Cavicchioli et al 2002)
Consorcios bacterianos durante un proceso de biodegradacioacuten factores que
determinan la sucesioacuten de especies
La sucesioacuten de especies en un consorcio durante un proceso de biodegradacioacuten depende
en gran medida de ciertas caracteriacutesticas celulares y metaboacutelicas de las especies que lo
componen sobre todo cuando la fuente de carbono son HAP de alto peso molecular
(Mueller et al 1997) Por ejemplo algunas especies de Pseudomonas (P aeruginosa
Soberon-Chavez et al 2005) tienen la capacidad de producir biosurfactantes para aumentar
la biodisponibilidad de HAP o bien como es el caso de las Gram-positivas la presencia de
una uacutenica membrana permite un transporte maacutes eficaz de los HAP al interior de la ceacutelula
(Mueller et al 1997) En la mayoriacutea de los casos las sustancias que se presentan como
recalcitrantes para una especie individual pueden metabolizarse a traveacutes de secuencias
cataboacutelicas complementarias que presentan las diferentes especies de un consorcio
(Fritsche 1985) De ahiacute que con los consorcios microbianos se puedan obtener tasas de
degradacioacuten mucho maacutes elevadas que con cepas individuales (Bautista et al 2009) Sin
embargo la estabilidad y eficacia de un consorcio bacteriano estaacuten determinadas por las
relaciones de supervivencia entre las especies que lo componen Un caso en el que las
asociaciones bacterianas son fundamentales son los procesos de biorremediacioacuten a bajas
temperaturas ya que tal y como Leahy amp Cowell (1990) exponen los consorcios bacterianos
cuentan con una capacidad enzimaacutetica maacutes amplia que especies aisladas y por tanto
mayor versatilidad y superioridad de supervivencia
Una modificacioacuten sobre el consorcio como es la dilucioacuten del mismo (capiacutetulo 1b)
puede afectar a las tasas de degradacioacuten finales precisamente porque modifican las
relaciones inicialmente establecidas entre las especies Igualmente este paraacutemetro puede
modificar el patroacuten de crecimiento sin que esto suponga un cambio significativo en la tasa de
degradacioacuten (capiacutetulo 1b) hecho que dependeraacute de la capacidad degradadora de la especie
favorecida (Szaboacute et al 2007) Por tanto la concentracioacuten del inoacuteculo introducido en un
medio contaminado puede condicionar la eficacia del proceso
Discusioacuten general
176
En los diferentes experimentos que componen los capiacutetulos de este proyecto doctoral
no se han realizado pruebas fisioloacutegicas para estudiar las rutas metaboacutelicas o la importancia
relativa del cometabolismo que condicionen la sucesioacuten o composicioacuten de especies de una
comunidad Sin embargo los anaacutelisis de la comunidad bacteriana a traveacutes de la
identificacioacuten de especies cultivables (capiacutetulos 2 y 3) y no cultivables (capiacutetulos 2 3 y 4)
mediante teacutecnicas moleculares indican que la comunidad bacteriana cambia y por tanto
existe una sucesioacuten y coexistencia determinada de especies en el tiempo Los resultados
obtenidos en el capiacutetulo 2 indican que las especies del consorcio cambian en funcioacuten de la
fuente de carbono disponible (HAP y subproductos de degradacioacuten de HAP) y la presencia
de determinados surfactantes (Tween-80 y HAP o solo HAP) por lo que eacutestos pueden ser
factores que intervienen en la sucesioacuten de especies en un consorcio En muchos procesos
de biodegradacioacuten es comuacuten la adicioacuten de ciertas fuentes de carbono para aumentar la
biomasa de los consorcios bacterianos o cepas concretas y acelerar por tanto el proceso de
biodegradacioacuten (Chen amp Aitken 1999 Lee et al 2003) Sin embargo dada la mencionada
influencia de la fuente de carbono sobre la composicioacuten de especies el resultado de esta
medida puede ser negativo en consorcios bacterianos en los que coexistan especies
degradadoras de una determinada fuente de carbono (ej HAP) con otras que no lo son
(capiacutetulo 1a y 1b) Este hecho es debido a que la adaptacioacuten a la nueva fuente de carbono
de los microorganismos degradadores de HAP se traduce en un aumento de la fase de
latencia y por tanto en un retraso de la tasa de degradacioacuten (Maier et al 2009) Este
fenoacutemeno se pudo observar con claridad cuando se suministroacute al consorcio degradador
C2PL05 glucosa como uacutenica fuente de carbono o en combinacioacuten con HAP (capiacutetulos 1a y
1b)
Nuevas especies bacterianas degradadoras de HAP
La identificacioacuten de especies en los numerosos trabajos de biodegradacioacuten realizados hasta
el momento verifican la existencia de una importante variedad de bacterias degradadoras
de HAP Sin embargo esto no implica que no haya taxa particularmente bien adaptados a
medios contaminados (Mueller et al 1997) y que frecuentemente esteacuten involucrados en
procesos de biodegradacioacuten Este es el caso de geacuteneros como Pseudomonas
Acinetobacter Sphingomonas y Stenothrophomonas identificados durante los ensayos que
componen los capiacutetulos 2 3 y 4 Ademaacutes de la identificacioacuten de especies pertenecientes a
estos geacuteneros ampliamente descritos en procesos de biodegradacioacuten (ej Pseudomonas
Sphingomonas Sphingobium Ralstonia Flexibacter Rhodococcus y Bacillus) cabe
destacar la importancia del aislamiento e identificacioacuten de secuencias englobadas en nuevos
geacuteneros degradadores ineacuteditos hasta el momento o cuya implicacioacuten en estos procesos es
Discusioacuten general
177
escasa Este es el caso de Enterobacter cloacae y E ludwigii (γ-Proteobacterias)
identificadas en el consorcio C2PL05 como degradadoras de HAP de bajo peso molecular
Incluso en un estudio previo (Bautista et al 2009) se ha determinado que la eficacia
degradadora de este geacutenero es mucho maacutes eficaz que otras especies degradadoras
frecuentemente descritas como Pseudomonas fluorescens o Stenotrophomonas maltophilia
Pantoea aglomerans (γ-Proteobacterias) es otra Enterobacteriaceae identificada por primera
vez como degradadora de (capiacutetulo 4) En escasas ocasiones (Toledo et al 2006) una
especie de la familia Enterobacteraceae ha sido identificada como degradadora de HAP o
de crudo (Zhang et al 2010) Asiacute mismo es la primera vez que bacterias Gram-positivas
pertenecientes a los geacuteneros Balneimonas sp (capiacutetulo 4) Bradyrhizobium sp y
Nitrobacteria sp (capiacutetulo 2) todas α-Proteobacterias y por otro lado el geacutenero
Microbacterium sp (Phylum Actinobacterias Capiacutetulo 3) se relacionan con procesos de
biodegradacioacuten de HAP y en procesos de mineralizacioacuten de sustancias recalcitrantes La
presencia de estos organismos debe quedar justificada por su capacidad degradadora dado
que han sido identificadas a partir de bandas de gran intensidad en DGGE teacutecnica que se
ha realizado con muestras procedentes de ensayos de biodegradacioacuten de HAP y creosota
(capiacutetulos 2 3 y 4) Es decir su mera presencia en el consorcio no parece justificable por
causas aleatorias sino maacutes bien por su implicacioacuten directa en los procesos metaboacutelicos
asociados a la degradacioacuten Por ejemplo el aislamiento e identificacioacuten en el capiacutetulo 2 de
especies del geacutenero Nitrobacteria podriacutea estar relacionada con la reduccioacuten de nitritos
presentes en el medio contaminado (capiacutetulo 2 Gonzaacutelez et al 2010)
Los resultados de identificacioacuten mediante teacutecnicas moleculares muestran la evidente
variedad de geacuteneros implicados en estos procesos La variabilidad observada fue mucho
menos intensa con las teacutecnicas moleculares dependientes de cultivo (capiacutetulo 2) ya que tan
solo entre un 1 y un 10 del total de bacterias del suelo son cultivables (Nannipieri et al
2003) Algunos autores (Menn et al 1993 Okpokwasili et al 1986) proponen que los genes
cataboacutelicos para la degradacioacuten de HAP probablemente se transmitan horizontalmente
mediante plaacutesmidos entre bacterias pertenecientes a grupos taxonoacutemicos muy diferentes
Mueller et al (1997) afirman que no es probable encontrar una clara relacioacuten entre grupos
taxonoacutemicos de bacterias y la produccioacuten de enzimas implicadas en la degradacioacuten de
hidrocarburos aromaacuteticos Por tanto no es extrantildeo que genes homoacutelogos (en este caso
degradativos) se expresen en bacterias que taxonoacutemicamente estaacuten muy poco relacionadas
(capiacutetulos 2 3 y 4) otorgando una alta variabilidad al conjunto de bacterias con capacidad
degradadora
Discusioacuten general
178
Preexposicioacuten a los HAP iquestes necesaria para una biodegradacioacuten eficaz HAP
Tradicionalmente algunos autores han sugerido que la preexposicioacuten de bacterias a un
determinado contaminante es necesaria para la adaptacioacuten y consecuente degradacioacuten
(Spain amp van Veld 1983) o para un aumento en la tasa del proceso (Haritash amp Kaushik
2009) Sin embargo autores como Johnsen amp Karlson (2005) se plantean si eacutesta es una
capacidad presente en las comunidades microbianas independientemente de su previa
exposicioacuten o si es una capacidad inducida por la exposicioacuten a elevados niveles de
contaminante Los procesos de biodegradacioacuten realizados con consorcios bacterianos
procedentes de zonas libres de contaminacioacuten por HAP (capiacutetulos 3 y 4) indican que eacutesta
es una capacidad intriacutenseca en las bacterias e independiente de la previa exposicioacuten y que
se manifiesta ante un periodo de contaminacioacuten Los geacuteneros identificados en el capiacutetulo 3
(Ralstonia Pseudomonas o Bacillus) son propios de sistemas con un alto contenido en
madera en descomposicioacuten en los que contribuyen a la degradacioacuten de lignocelulosa
celulosa y sus subproductos mediante enzimas oxidativas (Rastogi et al 2009) Las
enzimas lignoliacuteticas de los hongos saproacutefitos degradan compuestos con estructuras
quiacutemicas similares a la lignina como son los HAP (Hatakka 1994 2001 Barr amp Aust 1994
Meulenberg et al 1997) Por tanto las especies bacterianas con la bateriacutea enzimaacutetica para
degradar subproductos de lignina y celulosa pueden tambieacuten adaptarse y metabolizar HAP
(Tian et al 2008 Couling et al 2010) La capacidad degradadora de este tipo de
compuestos no solo se transmite de manera vertical sino que la transferencia horizontal de
genes puede ser tambien un factor determinante para la adquisicioacuten de esta capacidad entre
los microorganismos del consorcio o comunidad
Los resultados referentes a la alta capacidad degradativa que muestra el consorcio
BOS08 procedente de una zona limpia (capiacutetulo 3) gozan de una extraordinaria importancia
a nivel aplicado y ecoloacutegico La mayoriacutea de los trabajos que estudian el posible paralelismo
entre la degradacioacuten de lignina y la de compuestos aromaacuteticos se han llevado a cabo con
hongos maderables de la llamada ldquopodredumbre blancardquo El hecho de que un consorcio
bacteriano no adaptado a la degradacioacuten de HAP sea capaz de metabolizar eficazmente
HAP de alto peso molecular y ademaacutes disminuya la toxicidad del medio por debajo del
umbral de la toxicidad incluso a bajas temperaturas sin duda abre un campo de
investigacioacuten muy amplio dentro de la biorremediacioacuten Ecofisioloacutegicamente hablando
resultan tambieacuten de gran intereacutes estas espcies que han sido capaces de readaptar su
bateriacutea enzimaacutetica para metabolizar una fuente de carbono altamente recalcitrante y toacutexica
que no estaba presente en su medio natural
Discusioacuten general
179
Posibles actuaciones en un medio contaminado
Ante un caso de contaminacioacuten de un medio con HAP o sustancias que los contengan la
biorremediacioacuten resulta una de las teacutecnicas maacutes eficaces y respetuosas con el medio La
atenuacioacuten natural del contaminante por los microorganismos presentes en el propio medio
depende seguacuten Frosyth et al (1995) del tamantildeo de la poblacioacuten degradadora autoacutectona No
obstante los resultados obtenidos durante el proceso de biorremediacioacuten de un suelo
contaminado con creosota (capiacutetulo 4) indican que los resultados que puede ofrecer la
atenuacioacuten natural no dependen uacutenicamente del nuacutemero inicial de microorganismos
degradadores Las pruebas realizadas indicaron en el momento que se produjo la
contaminacioacuten la actividad degradadora era nula aunque tras un corto peridodo de
exposicioacuten al mismo comenzoacute la actividad de los microorganismos degradadores Esto
quiere decir que aunque en un primer momento la poblacioacuten degradadora sea miacutenima la
presencia del contaminante favorece su dominancia y hace patente su capacidad
degradadora Ademaacutes hay que tener en cuenta varias de las cuestiones abordadas en
apartados previos como son la rapidez y facilidad que tienen los microorganismos para
transferir esta capacidad incluso entre diferentes taxas (Menn et al 1993) o la alta
adaptabilidad a una nueva fuente de carbono Sin embargo la atenuacioacuten natural es una
teacutecnica muy ventajosa porque evita dantildeos en la comunidad bacteriana del medio a
diferencia de cualquier otra actuacioacuten que en menor o mayor medida modifican las
condiciones originales del ecosistema
Uno de los principales problemas de la biorremediacioacuten es el tiempo necesario para
la completa eliminacioacuten del contaminante del medio para lo cual se han desarrollado
estrategias de actuacioacuten con el uacutenico objetivo de acelerar y mejorar la eficacia del proceso
La bioestimulacioacuten tiene como principal objetivo potenciar la capacidad degradadora de los
microorganismos degradadores autoacutectonos mediante la adicioacuten de nutrientes inorgaacutenicos al
medio contaminado Sin embargo los resultados referentes a esta teacutecnica no son
concluyentes dada la elevada variabilidad de los mismo Los casos en los que la
bioestimulacioacuten favorece el proceso de biodegradacioacuten estaacuten estrechamente relacionados
con el impedimento de que los nutrientes se conviertan en un factor limitante para los
microorganismos ya que tal y como expone Leys et al (2005) los requerimientos de
nitroacutegeno y foacutesforo aumentan notablemente durante un episodio de contaminacioacuten Sin
embargo son numerosos los estudios que han obtenido resultados desfavorables con esta
teacutecnica debido a cuestiones relacionadas con altos iacutendices de salinidad (Braddock et al
1997) o tal y como se observa en el capiacutetulo 4 con los cambios que la bioestimulacioacuten
genera en la comunidad bacteriana que en muchos casos inducen a relaciones negativas
entre las especies de la comunidad debido a la competencia por los nutrientes (Rolling-
Discusioacuten general
180
Willfred et al 2002) Por otra parte la bioestimulacioacuten durante el proceso de
biorremediacioacuten del suelo contaminado con creosota (capiacutetulo 4) no favorecioacute
significativamente la biodegradacioacuten del contaminante Estos resultados se pueden atribuir a
una concentracioacuten de nutrientes suficientes en el medio o bien a la raacutepida y efectiva
capacidad degradativa de creosota que mostraron los microorganismos autoacutectonos
El bioaumento es una teacutecnica que pretende incrementar la eficacia del proceso de
biorremediacioacuten mediante el inoacuteculo a la poblacioacuten autoacutectona de una poblacioacuten
degradadora previamente definida como tal Sin embargo es un tratamiento complejo cuyos
resultados dependen de algo tan desconocido y variable como son las relaciones entre
especies y comunidades (Yu et al 2005) Por ello no hay gran nuacutemero de artiacuteculos en los
que se describan resultados favorables de esta teacutecnica pero podemos resumir que las
consecuencias del bioaumento dependen fundamentalmente de dos cuestiones Una de
ellas es que las relaciones de competencia que se establecen entre la comunidad
introducida y autoacutectona sean negativas para la poblacioacuten degradadora (Vintildeas et al 2005
Yu et al 2005) relaciones que principalmente estaacuten dirigidas por la competicioacuten por los
recursos (Yu et al 2005) La inexistencia de efectos significativos del bioaumento durante el
proceso de bodegradacioacuten de creosota (capiacutetulo 4) al igual que los descritos por Herwignen
et al (2005) indican que la presencia de una comunidad bacteriana autoacutectona con
capacidad degradadora o que se adapta raacutepidamente como es nuestro caso puede ser otra
de las cuestiones que hagan que el bioaumento no favorezca el proceso
Los ensayos de biorremediacioacuten realizados durante la presente tesis y los
consultados en las diferentes referencias bibliograficas nos llevan a concluir una vez maacutes
que los efectos de las diferentes teacutecnicas de biorremediacioacuten dependen de las condiciones
del medio contaminado y de la poblacioacuten bacteriana que alberga Por ello un estudio previo
que indique las caracteriacutesticas bioacuteticas (capacidad degradadora composicioacuten y evolucioacuten de
la comunidad bacteriana) y abioacuteticas (temperatura ambiente y caracteriacutesticas fisico-quiacutemicas
del suelo) del mismo asiacute como un breve ensayo a escala de laboratorio donde se apliquen
las diferentes teacutecnicas y seleccionando las maacutes adecuadas mejora en gran medida la
efectividad de la biorremediacioacuten in situ
Conclusiones generales
III
Conclusiones generales
183
Conclusiones generales
De los trabajos llevados a cabo en esta tesis doctoral se pueden extraer las siguientes
conclusiones generales
1 La optimizacioacuten de los factores abioacuteticos y bioacuteticos hace que el proceso de
biodegradacioacuten sea maacutes eficaz y permite modificarlo mediante estrategias de
biorremediacioacuten
2 Los factores que realmente influyen significativamente en un proceso se observan
mediante un estudio ortogonal de los mismos porque permite evaluar las
interacciones entre los factores seleccionados
3 No todos los ambientales son limitantes para la degradacioacuten de HAP Po ejemplo la
bioestimulacioacuten con nutrientes inorgaacutenicos no es efectiva en casos en los que la
cantidad de nutrientes en el medio es suficiente La adicioacuten de glucosa como fuente
adicional de carbono no es necesaria cuando el consorcio esta adaptado a los HAP
como fuente de carbono
4 Las actuaciones basadas en la adicioacuten de fuentes de carbono adicionales a los HAP
no son efectivas cuando los consorcios o cepas bacterianas estaacuten adaptadas a los
HAP porque esto supone un periodo de readaptacioacuten
5 La fuente de carbono disponible en cada momento durante un proceso de
biodegradacioacuten de HAP y otras sustancias en el medio como los surfactantes
condicionan la presencia de especies y por tanto la sucesioacuten de las mismas
6 La aparicioacuten de nuevas especies previamente no descritas como degradadoras
puede estar relacionada con la transferencia horizontal de genes degradativos que
en muchos casos ocurre entre grupos taxonoacutemicos poco relacionados lo que
ampliariacutea auacuten maacutes la expresioacuten de la capacidad degradativa en la comunidad
7 La identificacioacuten en un consorcio procedente de una zona limpia y rica en materia
orgaacutenica de especies fundamentales en sistemas de degradacioacuten de madera
sugiere que las enzimas oxidativas usadas por estas especies en la degradacioacuten de
subproductos de lignina y celulosa se emplean en la degradacioacuten de HAP Por tanto
Conclusiones generales
184
la previa exposicioacuten de los consorcios bacterianos o cepas individuales a un
contaminante no es necesaria cuando tienen una bateriacutea enzimaacutetica que se puede
adaptar y metabolizar el contaminante
8 El papel de las especies bacterianas adaptadas a la degradacioacuten de HAP en
ambientes friacuteos (Tordf lt 15ordmC) es fundamental para la biorremediacioacuten en climas
extremos Ademaacutes la actividad de estas especies en periodos de bajas temperaturas
permite el crecimiento de otras especies de la comunidad bacteriana a partir de los
subproductos de degradacioacuten
9 El bioaumento es una teacutecnica cuyos resultados estaacuten ampliamente influenciados por
las relaciones que se establecen entre la comunidad autoacutectona e introducida y soacutelo
se recomienda en aquellos casos en los que la comunidad autoacutectona no tenga
microorganismos degradadores o no sean capaces de desarrollar esta capacidad
Referencias bibliograacuteficas
IV
Referencias bibliograacuteficas
187
Referencias bibliograacuteficas
Aislabie J Foght J amp Saul D 2000 Aromatic hydrocarbon-degrading bacteria from soil near
Scott Base Antarctica Polar Biol 23 183-188
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Baek KH Yoon BD Kim BH Cho DH Lee IS Oh HM amp Kim HS 2007 Monitoring of
microbial diversity and activity during bioremediation of crude oil-contaminated soil
with different treatments J Microbiol Biotechnol 17 67-73
Barkay T amp Pritchart H 1988 Adaptation of aquatic microbial communities to pollutant
stress Microbiol Sci 5165-169
Barr DP amp Aust SD 1994 Mechanisms with rot fungi use to degrade pollutants Environ
Sci Technol 28 78A-87A
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Braddock JF Ruth ML Catterall PH Walworth JL amp McCarthynd KA 1997
Enhancement and inhibition of microbial activity in hydrocarbon contaminated arctic
soil implication for nutrients amended bioremediation Environ Sci Technol 31
2078-2084
Cavicchioli R Siddiqui KS Andrews D amp Sower KR 2002 Low temperature
extremophiles and their applications Curr Opin Biotechnol 13 253-261
Cerniglia1984 Microbial metabolism of polycyclic aromatic hydrocarbons Adv Appl
Microbiol 30 31-71
Cerniglia 1992 Biodegradation of polycyclic aromatic hydrocarbons Biodegradation 2-3
351-368
Referencias bibliograacuteficas
188
Chaicircneau CH Morel J Dupont J Bury E amp Oudot J 1999 Comparison of the fuel oil
biodegradation potential of hydrocarbon assimilating microorganisms isolated from a
temperate agricultural soil Sci Total Environ 227 237-247
Chaicircneau CH Rogeus G Yeacutepreacutemian C amp Outdot J 2005 Effects of nutrients
concentration on the biodegradation of crude oil and associated microbial
populations in the soil Soil Biol Biochem 37 1490-1497
Chauhan A Fazlurrahman Oakeshott JG amp Jain RK 2008 Bacterial metabolisms of
polycyclic aromatic hydrocarbons strategies for remediation Indian J Microbiol
4895-113
Chen S-H amp Aitken MD 1999Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
Environ Sci Technol 33 435ndash439
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of polycyclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Cheung P-Y amp Kinkle BK 2005 Effect of nutrients and surfactant on pyrene mineralization
and Mycobacterium spp populations in contaminated soil Soil Biol Biochem 37
1401-1405
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Clements WH Oris JT amp Wissin TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Leponis macrochirus
Arch Environ Contam Toxicol 26261-266
Colwell RR Mills AL Walker JD Garcia Tello P amp Campos V 1978 Microbial ecological
studies at the Metula spill in the Strait of Magellan J Fish Res Board Can 35573-
580
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Poll 158 3411-
3420
Das K amp Mukherjee AK 2006 Crude petroleum-oil biodegradation efficiency of Bacillus
subtillis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India Bioresour Technol 98 1339-1345
Delille D amp Pelletier E 2002 Natural attenuation of diesel-oil contamination in a subantartic
soil (Crozet island) Polar Biol 25 682-687
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge App Environ Mirobiol 37 729-739
Referencias bibliograacuteficas
189
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosms
simulation Marine Environ Res 52 195-211
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in artic tundra soil Appl Environ Microbiol 67 5107-
5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap
Evolution 39 783-791
Fiechter A 1992 Biosurfactants moving towards industrial application Trends Biotechnol
10 208-217
Fritsche JD 1985 Nature and significance of microbial cometabolism of xenobiotics J
Basic Bacteriol 25 603-619
Forsyth JV Tsao YM amp Bleam RD 1995 Biorremediation when is augmentation needed
In Hinchee RE Fredrickson J amp Alleman BC (Eds) Bioaugmentation for site
remediation Battelle Press Columbus pp 1-14
Ghazali FM Rahman RNZA Salleh AB amp Basr M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grimberg SJ Stringfellow WT amp Aitken MD 1996 Quantifying the biodegradation of
phenanthrene by Pseudomonas stutzeri P16 in the presence of a nonionic surfactant
Appl Environ Microbiol 62 2387-2392
Habe H amp Omori T 2003 Gentics of polycyclic aromatic hydrocarbon metabolisms in
diverse aerobic bacteria Biosci Biotechnol Biochem 67 225-243
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of polycyclic aromatic
hydrocarbons (PAHs) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microbial Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M amp Steinbuchel A (eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJ Wuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
Referencias bibliograacuteficas
190
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Internacional Agency for Research on Cancer 1972-1990 Monographs on the evaluation of
carcinogenics risks on human International Agency for Research on Cancer Lyons
France
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Johnsen AR Wick LY amp Harms H 2005 Principles of microbial PAH-degradation in soil
Environ Pollut 133 71-84
Johnsen AR Lipthay JR Sorensen SJ Ekelund F Christensen P Andersen O
Karlson U amp Jcobsen CS 2006 Microbial degradation of street dust polycyclic
aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil
Environ Microbiol 8535-545
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kanaly RA amp Harayama S 2000 Biodegradation of high molecular weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059-2067
Kaumlstner M Breueer-Jammali M amp Mahro B 1998 Impact of inoculation protocols salinity
and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil Appl Environ Microbiol 64 359-362
Kim Y H Freeman J P Moody J D Engesse K H amp Cerniglia C E 2005 Effects of pH
on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii
PYR-1 Appl Environ Microbiol 67 275ndash285
Koeber R Bayona JM amp Niessner R 1999 Determination of benzene[a]pyrene diones in
air particulates matter with liquid chromatography mass spectrometry Environ Sci
Technol 33 1552-1558
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Lee ML Novotny MV amp Bartle KD 1981 Analytical chemistry of polycyclic aromatic
hydrocarbons Academic Press Inc New York NY
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegrdation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Referencias bibliograacuteficas
191
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation by
Mycobacterium and Sphingomonas in soil Appl Microbiol Biotechnol 66 726-736
Lim LH Harrison RM amp Harrad S 1999 The contribution of traffic to atmospheric
concentration of polycyclic aromatic hydrocarbons Environ Sci Technol 33 3538-
3542
Liu Y Zhu L amp Shen X 2001 Polycyclic aromatic hydrocarbons in indoor and outdoor air of
Hangzhou China Environ Sci Technol 35 840-844
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Maliszewska-Kordybach B 1996 Polycyclic aromatic hydrocarbons in agricultural soils in
Poland preliminary proposals for criteria to evaluate the level of soil contamination
Appl Geochem 11 212-127
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts
Extremophiles 7451ndash458
Martiacuten Guirao L 2007 Aproximacioacuten ecotoxicoloacutegica a la contaminacioacuten por metales
pesados en la laguna costera del Mar Menor Tesis doctoral Universidad de Murcia
Murcia
Menn F-M Applegate BM amp Sayler GS 1993 NAH-plasmid mediated catabolisms of
anthracene and phenanthrene to naphtoic acids Appl Environ Microbiol 59 1938-
1942
Meulenberg R Rijnaarts HHM Doddema HJ amp Field A 1997 Partially oxidized polycyclic
aromatic hydrocarbons show an increased bioavailability and biodegradability FEMS
Microbiol 152 45-49
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Referencias bibliograacuteficas
192
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mueller JG Chapman PJ Blattman BO amp Pritchard PH 1990 Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis Appl
Environ Microbiol 56 1079-1086
Mueller JG Devereux R Santavy DL Lantz SE Willis SG amp Pritchard PH 1997
Phylogenetic and Physiological comparisions of PAH-degrading bacteria from
geographically diverse soils A van Leeuw J Microb 71 329-343
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions European J Soil Sci 54 655-670
Okpokwasili GC Somerville CC Grimes DJ amp Colwell RR 1986 Plasmid-associated
phenanthrene degradation by Chesapeake Bay sediment bacteria A Colloq Inst
Fran Rech Exploit Mer 3 601ndash610
Pelz O Tesar M Wittich RM Moore ERB Timmis KN Abraham WR 1999 Towards
elucidation of microbial community metabolic pathways unrevealing the network of
carbon sharing in a pollutant-degrading bacterial consortium by immunocapture and
isotopic ratio mass spectrometry Environ Microbiol 1167ndash174
Portaels F amp Pattyn SR 1982 Growth of mycobacteria in relation to the pH of the medium
Ann Microbiol 133 213-221
Puntus IF Filonov AE Akhmetov LI Karpov AV amp Boronin AM 2008 Phenanthrene
degradation by bacteria of the genera Pseudomonas and Burkholderia in model soil
systems Microbiology 77 7-15
Rastogi G Muppidi GL Gurram RN Adhikari A Bischoff KM Hughes SR Apel WA
Bang SS Dixon DJ amp Sani RK 2009 Isolation and characterization of cellulose-
degrading bacteria from the deep subsurface of the Homestake gold mine Lead
South Dakota USA J Ind Microbiol Biotechnol 36 585-598
Readman J W Fillmann G Tolosa I Bartocci J Villeneuve J -P Catinni C amp Mee L D
2002 Petroleum and PAH contamination of the Black Sea Marine Pollut Bull 44
48-62
Rolling Willfred FM Milner MG Jones DM Lee K Danniel F Swanell Richard JP amp
Head IM 2002 Robust hydrocarbons degradation and dynamics of bacterial
communities during nutrients-enhanced oil spill bioremediation Appl Environ
Microbiol 68 5537-5548
Rosenberg E amp Ron EZ 1999 High ndash and low- molecular mass microbial surfactant Appl
Microiol Biotechnol 52 154-162
Referencias bibliograacuteficas
193
Santos E C Jacques R J S Bento F M Peralba M-C R Selbach PA Saacute E L S
Camargo FAO 2008 Anthracene biodegradation and surface activity by an iron-
stimulated Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Shuttleworth KL amp Cerniglia E 1995 Environmental aspect of PAH biodegradation Appl
Biochem Biotechnol 54 291-302
Soberon-Chavez G Lepine F amp Deziel E 2005 Production of rhamnolipids by
Pseudomonas aeruginosa Appl Microbiol Biotechnol 68 718-725
Soriano JA Vintildeas MA Franco JJ Gonzaacutelez JM amp Albaigeacutes J 2006 Spatial and
temporal trends of petroleum hydrocarbons in wild mussels from the Galician coast
(NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquat Microb Ecol 47 1-10
Tian L Ma P amp Zhong J-J 2003 Impact of presence of salicylate or glucose on enzyme
activity and phenanthrene degradation by Pseudomonas mendocina Process
Biochem 38 1125-1132
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull56 1184-1191
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons
removal capacities Syst Appl Microbiol 29 244-252
Torres LG Rojas N Bautista G amp Iturbe R 2005 Effect of temperature and surfactantacutes
HLB and dose over the TPH-diesel biodegradation process in aged soils Process
Biochem 40 3296-3302
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated Soil App Environ Microbiol 71 7008-7018
Wagrowski DM amp Hites RA 1997 Polycyclic aromatic hydrocarbons accumulation in urban
suburban and rural vegetation Environ Sci Technol 31 279-282
Referencias bibliograacuteficas
194
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacilus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Pollut 139 1-13
Wu SC amp Gschwend PM 1986 Sorption kinetics of hydrophobic organic compounds to
natural sediments and soil Environ Sci Technol 20 717-725
Ye B Siddigi MA Maccubbin AE Kumar S amp Sikka HC 1996 Degradation of
polynuclear aromatic hydrocarbons by Sphyngomonas paucimobilis Environ Sci
Technol 30136-142
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005 Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
Zender M 1983 Physical and chemical properties of polycyclic aromatic hydrocarbons p 1-
26 In ABjorseth (ed) Handbook of polycyclic aromatic hydrocarbons Marcel
Dekker Inc New York NY
Zhang XX Cheng SP Zhu CJ amp Sun SL 2006 Microbial PAH-degradation in soil
degradation pathways and contributing factors Pedosphere 16 555-565
Zhang Z Gai L Hou Z Yang C Ma C Wang Z Sun B He X Tang H amp Xu P 2010
Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils Bioresource Technol 101 8452ndash8456
Agradecimientos
197
Agradecimientos
Todaviacutea recuerdo el primer diacutea que entre en el departamento en el laboratorio
aquello me parecioacute todo un mundo en el cual sin quererlo y sin estar convencida de
ello acabeacute metida de lleno Poco a poco fueron pasando los meses los antildeos
presenteacute el Practicum y me diacute cuenta de que queriacutea seguir adelante Unos cuantos
antildeos despueacutes he llegado a la meta lo cual no hubiera sido posible sin mucha gente
que me ha apoyado ayudado y empujado en los momentos en los que yo no podiacutea
maacutes A todos ellos gracias por hacer que esto haya sido posible
El primero de mis agradecimientos va dirigido a Natalia Fernando y Mari
Carmen Os tengo que dar las gracias por brindarme la oportunidad de formar parte
del grupo y por tantas cosas que con cada uno de vosotros he aprendido Despueacutes
de estos antildeos creo que hemos conseguido cosas maravillosas aunque hayamos
tenido imprevistos de todo tipo porque como ya sabemos si ponemos un circo nos
crecen los enanoshellippero aquiacute estamos Somos un grupo muy equilibrado
profesionalmente tenemos un poco de todo y por otro lado no es mal balance tres
histeacutericas frente a uno que pone la calma no se como no hemos acabado contigo
Fernando Natalia gracias por hacerme controlar el miura que llevo dentro y tener
tanta paciencia Carmen gracias por estar siempre ahiacute ya sea desde Espantildea desde
el otro lado del charco o nada mas ser mamaacute En todo momento a nivel personal y
profesional me he sentido arropada por vosotros gracias por vuestro apoyo y ganas
de seguir adelante Vosotros habeis sido los responsables de que quiera investigar
Si una persona en concreto se merece especial agradecimiento es mi Yoli
Aunque al principio de todo no nos conociacuteamos no hay mas que vernos ahora Por
un lado ha sido imprescindible la ayuda que me has dado trabajando cuando maacutes
perdida estaba Por todo tu apoyo ten presnete que me has ayudado a escribir cada
una de las liacuteneas que has leiacutedo Has sabido ser mi amiga y estar conmigo cuando
maacutes lo he necesitado y hacer que me olvidara de todo ya sea haciendo toriijas
pizzas viendo una peli tomando una copichuela o con nuestros preciados pinchitos
sobre todo estos uacuteltimos meses estresantes en los que no seacute como no te he vuelto
loca Gracias tambieacuten por hacerme reir hasta llorar por preocuparte cada diacutea de
198
estas uacuteltimas semanas de coacutemo voy por conocerte todas y cada una de las cosas
en las que estoy trabajando y un largo etc Te conoces mejor yo el estado de cada
uno de mis artiacuteculos las correcciones que tengo y las que me faltan Eres estupenda
y espero no dejar de descubrir nunca cosas sobre ti Mil gracias
Son muchas las personas que han pasado por el despacho Pepe aunque
estas muy muy lejos agardezco tu ayuda continua sobre todo en el Maacutester la mitad
de las cosas se me hubieran olvidado si no hubiera sido por ti que cabeza la miacutea
Tambieacuten tengo que recordar a Raquel Felipe y Cris el antiguo equipo Ecotox
pasamos muy buenos ratos que se echan de menos A mis actuales compantildeeros
Alfredo Pesca Julia Silvia y Carlos que aunque no estas en el despacho como si lo
estuvieras Gracias por amenizar las horas de laboratorio y los madrugones Silvia
especialmente a ti gracias por sacar siempre un rato para charlar y escucharnos
mutuamente aunque nos separen un porroacuten de cajas y un poto gigante ahiacute estas
siempre Espero seguir aquiacute mucho tiempo para apoyarte igual que tuacute lo has hecho
conmigo Cris no me olvido de ti que desde el principio y hasta ahora te has
preocupado de saber que tal me iba estabas al tanto de todo y me has animado a
seguir adelante Te deseo que las cosas te vayan genial porque te lo mereces
asique aacutenimo que no es por presionar pero en breve te toca a tiacute Me faltan palabras
para contar todo lo que Moacutenica y Andrea me han ayudado y ensentildeado desde un
primer momento Igualmente agredezco el apoyo que Patri y Ester me han dado al
igual que los buenos ratos cotilleando imprescindibles Tambieacuten tengo que
agradecer a Jose Luis Sanz de la Universidad Autoacutenoma de Madrid que me abriera
las puertas de su laboratorio para aprender la maravillosa teacutecnica del DGGE y unas
cuantas cosas maacutes Ine a tiacute si que te agradezco un montoacuten las horas que has
perdido de tu trabajo para ensentildearme Desde un primer momento simpre con la
sonrisa puesta auacuten sin concocerme de nada Han sido muchos los viajes que he
hecho y el tiempo empleado en ello pero ha merecido la pena Asique igualmente
formas parte de esta tesis porque cada uno de los artiacuteculos no hubieran estado
completos sin tu ayuda
Son muchas las personas que sin formar parte del gremio han estado siempre
presentes Mis padres y mi hermano ya sabeis que no podriacutea hacer nada sin
vosotros a mi lado Durante estos antildeos no habeis dejado de preocuparos por mi y de
apoyarme ni un solo instante maacutes auacuten cuando las cosas han sido tan complicadas
199
para miacute Nada hubiera salido bien sin vosotros una vez maacutes os doy las gracias por
ser tan maravillosos y por teneros Por otro lado mis amigos ellos si que andan
agenos al tema y sin embargo siempre han sabido cuando preguntar y que palabras
usar cuando mas lo he necesitado Tengo que hacer una mencioacuten especial al sentildeor
Jimmy (responsable graacutefico y de disentildeo de la tesis) a ti si que te ha caiacutedo una
buena desde aquella llamada en la que te dije ldquoha llegado el momentordquo A
parte del gran trabajo que has hecho vistiendo la tesis tuacute una de las personas maacutes
sosegadas que conozco has podido aguantar el histerismo de los diacuteas previos a
depositar la tesis Gracias Jimmy eres un sol pero que sepas que auacuten me queda la
defensa oacutesea presentacioacuten en power pointhellipyo no digo nada Tambieacuten
agaradezco al ldquogrupo parkeeerdquo las horas que pasamos en las cuales a parte de
mucho friacuteo tambieacuten pasamos muy buenos ratos Especialmente a Lauri gracias por
acercarte un buen diacutea y preguntarme iquesttodo bien Desde entonces tus achuchones
tus canciones y tu ldquoflower powerrdquo han hecho que me despeje cada tarde Gracias
tambieacuten por interesarte tanto por mi trabajo dentro de poco te lo podreacute presentar
Las uacuteltimas palabras van dirigidas a Javi A ti que has estado conmigo desde el
principio gracias por no dejar que me desquicie y darme siempre tranquilidad Son
muchas las horas que he dedicado a esto y siempre has estado recordaacutendome
cuando era el momeno de parar Gracias por saber comprender lo que hago aunque
a veces me queje tanto y por ayudarme a echarle un par de narices cuando maacutes
desanimada estaba Gracias por hacer que este mundo roto no estropee mi sonrisa
Todo el tiempo que no te he dedicado lo recuperaremos juntos en nuestra casa
A todos y cada uno de vosotros gracias
Raquel
Dra Natalia Gonzaacutelez y Dra Mariacutea del Carmen Molina profesoras titulares del
Departamento de Biologiacutea y Geologiacutea de la Universidad Rey Juan Carlos
CERTIFICAN
Que los trabajos de investigacioacuten desarrollados en la memoria de tesis doctoral
ldquoBiorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicosrdquo son aptos para ser presentados por la Lda Raquel Simarro Doblado ante el
Tribunal que en su diacutea se consigne para aspirar al Grado de Doctor en Ciencias
Ambientales por la Universidad Rey Juan Carlos de Madrid
VordmBordm Director Tesis VordmBordm Director de Tesis
Dra Natalia Gonzaacutelez Beniacutetez Dra Mordf Carmen Molina
A mi familia a Javi y amigos todos ellos forman parte de esta tesis como si de un capiacutetulo se tratase
A todos gracias por formar parte de los capiacutetulos de mi vida
Iacutendice
I Resumen Antecedentes 13 Objetivos 25 Listado de manuscritos 27 Siacutentesis de capiacutetulos 29 Metodologiacutea general 33
Capiacutetulo 1a Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium 47
b Evaluation of the influence of multiple environmental factors on the biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal experimental design 67
Capiacutetulo 2 Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process 85
Capiacutetulo 3 High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures 113
Capiacutetulo 4 Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil change in bacterial community 143
II Discusioacuten general 171
III Conclusiones generales 181
IV Referencias bibliograacuteficas 185
V Agradecimientos 195
Resumen
AntecedentesObjetivos
Listado de manuscritosSiacutentesis de capiacutetulosMetodologiacutea general
I
Resumen Antecedentes
13
Antecedentes
Tal y como su propio nombre indica biorremediacioacuten significa ldquodar remediordquo mediante
teacutecnicas bioloacutegicas por lo que una definicioacuten acertada de biorremediacioacuten seriacutea el conjunto
de teacutecnicas que permiten resolver problemas de contaminacioacuten mediante el uso de
microorganismos (bacterias algas unicelulares etc) hongos plantas o enzimas derivadas
de ellos En el contexto de esta tesis la biorremediacioacuten se aplica a suelos u otros sistemas
contaminados con hidrocarburos aromaacuteticos policiacuteclicos (HAP o PAH siglas en ingleacutes
polyciclic aromatic hydrocarbons) Los HAP son compuestos que se generan por la
combustioacuten incompleta de combustibles foacutesiles por causas naturales y en mayor medida
antroacutepicas Si tenemos en cuenta que el sustento del sistema energeacutetico mundial son los
combustibles foacutesiles podemos hacernos una idea de la relevancia y elevada presencia de
estos compuestos en la vida cotidiana Considerando sus complejas propiedades y su
caraacutecter perjudicial para el ser humano y los ecosistemas (Internacional Agency for
Research on Cancer 1972-1990) los HAP suscitaron una creciente preocupacioacuten a partir
del pasado siglo siendo los primeros carcinoacutegenos ambientales reconocidos (Haritash amp
Kaushik 2009) Eacutesto dio lugar a numerosos estudios cientiacuteficos con el objetivo de
determinar sus efectos en el medio y el ser humano asiacute como a la buacutesqueda de soluciones
para su eliminacioacuten Frente a muchas otras teacutecnicas de eliminacioacuten de contaminantes
(teacutecnicas fiacutesicas yo quiacutemicas) la biorremediacioacuten presenta una caracteriacutestica clave que la
hace destacar sobre las otras teacutecnicas y es que se basa en procesos que respetan el medio
perturbado y permiten en la medida de lo posible su recuperacioacuten
Los hidrocarburos aromaacuteticos policiacuteclicos (HAP) Legislacioacuten espantildeola sobre medios
contaminados
La presente tesis se centra en el estudio de la biodegradacioacuten de los hidrocarburos
aromaacuteticos policiacuteclicos y por ello es esencial conocer a fondo queacute son cuaacuteles son sus
caracteriacutesticas y porqueacute suscitan este intereacutes Los HAP son compuestos quiacutemicos formados
por la fusioacuten de un determinado nuacutemero de anillos de su principal componente aromaacutetico el
benceno La estructura quiacutemica de alguno de los compuestos que han sido utilizados
durante el desarrollo de esta tesis aparecen en la Figura 1
Resumen Antecedentes
14
Figura 1 Hidrocarburos aromaacuteticos poliacuteciacuteclicos de bajo (naftaleno fenantreno y antraceno) y alto peso
molecular (pireno y perileno)
Los HAP se pueden clasificar en funcioacuten del nuacutemero de anillos benceacutenicos en HAP de
bajo (menos de tres anillos) y de alto peso molecular Tan soacutelo el naftaleno fenantreno y
antraceno (dos y tres anillos respectivamente) seriacutean considerados HAP de bajo peso
molecular (Cerniglia 1984 1992) La propiedades quiacutemicas de los HAP y por tanto su
destino en el medioambiente depende del nuacutemero de anillos aromaacuteticos que lo componen y
de su tipologiacutea molecular (Kanaly amp Harayama 2000) Por ejemplo el fenantreno y
antraceno son compuestos isoacutemeros (Figura 1) con el mismo peso molecular porque tienen
el mismo nuacutemero de anillos benceacutenicos pero en distinta disposicioacuten lo que les confiere
distintas caracteriacutesticas quiacutemicas En general a medida que aumenta su tamantildeo peso
molecular y angularidad aumenta su hidrofobicidad y estabilidad electroquiacutemica (Zander
1983) Tal y como algunos trabajos han demostrado eacutestos son dos factores primarios que
contribuyen a la persistencia de los HAP en el medio Por ejemplo de acuerdo con
Shuttleworth amp Cerniglia (1995) la vida media en suelos y sedimentos de un HAP de tres
anillos como el fenantreno podriacutea oscilar en un rango de entre 6 a 126 diacuteas mientras que
para moleacuteculas de cuatro a cinco anillos el tiempo aumentariacutea de 229 a maacutes de 1400 diacuteas
Ademaacutes debido a su naturaleza lipofiacutelica tiene un elevado potencial de bioacumulacioacuten en la
cadena troacutefica fenoacutemeno conocido como biomagnificacioacuten (Clements et al 1994) Se sabe
que los HAP ejercen un acusado efecto toacutexico y poseen propiedades mutageacutenicas
teratogeacutenicas y en algunos casos carcinogeacutenicas (Internacional Agency for Research on
Cancer 1972-1990) De hecho dieciseacuteis HAP han sido clasificados como contaminantes
prioritarios por la US Environmental Protection Agency (Agencia de proteccioacuten ambiental
Resumen Antecedentes
15
de Estados Unidos) y por la Comisioacuten Europea de Medio Ambiente (Maliszewska-Kordybach
1996)
Los HAP estaacuten presentes como constituyentes naturales de los combustibles foacutesiles y
se forman durante la combustioacuten incompleta de la materia orgaacutenica Las fuentes naturales
de produccioacuten de HAP son los incendios forestales y de pastizales yacimientos de petroacuteleo
o erupciones volcaacutenicas (Haritash amp Kaushik 2009) Sin embargo las fuentes antroacutepicas
son las que maacutes contribuyen a su formacioacuten mediante la quema de combustibles foacutesiles con
fines energeacuteticos en el tratamiento de la madera con creosota mediante el uso de
lubricantes y en el refino del petroacuteleo y actividades de transporte (Lee et al 1981) Aunque
los vertidos se produzcan en una zona determinada es posible que la carga contaminante
se extienda si alcanza un efluente o mediante su filtracioacuten a traveacutes del suelo pudiendo
alcanzar acuiacuteferos Otras cargas contaminantes se generan por descarga directa
procedentes de efluentes industriales en grandes superficies de suelos o mares o por la
liberacioacuten accidental de materia prima (Kanaly amp Harayama 2000) Se han detectado HAP
en el aire procedente fundamentalmente de la quema industrial de combustibles foacutesiles y el
traacutefico (Koeber et al 1999 Lim et al 1999) en suelos y en la parte superficial y profunda
de la columna de agua y sedimentos (Readman et al 2002 Johnsen et al 2005 2006) En
alimentos vegetales y plantas aparecen como consecuencia de la difusioacuten y posterior
sedimentacioacuten de los HAP atmosfeacutericos sobre la vegetacioacuten (Wagrowski amp Hites 1997) y
por la adsorcioacuten de HAP acumulados en el agua del suelo
El suelo constituye uno de los medios receptores de la contaminacioacuten maacutes sensibles y
vulnerables Sin embargo y auacuten dada la gravedad y extensioacuten creciente de la contaminacioacuten
con HAP no fue hasta la Conferencia de Naciones Unidas sobre el Medio Ambiente y el
Desarrollo celebrada en Riacuteo de Janeiro en 1992 cuando se reconocioacute y planteoacute de forma
trascendente la importancia de la proteccioacuten de los suelos y la definicioacuten de sus usos
potenciales La Agencia Europea de Medio Ambiente (AEMA) estimoacute en 1999 que el
nuacutemero de zonas o aacutereas contaminadas en Europa Occidental estaba entre 300000 y
1500000
Hasta la promulgacioacuten de la Ley 101998 de 21 Abril de Residuos Espantildea careciacutea de
cualquier instrumento normativo para legislar controlar y proteger lo referente a suelos
contaminados Con esta Ley las Comunidades Autoacutenomas son las encargadas de declarar
delimitar e inventariar los suelos contaminados de sus territorios ademaacutes de establecer las
bases para una determinada actuacioacuten Con el Real decreto 92005 del 14 de Enero se da
cumplimiento a lo dispuesto en la 101998 de Residuos y en eacutel se establece la relacioacuten de
actividades potencialmente contaminantes del suelo y los criterios y estaacutendares para la
Resumen Antecedentes
16
declaracioacuten de un suelo bajo la categoriacutea de ldquocontaminadordquo Uno de los aspectos maacutes
importantes desde el punto de vista de la biorremediacioacuten se recoge en el Artiacuteculo 7 del
Real Decreto 92005 por el cual ldquola declaracioacuten de un suelo como contaminado obligaraacute a la
realizacioacuten de las actuaciones necesarias para proceder a su recuperacioacuten ambientalrdquo
Ademaacutes antildeade que las teacutecnicas deben ser las maacutes apropiadas en cada caso garantizando
soluciones de caraacutecter permanente y prioriza las teacutecnicas de tratamiento in situ que eviten la
generacioacuten traslado y eliminacioacuten de residuos
Lo dispuesto en esta ley sin duda supone un enorme impulso a las teacutecnicas de
biorremediacioacuten ya que a traveacutes de ellas se favorece el tratamiento in situ y la recuperacioacuten
del ecosistema a su estadio original sin generacioacuten de residuos y con el menor impacto
ambiental posible
Factores que condicionan la biodegradacioacuten
Aunque la biodegradacioacuten bacteriana es una de las teacutecnicas maacutes eficaces en la
descontaminacioacuten in situ de medios contaminados con HAP la eficacia y tasas de
biodegradacioacuten dependen en gran medida del nuacutemero y tipo de microorganismo
degradador presente en el medio y de la naturaleza y estructura quiacutemica del contaminante a
degradar (Haritash amp Kaushik 2009) Ademaacutes a la hora de disentildear un sistema de
biorremediacioacuten debemos tener en cuenta que existen muacuteltiples factores ambientales que
van a condicionar la eficacia y la rapidez del proceso con el agravante de que durante la
aplicacioacuten in situ es difiacutecil y en algunos casos imposible poder controlar o modificar alguno
de estos factores La biorremediacioacuten es una teacutecnica eficaz y econoacutemica pero cuenta con la
desventaja del tiempo ya que en algunos casos la descontaminacioacuten del medio y su
recuperacioacuten pueden durar antildeos
Por tanto los estudios de optimizacioacuten en los que se combinen todos los factores
posibles considerando los efectos sineacutergicos y antagoacutenicos son esenciales en
biorremediacioacuten Entre los factores ambientales maacutes estudiados en la literatura destacamos
temperatura pH tipo y concentracioacuten de nutrientes inorgaacutenicos y fuentes de carbono
Temperatura y pH
La temperatura es una de las variables maacutes influyentes en el proceso de biodegradacioacuten
bacteriana ya que afecta tanto a las propiedades fisicoquiacutemicas de los HAP como al
Resumen Antecedentes
17
metabolismo microbiano La temperatura guarda una relacioacuten proporcional con los rangos
de difusioacuten y solubilidad de los HAP e inversamente proporcional con el coeficiente de
particioacuten suelo-agua (Wu amp Gschwend 1986) Mientras que el coeficiente de particioacuten de los
HAP decrece entre un 20-30 por cada incremento de 10ordmC en temperaturas comprendidas
entre los 5 ordmC - 45 ordmC el coeficiente de difusioacuten en agua aumenta entre 4-5 veces con un
incremento de la temperatura de 20 a 120 ordmC Esto se traduce en que cuanto menor es la
temperatura menor es la solubilidad de los HAP en la fase acuosa y consecuentemente
menor es su biodisponibilidad para ser mineralizados por los microorganismos (Haritash amp
Kaushik 2009)
Por otro lado las bajas temperaturas afectan negativamente al metabolismo
microbiano ralentizaacutendolo y aumentando la duracioacuten de la fase de latencia en la que hay
inactividad (Atlas amp Bartha 1972 Eriksson et al 2001) Tal y como se ha demostrado en
estudios previos (Leahy amp Colwell 1990) la velocidad de metabolizacioacuten normalmente se
duplica por cada aumento de 10 ordmC en temperaturas comprendidas entre los 10 y 40 ordmC Sin
embargo y a pesar de las desventajas que las bajas temperaturas presentan para la
biodegradacioacuten existe degradacioacuten de hidrocarburos en ambientes friacuteos cuyas temperaturas
oscilan entre los 0 ordmC ndash 10 ordmC (Margesin et al 2002) Algunos trabajos se han centrado en el
estudio de la biodegradacioacuten en zonas de agua marina y suelos bajo temperaturas
extremadamente bajas (Colwell et al 1978 Mohn amp Stewart 2000 Ericksson et al 2001
Delille amp Pelletiere 2002) obteniendo resultados positivos Sin embargo la mayoriacutea de los
estudios de biodegradacioacuten se han llevado a cabo en condiciones de laboratorio en un rango
de temperaturas comprendido entre los 20 ndash 35 ordmC sin observar a penas diferencias en las
tasas de biodegradacioacuten (Chen et al 2008) Por debajo de estas temperaturas la
degradacioacuten es maacutes complicada porque el metabolismo de los microorganismos se ralentiza
y la solubilizacioacuten de los HAP disminuye Aun asiacute hay bacterias adaptadas a estas
condiciones que hacen posible la degradacioacuten en ambientes con temperaturas extremas
Varias especies de Pseudomonas y Sphingomonas se han identificado como bacterias
degradadoras de HAP en la Antaacutertida (Aislabie et al 2000) Eacutestas y otras especies estaacuten
adaptadas a las temperaturas locales y a otras condiciones de estreacutes ya que durante el
deshielo sobreviven en suelos friacuteos y secos pobres en nutrientes y a menudo alcalinos Sin
embargo la capacidad de estas bacterias para crecer en suelos con condiciones climaacuteticas
suaves y la utilizacioacuten de HAP para su crecimiento implica que estas bacterias son
psicrotolerantes (Aislabie et al 2000) cuya temperatura oacuteptima es superior a los 20 ordmC pero
son capaces de sobrevivir cerca o por debajo de los 0 ordmC Ademaacutes existen algunas especies
cuyo crecimiento se desarrolla en ambientes que permanentemente esteacuten por debajo de los
5 ordmC este grupo de bacterias son psicroacutefilas La temperatura es un factor que difiacutecilmente se
puede controlar o manipular en proyectos de aplicacioacuten in situ por lo que es importante
Resumen Antecedentes
18
elaborar un estudio previo bajo las condiciones del ecosistema afectado Esto es
fundamental sobre todo en ambientes con temperaturas bajas en los que se puede estudiar
queacute otros factores modificar para suplir las desventajas de la temperatura como puede ser
inocular cepas bacterianas adaptadas a las bajas temperaturas aumentar el oxiacutegeno o
adicionar nutrientes En estas condiciones no toda la comunidad tiene por queacute ser eficaz en
la degradacioacuten de un contaminante aunque se ha propuesto que las bacterias y no los
hongos son las mayores colonizadoras y degradadoras (Kerry 1990) La identificacioacuten de
las especies de la poblacioacuten autoacutectona asiacute como la refrenciacioacuten de sus capacidades
metaboacutelicas son muy importantes en la biorremediacioacuten de suelos de ambientes friacuteos Esta
cuestioacuten es especialmente importante en la Antaacutertida ya que el Sistema del Tratado
Antaacutertico prohiacutebe la introduccioacuten de organismos aloacutectonos
Por otro lado el pH es un factor abioacutetico que de forma similar a la temperatura puede
afectar significativamente tanto a la actividad y diversidad microbiana como a la
mineralizacioacuten de los HAP Los rangos de pH oacuteptimos para el proceso de metabolizacioacuten
pueden ser muy variables ya que depende de las caracteriacutesticas del medio contaminado y
de la poblacioacuten microbiana que alberga (Dibble amp Bartha 1979) Las micobacterias son
bacterias neutroacutefilas cuyo pH oacuteptimo es superior 6 (Portaels amp Pattyn 1982) Sin embargo
a paritr de este pH se ha observado que la degradacioacuten de HAP por Mycobacterium es maacutes
eficaz cuando el pH tiende ligeramente a aacutecido (65) porque la membrana de aacutecidos
micoacutelicos es maacutes permeable a compuestos hidrofoacutebicos (Kim et al 2005) Otros autores
han mostrado que para otro tipo de bacterias comuacutenmente descritas en procesos de
biodegradacioacuten como Pseudomonas sp el rango oacuteptimo de pH oscila entre 55 y 78
notablemente mejor cuanto maacutes neutro (Dibble amp Bartha 1979) El uso de ciertos
surfactantes puede causar la basificacioacuten del medio (Bautista et al 2009) por lo que este
aspecto debe ser considerado a la hora de disentildear un proceso de biorremediacioacuten Tambieacuten
se pueden generar variaciones de pH durante el proceso como consecuencia de los
metabolitos intermedios derivados de los HAP Por ejemplo al comienzo de la degradacioacuten
se generan metabolitos con grupos hydroxiacutelicos que producen un aumento del pH (Habe amp
Omori 2003 Puntus et al 2008)
Nutrientes inorgaacutenicos
Ante una perturbacioacuten por un contaminante el requerimiento de nutrientes de las bacterias
degradadoras del ecosistema aumenta para poder metabolizar el aporte extra de carbono
que supone el contaminante Por este motivo en biorremediacioacuten es importante encontrar
una relacioacuten oacuteptima de carbononitroacutegenofoacutesforo (CNP) que tradicionalmente se han fijado
Resumen Antecedentes
19
en 100101 (ej Bouchez et al 1995) Sin embargo este aspecto es objeto de controversia
ya que otros autores (Leys et al 2005) han demostrado que la relacioacuten anteriormente
propuesta como oacuteptima puede ser insuficiente limitando el crecimiento bacteriano y por
tanto ralentizando la biodegradacioacuten La bioestimulacioacuten es una teacutecnica de biorremediacioacuten
que consiste en la adicioacuten de nutrientes inorgaacutenicos a los substratos contaminados La
disponibilidad de nutrientes es un aspecto muy importante en la eficacia de la
biodegradacioacuten Nutrientes como el nitroacutegeno el foacutesforo o el hierro son esenciales para el
metabolismo bacteriano en general y mucho maacutes en el caso de biorremediacioacuten de medios
contaminados por HAP Aunque la mayoriacutea de los trabajos indican que la adicioacuten de
nutrientes mejora el proceso algunos autores (Yu et al 2005) obtuvieron resultados
opuestos La diferencia entre unos resultados y otros radican en que la necesidad de
nutrientes depende del tipo de bacteria tipo de hidrocarburo y de las condiciones del medio
(Leys et al 2005) El hierro es un nutriente esencial necesario en el proceso de
biodegradacioacuten ya que por un lado es cofactor de las enzimas que catalizan la oxidacioacuten de
los HAP y por otro se ha relacionado con la produccioacuten de biosurfactantes para potenciar la
solubilidad de los HAP (Wei et al 2003) Sin embargo determinar la proporcioacuten oacuteptima de
este nutriente es fundamental pues altas concentraciones pueden ser toacutexicas (Santos et al
2008) Es tambieacuten una cuestioacuten a considerar la forma en la que se adicionan o se
encuentran los nutrientes en el medio ya que condiciona su biodisponibilidad Asiacute algunos
autores (Schlessinger 1991) proponen que las formas oxidadas como nitratos son maacutes
solubles que las formas reducidas como amonio que ademaacutes tiene propiedades
adsorbentes Establecer si un determinado problema medioambiental requiere un aporte
exoacutegeno de nutrientes es por tanto una cuestioacuten a discutir que probablemente dependa de
otras variables bioacuteticas y abioacuteticas
Fuentes de carbono laacutebiles
La adicioacuten a un medio contaminado de otras fuentes de carbono faacutecilmente biodegradables
se considera una alternativa que puede favorecer la biodegradacioacuten porque aumenta la
biomasa de la poblacioacuten microbiana y por tanto de la poblacioacuten degradadora Realmente se
puede entender como una forma de bioestimulacioacuten enfocada a aumentar y estimular el
crecimiento bacteriano o su actividad y por consiguiente la degradacioacuten Algunas de las
sustancias tratadas con este fin son el piruvato que estimula el crecimiento de ciertas cepas
bacterianas o el salicilato que induce la activacioacuten de enzimas degradadoras En el caso de
la glucosa su raacutepida asimilacioacuten y aumento de biomasa asociado se podriacutea traducir en un
aumento de la biodegradacioacuten (Ye et al 1996) Lee et al (2003) propusieron y
comprobaron que el piruvato potenciaba el crecimiento de la cepa degradadora
Resumen Antecedentes
20
Pseudomonas putida lo que se tradujo en un aumento de la tasa de biodegradacioacuten de
naftaleno Chen amp Aitken (1999) han comprobado que el salicilato induce la siacutentesis de
enzimas cataboacutelicas y por tanto su adicioacuten favorece la metabolizacioacuten de HAP siempre
que su concentracioacuten en el medio no supere una concentracioacuten liacutemite inhibitoria Wong et al
(2000) observoacute que la adicioacuten de glucosa favoreciacutea el crecimiento total de la poblacioacuten pero
las tasas de biodegradacioacuten fueron significativamente menores Estos resultados se deben
a que la cepa o consorcio degradador es capaz de mineralizar un HAP como uacutenica fuente de
carbono y la asimilacioacuten de glucosa inhibe la siacutentesis de enzimas implicadas en la
degradacioacuten del contaminante Es necesario valorar en cada caso de estudio coacutemo afecta la
adicioacuten de una nueva fuente de carbono ya que en el caso de bacterias no pre-adaptadas a
degradar HAP es posible que sus efectos sean positivos (Wong et al 2000) pero en
poblaciones microbianas histoacutericamente adaptadas a substratos contaminados la adicioacuten de
glucosa puede favorecer el crecimiento de microorganismos heteroacutetrofos no degradadores
Importancia y efecto de los surfactantes en la biodegradacioacuten de HAP
La baja solubilidad de los HAP y de la mayoriacutea de los compuestos del petroacuteleo limita la
capacidad de los microorganismos para acceder y degradar los compuestos contaminantes
Los surfactantes son tensioactivos que actuacutean disminuyendo la tensioacuten superficial del agua
para facilitar la disolucioacuten de los HAP en la fase acuosa En algunos estudios (Bautista et al
2009) se ha demostrado que el uso de surfactantes en procesos de biodegradacioacuten es
necesario para solubilizar los HAP Muchas bacterias degradadoras de HAP han
desarrollado la capacidad de generar biosurfactantes (surfactantes de origen microbiano)
como parte de su superficie celular o como moleacuteculas liberadas extracelularmente (Fiechter
1992) Algunas de estas especies pertenecen a los geacuteneros Pseudomonas (P aeruginosa
P fluorescens) Rhodococcus Mycobacterium Lactobacillus Acinetobacter o
Sphingomonas Los biosurfactantes se clasifican en funcioacuten de su masa molecular en
biosurfactantes de bajo peso molecular como glicoliacutepidos o lipopeacuteptidos y de alto peso
molecular que incluyen moleacuteculas maacutes complejas como polisacaacuteridos anfipaacuteticos proteiacutenas
lipopolisacaacuteridos y lipoproteiacutenas Se han observado resultados muy contradictorios en
cuanto a sus efectos sobre las tasas de biodegradacioacuten por un lado positivos (Jing et al
2007) pero tambieacuten inhibitorios (Laha amp Luthy 1991) Los biosurfactantes de alto peso
molecular son eficaces en la estabilizacioacuten de emulsiones de aceite en agua mientras que
los de bajo peso molecular son maacutes eficaces en la disminucioacuten de la tensioacuten interficial y
superficial (Rosenberg amp Ron 1999) En el caso de los surfactantes sinteacuteticos su eficacia
estaacute determinada por sus propiedades de carga (no ioacutenicos anioacutenicos o catioacutenicos) su
balance hidrofiacutelico-lipofiacutelico y su concentracioacuten micelar criacutetica (CMC) concentracioacuten a la cual
Resumen Antecedentes
21
la tensioacuten superficial es miacutenima y los monoacutemeros de surfactante se agregan formando
micelas Sin embargo algunos surfactantes pueden inhibir la mineralizacioacuten de los HAP por
cuestiones como la toxicidad del medio derivada de una elevada concentracioacuten de
surfactantes la cual resulta toacutexica para los microorganismos (ej Tergitol NP-10) o porque
al solubilizarse los HAP por accioacuten del surfactante aumenta toxicidad del medio (Liu et al
2001) En algunos casos ademaacutes los surfactantes no son biodegradables (Bautista et al
2009) De hecho Bautista et al (2009) comprobaron que el surfactante no ioacutenico Tergitol
NP-10 es un surfactante no biodegradable y toacutexico para los microorganismos en
comparacioacuten con el Tween-80 Dada la amplia variabilidad de resultados referentes a los
surfactantes es importante la eleccioacuten correcta en cada proceso considerando el tipo de
contaminante a eliminar y los microorganismos presentes en el medio
Biodegradacioacuten bacteriana cepas y consorcios microbianos degradadores de HAP
Son muchas las especies bacterianas descritas con capacidad degradadora de HAP la
mayoriacutea de ellas aisladas de aguas sedimentos y suelos previamente contaminados con
hidrocarburos La biodegradacioacuten de HAP de bajo peso molecular como el naftaleno
fenantreno y antraceno ha sido ampliamente estudiada Sin embargo son escasos los
estudios realizados sobre la biodegradacioacuten de HAP de alto peso molecular como el pireno
perileno acenafteno o fluoreno (Kanaly amp Harayama 2000) De acuerdo con Chauhan et al
(2008) especies de Pseudomonas y Ralstonia se relacionan en mayor medida con la
degradacioacuten de naftaleno y fenantreno Burkolderia y Stenotrophomonas con naftaleno
fenantreno y antraceno y otras especies pertenecientes a los geacuteneros Rhodococcus
Sphingomonas y Mycobacterium con HAP de mayor peso molecular como fluoranteno
benzo[a]pireno pireno benzo[b]fluoranteno Las especies bacterianas degradadoras
pertenecen a grupos filogeneacuteticos muy diversos y en muchos casos taxonoacutemicamente
alejados Trabajos previos (Vintildeas et al 2005 Molina et al 2009 Gonzaacutelez et al 2011)
muestran una gran parte de las bacterias degradadoras pertenecen al phylum
Proteobacteria en mayor proporcioacuten a las clases α- Proteobacteria (Sphingomonas
Bradyrizobium Nitrobacteria Balneimonas) y γ- (Pseudomonas Stenotrhophomonas
Enterobacter Pantoea Acinetobacter o Psychrobacter) Tambieacuten se han aislado especies
pertenecientes a la clase β- Proteobacterias (Ralstonia) y a los phylum Actinobacteria
(Microbacterium sp Rhodococcus sp) Firmicutes (Bacillus subtillis) y Bacteroidetes
(Flexibacter) aunque eacutestas en menor frecuencia Muchos de los trabajos de degradacioacuten
bacteriana se han realizado con cepas individuales (Grimberg et al 1996 Das amp Mukherjee
2006) extraiacutedas de suelos contaminados o bien con consorcios artificiales formados por
varias cepas degradadoras (Ghazali et al 2004) siendo muy pocos aquellos en los que se
Resumen Antecedentes
22
ha utilizado un consorcio bacteriano natural extraiacutedo directamente de un suelo Bautista et al
(2009) sentildeala que la capacidad de degradacioacuten de un consorcio artificial es mayor que la de
las cepas individuales Seguacuten algunos autores (Fritsche 1985 Mueller et al 1997) la mejor
eficiencia de degradacioacuten de un consorcio es debido a que la diversidad de especies permite
que cada una tenga un papel en el proceso de biodegradacioacuten facilitando la degradacioacuten de
HAP gracias al cometabolismo establecido entre las especies implicadas
Existe una importante controversia referente a la capacidad degradadora que
presentan los consorcios naturales ya que se ha observado que ciertos consorcios
extraiacutedos de zonas no contaminadas con HAP son capaces de metabolizar dichos
compuestos (Tian et al 2008 Couling et al 2010) Seguacuten estos autores es una
caracteriacutestica general presente en algunas comunidades microbianas que se expresa ante
una determinada perturbacioacuten Sin embargo Barkay amp Pritchart (1988) exponen que es una
caracteriacutestica que soacutelo estaacute presente en comunidades previamente expuestas y por lo tanto
preadaptadas como consecuencia de presiones selectivas Algunos autores (Jhonsen et al
2005) subrayan que la capacidad cataboacutelica se propaga faacutecilmente entre bacterias de un
mismo suelo contaminado como resultado de la transferencia horizontal de genes (ej
conjugacioacuten y transformacioacuten) Esto facilitariacutea auacuten maacutes que una comunidad no preadaptada
pueda hacer frente a una perturbacioacuten
Teacutecnicas de biorremediacioacuten
El objetivo uacuteltimo de la biorremediacioacuten es que el proceso de biodegradacioacuten se desarrolle
de la forma maacutes eficaz posible y por eso muchos trabajos se centran en la optimizacioacuten del
proceso mediante el desarrollo de teacutecnicas que aumenten la eficacia del mismo Teacutecnicas
como la bioestimulacioacuten anteriormente mencionada se centran en aumentar la capacidad
degradadora de la comunidad autoacutectona bacteriana mediante la adicioacuten de nutrientes
(nitroacutegeno foacutesforo potasio) de forma que la falta de nutrientes no suponga una limitacioacuten
para el metabolismo microbiano y por consiguiente para la biorecuperacioacuten de la zona
perturbada Otras teacutecnicas se basan en el aumento de la poblacioacuten degradadora mediante la
adicioacuten de cepas o consorcios con capacidad reconocida para metabolizar un determinado
compuesto es lo que se conoce como bioaumento En algunos trabajos los resultados
derivados de la bioestimulacioacuten y el bioaumento han sido positivos (Mills et al 2004
Atagana 2006) pero en trabajos como Chen et al (2008) o Yu et al (2005) los efectos de
ambas teacutecnicas en el proceso fueron negativos o simplemente no tuvieron efecto Se tiene
que tener en cuenta que ambas teacutecnicas generan cambios en las comunidades autoacutectonas
que afectan y modifican las relaciones de competencia Estos cambios pueden ser auacuten maacutes
Resumen Antecedentes
23
acusados en el caso del bioaumento pues la introduccioacuten de una comunidad foraacutenea puede
tener resultados difiacuteciles de predecir La atenuacioacuten natural es otra teacutecnica basada en la
mera actuacioacuten de la comunidad autoacutectona sin ninguacuten tipo de modificacioacuten de la comunidad
yo adicioacuten de sustancias Dowty et al (2001) entre otros defiende que cuando se trata de
restablecer el medio a las condiciones originales preservando la biodiversidad la
atenuacioacuten microbiana puede ser la mejor opcioacuten siempre que las poblaciones autoacutectonas
presenten capacidad degradadora
Resumen Objetivos
25
Objetivos
El objetivo general de la tesis es el conocimiento profundo de la biodegradacioacuten bacteriana
de hidrocarburos aromaacuteticos policiacuteclicos para la biorremediacioacuten y recuperacioacuten de medios
contaminados con estos compuestos toacutexicos El proyecto se ha centrado en la identificacioacuten
y conocimiento de la poblacioacuten bacteriana de consorcios procedentes de ambientes
(contaminados o no) y de su dinaacutemica ante determinadas condiciones durante el proceso de
biodegradacioacuten Para alcanzar este objetivo principal se fijaron objetivos especiacuteficos
desarrollados en cuatro capiacutetulos
1 Estudiar los factores abioacuteticos a fin de optimizar las condiciones de desarrollo en el
proceso de biodegradacioacuten de HAP en cultivos liacutequidos (capiacutetulo 1a) En un segundo
proyecto de optimizacioacuten el objetivo fue asemejar el proceso en laboratorio lo maacutes
posible a las condiciones naturales considerando los efectos derivados de la
interaccioacuten muacuteltiple de factores ambientales y bioloacutegicos (capiacutetulo 1b)
2 Analizar el efecto de la aplicacioacuten de distintos tipos de surfactantes (no ioacutenicos
biodegradables y no biodegradables) en la eficacia de degradacioacuten de HAP de un
consorcio bacteriano previamente adaptado (C2PL05) Asiacute mismo se quiso estudiar el
efecto del tipo de surfactante en la sucesioacuten y dinaacutemica del consorcio identificando los
microorganismos implicados a lo largo del proceso (capiacutetulo 2)
3 Estimar la capacidad degradadora de microcosmos inoculados con consorcios
procedentes de suelos con distinta historia de contaminacioacuten suelo croacutenicamente
contaminado (C2PL05) frente a un suelo procedente de un ambiente libre de
contaminacioacuten (BOS08) bajo condiciones climaacuteticas suaves y extremas Describir y
comparar las comunidades bacterianas que componen ambos consorcios (capiacutetulo 3)
4 Evaluar la eficacia de diversas teacutecnicas de biorremediacioacuten (atenuacioacuten natural
bioestimulacioacuten yo bioaumento) tanto en la eliminacioacuten del contaminante y la
toxicidad como en la capacidad de recuperacioacuten del ecosistema (capiacutetulo 4) Para el
desarrollo de este objetivo se llevoacute a cabo una simulacioacuten a pequentildea escala
(microcosmos) de un proceso de biorremediacioacuten in situ de suelos naturales
contaminados con creosota
Resumen Listado de manuscritos
27
Listado de manuscritos
Los capiacutetulos que integran este proyecto doctoral han sido redactados en ingleacutes para su
publicacioacuten en revistas cientiacuteficas de aacutembito internacional Por ello se presentan los
manuscritos originales de dichos artiacuteculos A continuacioacuten se detalla la traduccioacuten del tiacutetulo
los nombres de los coautores y el estado de publicacioacuten de los manuscritos
Capiacutetulo 1a Simarro R Gonzaacutelez N Bautista LF Sanz R y Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium
Water Air and Soil Pollution (2011) 217 365-374
Capiacutetulo 1b Simarro R Gonzaacutelez N Bautista LF y Molina MC
Evaluation of the influence of multiple environmental factors on the
biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial
consortium using an orthogonal experimental design
Water Air and Soil Pollution (Aceptado febrero 2012)
Capiacutetulo 2 Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L y Villa
JA
Effect of surfactants on PAH biodegradation by a bacterial consortium and
on the dynamics of the bacterial community during the process
Bioresource Technology (2011) 102 9438-9446
Capiacutetulo 3 - Simarro R Gonzaacutelez N Bautista LF y Molina MC
High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures
FEMS Microbiology Ecology (Subscrito Diciembre 2011 En revisioacuten)
Resumen Listado de manuscritos
28
Capiacutetulo 4 - Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez L y Peacuterez
M
Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil
change in bacterial community
Manuscrito ineacutedito
Resumen Siacutentesis de capiacutetulos
29
Siacutentesis de capiacutetulos
La presente tesis doctoral se desarrolla dentro de un proyecto de investigacioacuten basado en la
biorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicos y
sustancias contaminantes que los contengan Este proyecto se esta llevando a cabo desde
hace seis antildeos por el grupo de Biorremediacioacuten del Departamento de Biologiacutea y Geologiacutea de
la Universidad Rey Juan Carlos Los artiacuteculos citados anteriormente componen los cuatro
capiacutetulos que se desarrollan en el cuerpo de la tesis
Anteriormente al desarrollo de los experimentos que componen los capiacutetuos de la
presente tesis se realizoacute un trabajo (Molina et al 2009) en el que se estudioacute la capacidad
de degradacioacuten de un consorcio bacteriano extraiacutedo de un suelo croacutenicamente contaminado
y se describioacute su poblacioacuten bacteriana mediante teacutecnicas dependientes e independientes de
cultivo El consorcio fue capaz de degradar los HAP (naftaleno fenantreno y antraceno) en
maacutes de un 98 en un periodo de 18 diacuteas y ademaacutes eliminoacute completamente la toxicidad del
medio en 41 diacuteas La identificacioacuten molecular permitioacute aislar e identificar 5 cepas bacteriana
(DIC-1 a DIC-6 DIC Degrading isolated Culture) todas γ-Proteobacterias pertenecientes a
los geacuteneros Enterobacter Pseudomonas y Stenotrophomonas (maacutes detalles en Molina et al
2009) Ademaacutes el anaacutelisis de la poblacioacuten mediante electroforesis en un gel con gradiente
desnaturalizante (DGGE Denaturing Gradient Gel Electrophoresis) confirmoacute que estos tres
geacuteneros eran dominantes La alta eficacia en la degradacioacuten de los HAP y la escasa
biodiversidad tiacutepica de suelos sometidos a elevadas concentraciones de contaminantes
durante largos peridos de tiempo indican que el consorcio C2PL05 estaacute totalmente
adaptado a la degradacioacuten de HAP
En el capiacutetulo 1 se optimizoacute el proceso de biodegradacioacuten a traveacutes de dos disentildeos
experimentales diferentes que se recogen en los subcapiacutetulos 1a y 1b En el capiacutetulo 1a
se evaluacutea y mejora la influencia de varios factores ambientales como la relacioacuten molar de
CNP la fuente de nitroacutegeno fuente y concentracioacuten de hierro pH y fuente de carbono El
anaacutelisis estadiacutestico de las tasas de degradacioacuten (Kb) y los incrementos de la densidad celular
indicoacute que todos los factores fueron significativamente influyentes en la Kb Esto permitioacute
establecer un valor oacuteptimo de estos factores y descartar en los siguientes ensayos aquellos
paraacutemetros como el pH cuyo valor oacuteptimo (pH 7) seguacuten nuestros resultados coincidiacutea con
otros estudios y estaba claramente definido en la bibliografiacutea A partir de los resultados de
esta primera parte se realizoacute un segundo ensayo de optimizacioacuten ortogonal multifactorial
(capiacutetulo 1b) que permitioacute la optimizacioacuten de 8 factores de forma conjunta La concentracioacuten
de surfactante y de inoacuteculo bacteriano son dos factores que no fueron incluiacutedos en el
anterior anaacutelisis pero a traveacutes de la bibliografiacutea se consideraron factores importantes en la
Resumen Siacutentesis de capiacutetulos
30
biodegradacioacuten de HAP Los resultados confirmaron que la temperatura la fuente de
carbono y la concentracioacuten de inoacuteculo fueron factores significativos en el incremento de la
densidad celular pero soacutelo la fuente de carbono influyoacute significativamente el porcentaje total
de degrad acioacuten Estos resultados (capiacutetulo 1) permitieron conocer cuaacuteles son las
condiciones oacuteptimas del cultivo para una degradacioacuten maacutes eficaz de HAP con el consorcio
bacteriano C2PL05
El uso de surfactantes en la biodegradacioacuten de HAP puede optimizar la eficacia del
proceso y en algunos casos su uso es imprescindible Sin embargo su utilizacioacuten implica
un elevado coste y en ocasiones pueden tener efectos negativos dependiendo de la
concentracioacuten y tipo de surfactante En el capiacutetulo 2 se evaluacutea el efecto de dos
surfactantes no ioacutenicos Tergitol NP-10 (no biodegradable) y Tween-80 (biodegradable) en
la capacidad degradadora del consorcio microbiano C2PL05 teniendo en cuenta la
velocidad de degradacioacuten de los HAP y la dinaacutemica de la poblacioacuten microbiana durante el
proceso (teacutecnicas cultivo-dependientes e independientes) La degradacioacuten bacteriana de
los HAP y la reduccioacuten de la toxicidad del medio fue significativamente mejor con el
surfactante no ioacutenico y biodegradable Tween-80 Ademaacutes el tipo de surfactante utilizado
para optimizar la biodegradacioacuten de HAP afectoacute significativamente a la dinaacutemica de la
comunidad bacteriana del consorcio siendo especies pertenecientes a los geacuteneros
Pseudomonas Sphingomonas Sphingobium y Agromonas responsables de estas
diferencias Teoacutericamente la uacutenica funcioacuten del surfactante en el proceso de
biodegradacioacuten es aumentar la solubilidad de los HAP pero sin embargo en este capiacutetulo
se ha puesto de manifiesto que modifican notablemente las poblaciones bacterianas y la
sucesioacuten de especies pudiendo afectar a la eficacia del proceso Un estudio previo que
desemboque en la eleccioacuten del surfactante maacutes adecuado asiacute como su concentracioacuten
favorece la efiacacia de la biorremediacioacuten
El capiacutetulo 3 se centra en el estudio de la capacidad degradadora de los
microorganismos El principal objetivo es comprobar si la capacidad de degradacioacuten se
adquiere necesariamente tras un periodo de exposicioacuten a un contaminante o si bien es una
caracteriacutestica intriacutensecamente presente en algunas bacterias Se considera que la
temperatura es uno de los factores maacutes influyentes en el proceso de biodegradacioacuten de
manera que a temperaturas friacuteas (lt15 ordmC) o extremas (lt5 ordmC) se dificulta el proceso porque
afecta a la solubilidad de los HAP y al metabolismo microbiano Sin embargo existen
especies que toleran o estaacuten adaptadas a las bajas temperaturas y que ademaacutes pueden
degradar HAP En este capiacutetulo se avaluoacute la capacidad degradadora de un consorcio
preadaptado a HAP (C2PL05) frente a un consorcio extraiacutedo de una zona priacutestina rica en
madera en descomposicioacuten (BOS08) Al mismo tiempo se simularon dos ambientes de
Resumen Siacutentesis de capiacutetulos
31
biodegradacioacuten uno a temperaturas suaves comprendidas entre los 15 ordmC-25 ordmC y otro maacutes
extremo con temperaturas entre los 5 ordmC-15 ordmC todo ello en un sustrato soacutelido (suelo) con
objeto de ajustarnos a las condiciones naturales Sin duda el resultado maacutes significativo fue
que el consorcio BOS08 no adaptado a la degradacioacuten de HAP fue capaz de degradar
eficazmente e incluso mejor que el consorcio C2PL05 cuando las temperaturas fueron bajas
Ademaacutes se observoacute que aunque hubo geacuteneros exclusivos de cada consorcio (Ralstonia
Bacillus) otros fueron comunes en ambos (Microbacterium Acinetobacter Pseudomonas)
Los resultados obtenidos confirman la hipoacutetesis de que la capacidad de degradacioacuten estaacute
presente de forma intriacutenseca en algunas especies y no depende de una pre-exposicioacuten al
contaminante
En la biorremediacioacuten de un suelo contaminado con HAP es muy importante tener en
cuenta la respuesta de la poblacioacuten bacteriana autoacutectona del suelo frente a un episodio de
contaminacioacuten En el capiacutetulo 4 se estudioacute el comportamiento de la comunidad bacteriana
de un suelo previamente no contaminado cuando es perturbado con creosota La
biorremediacioacuten in situ es un proceso maacutes complejo que cuando se estudia bajo condiciones
controladas de laboratorio ya que hay factores como la escasez de nutrientes o las bajas
temperaturas que dificultan el proceso (capiacutetulos 1 y 3) Sin embargo la aplicacioacuten de
tratamientos in situ como la bioestimulacioacuten o el bioaumento pueden mejorar la eficacia de la
biorremediacioacuten En este capiacutetulo se determinoacute la respuesta de la comunidad bacteriana
frente a la bioestimulacioacuten el bioaumento o a la atenuacioacuten natural evaluando el porcentaje
de degradacioacuten de creosota y los HAP que la componen la reduccioacuten de la toxicidad y al
mismo tiempo estudiando los cambios poblacionales El criterio para la eleccioacuten de la
teacutecnica maacutes eficaz se determinoacute en funcioacuten de la eficacia en la degradacioacuten y en la
reduccioacuten de la toxicidad Los resultados mostraron que aunque la creosota se redujo
considerablemente y sin diferencias significativas entre tratamientos la toxicidad del medio
permanecioacute alta durante todo el proceso La ausencia de diferencias significativas entre
tratamientos en cuanto a la eliminacioacuten de creosta se refiere indica que la comunidad
autoacutectona del suelo tiene mcroorgasnimos con capacidad degradadora aunque previamente
no hayan estado expuestos a HAP Las bajas temperaturas a las que se desarrolloacute el
experimento fue la causa de que la toxicidad del medio no se redujera Cabe destacar la
importancia de las identificaciones mediante teacutecnicas no cultivables de especies
pertenecientes a los geacuteneros Balneimonas y Pantoea previamente no descritas en procesos
de biodegradacioacuten de creosota o HAP
Resumen Metodologiacutea general
33
Metodologiacutea general
Todos los materiales y meacutetodos estaacuten descritos y con sus respectivas refrencias en cada
uno de los capiacutetulos que se indican a continuacioacuten Sin embargo en algunos casos y dado
que la publicacioacuten de los datos en muchos casos obliga a ajustarse a los formatos de cada
revista especializada algunos meacutetodos no se han explicado en detalle en los capiacutetulos Este
apartado ldquoMetodologiacutea generalrdquo tiene como objetivo profundizar en el fundamento de
algunos de los meacutetodos utilizados durante el desarrollo de este proyecto
Preparacioacuten de consorcios bacterianos
El consorcio bacteriano C2PL05 fue utilizado en los experimentos de los capiacutetulos que
componen esta tesis como consorcio degradador de HAP Este consorcio fue extraiacutedo de un
suelo croacutenicamente contaminado con HAP (Figura 2A) de una refineriacutea de petroacuteleo situada
en Puertollano Ciudad Real (Espantildea) Su capacidad degradadora se verificoacute en un cultivo
semicontinuo en matraces Erlenmeyer de 100 ml que conteniacutean 50 ml BHB con Tween-80
(1 vv) y naftaleno fenantreno (05 gmiddotlminus1) y antraceno (005 gmiddotlminus1) realizando refrescos del
medio cada 15 diacuteas
Cuando se indique (capiacutetulo 3) se preparoacute un consorcio de un suelo procedente de un
bosque (43ordm 4175acuteN 8ordm 0683acuteO Frgas do Eume Galicia Espantildea Figura 2B) totalmente
libre de contaminacioacuten por HAP al que se denominoacute BOS08 El suelo se obtuvo de la parte
maacutes superficial por lo que teniacutea un alto contenido en materia orgaacutenica y restos de madera
muerta
Figura 2 Suelo contaminado procedente de la refineriacutea (A) y suelo
procedente de bosque (B) de los cuales se extrajeron los consorcios
C2PL05 y BOS08 respectivamente
A B
Resumen Metodologiacutea general
34
Para la extraccioacuten de ambos consorcios bacterianos 1 g de suelo se resuspendioacute en
10 ml de solucioacuten salina PBS (pH 70) y se mantuvo en agitacioacuten constante a 150 rpm en
oscuridad y a 25ordmC durante 24 horas Posteriormente se formoacute un cultivo madre de cada
consorcio en 50 ml de BHB con la mezcla de HAP que se fuera a utilizar en el experimento
tween-80 (1 vv) como surfactante y 15 ml del extracto de cada consorcio Los cultivos se
incubaron en un agitador orbital a 150 rpm y 25ordmC hasta que alcanzara la fase exponencial
En este momento se inoculaba la cantidad de cultivo madre necesario en los microcosmos
de los experimentos en funcioacuten de la concentracioacuten de inoacuteculo deseada en los mismos
Disentildeos experimentales
En este apartado se explica el disentildeo y la composicioacuten de los experimentos que conforman
los capiacutetulos de esta tesis para facilitar su comprensioacuten Generalizando los capiacutetulos 1 (1a y
1b) y 2 tratan de optimizar el medio nutritivo suministrado al consorcio C2PL05 el tipo y
concentracioacuten de surfactante y otros factores ambientales para lo cual los microcosmos
eran cultivos liacutequidos incubados en Erlenmeyers en un agitador orbital Los capiacutetulos 3 y 4
se centran en el estudio de la biodegradacioacuten de HAP en sustrato soacutelido (arena de riacuteo y
suelo natural respectivamente) para reproducir en la medida de los posible las condiciones
naturales
En el capiacutetulo 1a se optimizaron 6 factores (3 posibles valores cada factor) de forma
individual y consecutiva En total se desarrollaron 18 tratamientos en cultivos liacutequidos (3
reacuteplicas) incubados en un agitador orbital a 150 rpm 25 ordmC y oscuridad (Figura 3) durante
168 horas En el capiacutetulo 1b el disentildeo ortogonal L18 (37) (21) permitioacute mediante el desarrollo
de 18 tratamientos (3 reacuteplicas cada uno) la optimizacioacuten de 8 factores 7 de ellos con 3
posibles valores (37) y un factor con dos valores (21) Un total de 54 cultivos se incubaron
durante 159 horas en las mismas condiciones que en el capitulo 1a variando la temperatura
seguacuten las necesidades del tratamiento En la Figura 4 y 5 se muestran los disentildeos
experimentales correspondientes a los capiacutetulos 1a y 1b respectivamente
Resumen Metodologiacutea general
35
Figura 3 Cultivos liacutequidos incubados en un agitador orbital
Optimizacioacuten
CNP
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
100101
1002116
100505
Optimizacioacuten
fuente de N
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
NaNO3
NH4NO3
(NH4)2SO3
Optimizacioacuten
fuente de Fe
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
FeCl3
Fe(NO3)3
Fe2(SO4)3
Optimizacioacuten
[Fe]
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
005 mM
01 mM
02 mM
Optimizacioacuten
pH
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
50
70
80
Optimizacioacuten
fuente de C
BHB tween-80
C2PL05
Naftaleno fenantreno
antraceno y glucosa (20 80 100)
X 3
HAP
HAPglucosa (5050)
Glucosa
2ordm 3ordm
4ordm 5ordm 6ordm
Figure 4 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 1a
Resumen Metodologiacutea general
36
Tordf
Optimizacioacuten CNP
OptimizacioacutenFuente N
OptimizacioacutenFuente Fe
Optimizacioacuten[Fe]
Optimizacioacuten[Tween-80]
Optimizacioacutendilucioacuten inoacuteculo
Optimizacioacutenfuente de C
20ordmC25ordmC30ordmC
1001011002116100505
NaNO3
NH4NO3
(NH4)2SO3
FeCl3Fe(NO3)3
Fe2(SO4)3
005 mM01 mM02 mM
CMC20 CMC
10-1
10-2
10-3
0100505020100
18 tratamientos
X 3
C2PL05Antraceno dibenzofurano pireno
BHB (modificado seguacuten tratamiento)
Figura 5 Disentildeo experimental correspondiente a al experimento que conforma el capiacutetulo 1b
En el capiacutetulo 2 se estudioacute la capacidad de degradacioacuten y la evolucioacuten del consorcio
C2PL05 en dos tratamientos (cada uno en triplicado) uno adicionado con Tween-80 y otro
con Tergitol NP-10 (1 vv) como surfactantes En total 6 cultivos liacutequidos se incubaron a
150 rpm 25 ordmC y oscuridad durante 45 diacuteas como se muestra en la Figura 3 El disentildeo
experimental de este capiacutetulo se resume graacuteficamente en la Figura 6
Tratamiento 1con Tween-80
Tratamiento 2con Tergitol NP-10
C2PL05BHB-Tergitol NP-10 (1)Naftaleno fenantreno antraceno
X 3
X 3
C2PL05BHB-Tween-80 (1)Naftaleno fenantreno antraceno
Figura 6 Disentildeo experimental correspondiente al experimento que conforma
el capiacutetulo 2
Resumen Metodologiacutea general
37
El capiacutetulo 3 se desarrolloacute en microcosmos con 90 g de arena de riacuteo esterilizada
(Figura 7) e incinerada en una mufla a 300 ordmC para eliminar cualquier tipo de
microorganismos o materia orgaacutenica que pudiera contener Se realizaron 4 tratamientos
distintos en funcioacuten de la temperatura de incubacioacuten (5-15 ordmC o 15-25 ordmC) y del consorcio
inoculado (C2PL05 o BOS08) cada tratamiento con tres reacuteplicas para cada uno de los 5
tiempos de muestreo lo que supuso un total de 60 microcosmos (Figura 8) Los nutrientes
se suministraron antildeadiendo 18 ml de medio BHB que proporcionaba una humedad relativa
del 60 y que ademaacutes conteniacutea Tween-80 (1 vv) Los microcosmos se inocularon con
35 ml de un cultivo madre del consorcio C2PL05 oacute BOS08 y se incubaron en caacutemaras bajo
condiciones controladas de temperatura (seguacuten tratamiento) humedad (60 constante) y
luz (16 horas de luz8 horas oscuridad)
Figura 7 Microcosmos del experimento para el capiacutetulo 3 en caacutemara de crecimiento
Resumen Metodologiacutea general
38
Tratamiento 1
Tratamiento 2
Tratamiento 3
Tratamiento 4
C2PL0515-25ordmCBHB oacuteptimoNaftaleno fenantreno antracenopireno y perileno
C2PL055-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS0815-25ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS085-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
X 3
X 3
X 3
X 3
X 5 tiempos
X 5 tiempos
X 5 tiempos
X 5 tiempos
TOTAL = 60 MICROCOSMOS
Figura 8 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 3
El experimento que compone el capiacutetulo 4 de biorremediacioacuten in situ se desarrolloacute
bajo condiciones ambientales externas en una zona del campus preparada para ello Como
sustrato se utilizoacute suelo natural extraiacutedo de los primeros 20 cm y tamizado con una maya lt
2 mm El sustrato se depositoacute en bandejas de plaacutestico para evitar que el agente
contaminante se filtrara al suelo y se protegioacute de la lluvia tal y como se observa en la Figura
9 Cada uno de los cinco tratamientos (control atenuacioacuten natural bioestimulacioacuten
bioaumento y bioestimulacioacuten junto con bioaumento) se hizo en duplicado para cada uno de
los 4 muestreos realizados durante los 8 meses de experimentacioacuten (octubre-junio) Cada
microcosmos (bandeja) conteniacutea 550 g de suelo humedecidos (40) con agua o BHB como
fuente de nutrientes en el caso de los tratamientos con bioestimulacioacuten Los tratamientos
bioaumentados se enriquecieron con 5 ml de un cultivo madre del consorcio C2PL05 Como
agente contaminante se utilizoacute creosota antildeadiendo 25 ml de una disolucioacuten de creosota en
Resumen Metodologiacutea general
39
n-hexano (25 g creosota por bandeja) a todos los tratamientos excepto al control Resumen
del disentildeo en la Figura 10
Figura 9 Experimento para el capiacutetulo 4 bajo condiciones ambientales
externas en el Campus de la Universidad Rey Juan Carlos Moacutestoles
Tratamiento 1 Control
Tratamiento 2 Atenuacioacuten
natural
Tratamiento 3 Bioestimulacioacuten
Tratamiento 4 Bioaumento
Tratamiento 5 Bioestimulacioacuten
y Bioaumento
Suelo sin contaminar X 4 tiempos
CreosotaH2O-Tween-80 X 4 tiempos
CreosotaBHB oacuteptimo-Tween-80 X 4 tiempos
CreosotaH20 ndash Tween-80 X 4 tiemposC2PL05
CreosotaBHB oacuteptimo-Tween-80 X 4 tiemposC2PL05
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
TOTAL = 40 MICROCOSMOS
Figura 10 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 4
Resumen Metodologiacutea general
40
Anaacutelisis fiacutesico-quiacutemicos
La caracterizacioacuten del suelo contaminado del cual se extrajo el consorcio C2PL05 asiacute como
la explicacioacuten de las teacutecnicas y metodologiacuteas empleadas se detallan en Molina et al (2009)
No obstante en la Tabla 1 se presentan las propiedades fiacutesico-quiacutemicas de dicho suelo
contaminado
Tabla 1 Propiedades fisico-quiacutemicas y bioloacutegicas del suelo contaminado con HAP
Propiedades Unidades Media plusmn ES
Tamantildeo medio de partiacutecula μm3 291 plusmn 6 Composicioacuten (arenaslimosarcillas) v 291009000 plusmn 03603600
pH - 77 plusmn 01
Conductividad μSmiddotcm-1 74 plusmn 22
WHCa v 33 plusmn 7
(NO3)- μgmiddotKg-1 40 plusmn 37
(NO2)- μgmiddotKg-1 117 plusmn 01
(NH4)+ μgmiddotKg-1 155 plusmn 125
(PO4)3- μgmiddotKg-1 47 plusmn 6
Carbono total v 96 plusmn 21
TOCb (tratamiento aacutecido) v 51 plusmn 04
MPNc (heteroacutetrofos) x104 ceacutelulasmiddotg-1 97 plusmn 12
MPNc (degradador de HAP) x103 ceacutelulasmiddotg-1 93 plusmn 19
Toxicity EC50d gmiddot100ml-1 144 plusmn 80
Hidrocarburos extraiacutedos w 92 plusmn 18
a Capacidad de campo del agua (WHC Water holding capacity) maacutexima cantidad de agua que
puede contener un suelo b Carbono orgaacutenico total (TOC total organic carbon) c Nuacutemero maacutes
probable (MPN most probably number) teacutecnica cultivo-dependiente que estima el nuacutemero de
ceacutelulas capaces de crecer con una determinada fuente de carbono (ver apartado Anaacutelisis
bioloacutegicos) d EC50 es una medida de la eficacia de una determinada sustancia o de su toxicidad
y representa la cantidad de un compuesto necesaria para disminuir al 50 una funcioacuten En
nuestro caso indica la toxicidad del medio que disminuye a la mitad la actividad microbiana del
consorcio
La metodologiacutea utilizada para la extraccioacuten de HAP (capiacutetulos 1 2 y 3) y creosota
(capiacutetulo 4) se detalla en el apartado de material y meacutetodos de los capiacutetulos
correspondientes La cromatografiacutea liacutequida de alto rendimiento (HPLC high-performance
liquid chromatography) fue la teacutecnica utilizada para el anaacutelisis de los HAP en los capiacutetulos 1
y 2 siguiendo el protocolo descrito por Bautista et al (2009) El equipo de anaacutelisis HPLC
(Prestar 230 Varian Palo Alto CA USA) esta compuesto por una columna C18 en fase
reversa Luna C18 (2) (75 cm longitud x 46 mm diaacutemetro interno y 3 μm tamantildeo de partiacutecula
Phenomenex Torrance CA USA) y conectado a una matriz de fotodiodos de UVVis
Resumen Metodologiacutea general
41
(ultravioletavisible) y un detector de fluorescencia La fase moacutevil utilizada se compone de un
gradiente acetonitriloagua programado como se detalla a continuacioacuten gradiente isocraacutetico
6040 (0-2 min) gradiente de 7525 (2-14 min) gradiente isocraacutetico 7525 (14-15 min)
gradiente de 1000 (15-16 min) El volumen de inyeccioacuten de muestra es de 10 μl y el flujo de
elusioacuten en la columna de 08 mlmiddotmin-1 La deteccioacuten de los HAP se realiza a 254 nm El
posterior tratamiento de los datos se detalla en los respectivos capiacutetulos
El meacutetodo para la deteccioacuten de HAP en el capiacutetulo 3 y de creosota en el capitulo 4 fue
la cromatografiacutea de gases (GC Gas Chromatography) utilizando un cromatoacutegrafo de gases
(system Varian 3900 Palo Alto CA USA) con un detector con ionizador de llama (FID
Flame Ionization Detector) La metodologiacutea protocolo y posterior tratamiento de los datos se
detallan en el material y meacutetodos de los respectivos capiacutetulos
Anaacutelisis bioloacutegicos
La densidad celular es una teacutecnica utilizada en todos los ensayos que componen esta tesis y
por tanto la metodologiacutea y el posterior tratamiento de los datos estaacuten detalladamente
descritos en todos los manuscritos que conforman los capiacutetulos de la tesis
Las teacutecnicas cultivo dependientes desarrolladas en los ensayos han sido el NMP
descrito en los capiacutetulos 2 3 y 4 y el aislamiento de colonias aplicando la metodologiacutea
empleada por Molina et al (2009) y descrita en los capiacutetulos 2 y 3
Teacutecnicas moleculares
Extraccioacuten y amplificacioacuten de ADN
La extraccioacuten de ADN de muestras de cultivos liacutequidos y muestras de biomasa de una
colonia aislada (capiacutetulos 2 y 3) se realizoacute usando el kit de extraccioacuten fiacutesico-quiacutemico de ADN
bacteriano Microbial DNA isolation Kit (Laboratorios MoBio Solano Beach CA USA) Para
la extraccioacuten de ADN total de muestras de suelo (capiacutetulos 3 y 4) se usoacute el kit de extraccioacuten
fiacutesico-quiacutemico Power Soil DNA kit (Laboratorios MoBio Solano Beach CA USA) siguiendo
en ambos casos el protocolo recomendado por el fabricante
Resumen Metodologiacutea general
42
Para la amplificacioacuten de las secuencias de ADN se utilizaron varias parejas de
cebadores en funcioacuten de la teacutecnica posterior de anaacutelisis del producto de PCR La
amplificacioacuten del ADN se realizoacute con el fin de identificar las secuencias de las cepas
aisladas o para un posterior anaacutelisis del ADN total de una muestra mediante electroforesis
en gel con gradiente desnaturalizante (DGGE denaturing gradient gel electrophoresis)
Cuando fue necesario reamplificar material geneacutetico procedente de una banda de DGGE la
pareja de primers utilizada no presentaba cola de GC (guanina-citosina) En la Tabla 2 se
describen las caracteriacutesticas de los cebadores y en la Figura 11 se detallan las condiciones
del programa correspondiente a cada pareja de cebadores
Tabla 2 Caracteriacutesticas de los cebadores utilizados para la amplificacioacuten de ADN por PCR
Cebador Secuencia 5acute--3acute Nordm de bases
Tordf hibridacioacuten
(ordmC)
Programa de PCR (Figura
Teacutecnica de anaacutelisis del producto de
16F27 AGAGTTTGATCMTGGCTCAG 20 55 I Purificacioacuten Secuenciacioacuten16R1488 CGGTTACCTTGTTACGACTTCAGG 24 55 I
16F341 CCTACGGGAGGCAGCAG 17 54 II DGGE Clonacioacuten Ecoli 16R907 CCGTCAATTCCTTTRAGTTT 20 54 II
16F338 CTCCTACGGGAGGCAGCAG 19 55 II DGGE Clonacioacuten Ecoli 16R518 CGTATTACCGCGGCTGCTGG 20 55 II
ITS1F CTTGGTCATTTAGAGGAAGTAA 20 54 III Presencia material geneacutetico ITS4 TCCTCCGCTTATTGATATGC 20 54 III
Primer con posibilidad de antildeadir una secuencia de 40 bases (5acute-CGC CCG CCG CGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) rica en guanina (G) y citosina(C) unida al extremo 5acute- del
cebador necesaria para electroforesis en gel con gradiente desnaturalizantede
Resumen Metodologiacutea general
43
Figura 11 Condiciones de los programas de PCR I II y III a) Paso en el cual se procede a la
activacioacuten del principio activo de la polimerasa ExTaq-HS a una Tordf de activacioacuten de 94ordmC b) Tordf de
desnaturalizacioacuten c) Tordf de hibridacioacuten d) Tordf de polimerizacioacuten e) Tordf de extensioacuten f) Tordf final y de
conservacioacuten del producto de PCR
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 5 min
95 ordmC 1 min
54 ordmC 05 min
72 ordmC 15 min
72 ordmC 10 min
30 CICLOS
PROGRAMA PCR III
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR II
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
94 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR I
Resumen Metodologiacutea general
44
Electroforesis en gel con gradiente de desnaturalizacioacuten (DGGE) y clonacioacuten en
Escherichia coli
El estudio de la comunidad bacteriana se realizoacute mediante la teacutecnica DGGE ampliamente
descrita en los capiacutetulos 2 3 y 4 Las bandas maacutes predominantes fueron extraiacutedas del gel
eluiacutedas en de agua esterilizada y almacenadas a -20 ordmC para su posterior reamplificacioacuten y
clonacioacuten Las imaacutegenes de DGGE se analizaron graacutefica y estadiacutesticamente para diferenciar
entre las comunidades objeto de estudio y la influencia de los tratamientos en los cambios
de una comunidad El anaacutelisis graacutefico mediante el programa UN-Scan-It (v 60 Silk Scientific
US) permitioacute identificar el porcentaje de abundancia de cada banda con respecto de una
comunidad
La clonacioacuten en Ecoli se empleoacute debido a la imposiblidad de reamplificar el ADN
contenido en una banda cortada del gel de DGGE La metodologiacutea empleada para el
desarrollo de esta teacutecnica en los capiacutetulos 2 3 y 4 es la recomendada por el fabricante del
kit utilizado pGEM-T Easy Vector System II (Pomega)
Alineamiento de secuencias y anaacutelisis filogeneacuteticos
Las secuencias fueron editadas utilizando el programa Chromas Pro v142 que permite
ademaacutes visualizar y modificar posibles ambiguumledades en los nucleoacutetidos Las secuencias
fueron descargadas en las bases de datos disponibles (Genbank
(httpwwwncbinlmnihgovgenbank) y Ribosomal Sequence Data
(httprdpcmemsueduseqmatchseqmatch_introjsp)) a traveacutes de la opcioacuten BLAST con el
fin de aproximarnos a la identificacioacuten molecular de los organismos La secuencias fueron
alineadas utilizando el programa Bioedit v709 y posteriormente se elaboroacute una matriz de
datos a partir de la cual se establecieron las posibles relaciones filogeneacuteticos entre las
secuencias problema y aquellas descargadas de las bases de datos El programa utilizado a
tal efecto fue PAUP 40B10 (Swofford 2003)
Se utilizaron dos tipos de anaacutelisis para estimar las relaciones filogeneacuteticas y la
fiabilidad de las topologiacuteas obtenidas Por un lado se utilizoacute la Maacutexima Parsimonia estaacutendar
(Maxima Parsimonia de Fitch MP) un meacutetodo que elige el aacuterbol que requiere el menor
nuacutemero de cambios evolutivos para explicar las relaciones entre taxones a partir de la
informacioacuten generada por los sitios informativos el valor relativo de los diferentes caracteres
y de sus transformaciones Para evaluar la fiabilidad de las relaciones establecidas por
parsimonia se selecciono el meacutetodo Bootstraping (Felsenstein 1985) donde los caracteres
Resumen Metodologiacutea general
45
de las matrices se combinan al azar con las repeticiones necesarias considerando los
paraacutemetros establecidos en el anaacutelisis de parsimonia Asiacute el porcentanje con que aparece
un determinado grupo es una medida de la bondad de dicho grupo o rama Por otro lado la
diferencia entre secuencias (distancia geneacutetica) se computoacute en teacuterminos de nuacutemero de
nucleoacutetidos diferentes por sitio entre secuencias realizando un anaacutelisis de neighbour-joining
de acuerdo al algoritmo de Jukes amp Cantor (1969) Ambos tipos de anaacutelisis se llevaron a
cabo usando el software PAUP 40B10 (Swofford 2003)
Anaacutelisis estadiacutesiticos
Todos los capiacutetulos se disentildearon de forma que tras la finalizacioacuten del experimento los datos
pudieran ser tratados estadiacutesticamente El tratamiento estadiacutestico y los anaacutelisis realizados
con los datos de los ensayos estaacuten descritos en el apartado correspondiente de los
manuscritos que componen los artiacuteculos de la presente tesis Es necesario explicar
detalladamente el experimento que compone el capiacutetulo 1b disentildeado con un experimento
ortogonal del tipo L18 (37) (21) seleccionado del modulo de Statistica (Version 60) Este tipo
de disentildeo permitioacute hacer una combinacioacuten de muacuteltiples factores de forma reducida Es decir
un total de 18 experimentos representan todas las combinaciones posibles que se pueden
dar entre 8 factores siete de los cuales pueden tomar tres valores (37) diferentes (ej factor
Tordf valores 30ordmC 25ordmC y 20ordmC) y uno de ellos con dos valores (21) (ej factor concentracioacuten
de surfactante valores CMC y +20 CMC)
Para visualizar cambios en las comunidades microbianas (patrones univariantes) en
cada combinacioacuten de factores (ej tiempo tipo de consorcio temperatura) se realizoacute una
ordenacioacuten multivariante mediante un escalamiento multidimensional no-meacutetrico (MDS non-
parametric Multidimensional Scaling) usando el programa PRIMER (Clarke 1993) Este tipo
de anaacutelisis se realizoacute en los capiacutetulos 3 y 4 La ordenacioacuten se hizo sobre la base de la matriz
de dismilaridad de Bray-Curtis construida a partir de la transformacioacuten de los datos de
abundancia por la raiacutez cuarta para minimizar la influencia de los valores maacutes extremos
(Clarke 1993 Martiacuten Guirao 2007) Se usoacute el procedimiento SIMPER (Clarke 1993) para
identificar el porcentaje de contribucioacuten de cada banda a la disimilitud entre tratamientos
establecida en la matriz de Bray-Curtis Las bandas se consideraron influyentes cuando su
contribucioacuten se encontraba dentro de los primeros 70 (capiacutetulo 2) 60 (capiacutetulo 3) o 50
(capiacutetulo 4 Viejo 2009) del porcentaje medio de similaridaddisimilaridad acumulado entre y
dentro de la combinacioacuten de factores El criterio aplicado para escoger el porcentaje de
contribucioacuten limite se hizo en funcioacuten de la riqueza de bandas de forma que cuanto menor
fuera este paraacutemetro mayor el porcentaje liacutemite
Capiacutetulo
Publicado en Water Air amp Soil Pollution (2011) 217 365-374
Simarro R Gonzaacutelez N Bautista LF Sanz R amp Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene and
anthracene) biodegradation process by a bacterial consortium
Optimizacioacuten de los principales factores abioacuteticos de un proceso de biodegradacioacuten
de HAP (naftaleno fenantreno y antraceno) por un consorcio bacteriano
1a
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
49
Abstract
The aim of this work is to determine the optimum values for the biodegradation process of six
abiotic factors considered very influential in this process The optimization of a polycyclic
aromatic hydrocarbons (naphthalene phenanthrene and anthracene) biodegradation
process was carried out with a degrading bacterial consortium C2PL05 The optimized
factors were the molar ratio of carbonnitrogenphosphorus (CNP) the nitrogen source the
iron source the iron concentration the pH and the carbon source Each factor was optimized
applying three different treatments during 168 h analyzing cell density by spectrophotometric
absorbance at 600 nm and PAH depletion by HPLC To determine the optimum values of the
factors an analysis of variance (ANOVA) was performed using the cell density increments
and biotic degradation constants calculated for each treatment The most effective values of
each factor were a CNP molar ratio of 1002116 NaNO3 as nitrogen source Fe2(SO4)3 as
iron source using a concentration of 01 mmolmiddotl-1 a pH of 70 and a mixture of glucose and
PAH as carbon source Therefore high concentration of nutrients and soluble forms of
nitrogen and iron at neutral pH favour the biodegradation Also the addition of glucose to
PAH as carbon source increased the number of total microorganism and enhanced the PAH
biodegradation due to augmentation of PAH degrader microorganisms It is also important to
underline that the statistical treatment of data and the combined study of the increments of
the cell density and the biotic biodegradation constant has facilitated the accurate
interpretation of the optimization results For an optimum bioremediation process is very
important to perform these previous bioassays to decrease the process development time
and so the costs
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
51
Introduction
Polycyclic aromatic hydrocarbons (PAH) are persistent organic compounds with two or more
aromatic rings They are formed by incomplete combustion of fossil fuels and pyrolysis of
organic matter derived from human activities and as a result of natural events like forest fires
The toxic mutagenic and carcinogenic properties of PAH have concerned the Unites States
Environmental Protection Agency (US-EPA) proposing some of them as priority pollutants
(including naphthalene phenanthrene and anthracene) In addition the PAH solubility is very
low in aqueous medium (Luning Prak amp Pritchard 2002) affecting their degradation and
biomagnification within the ecosystems The microbial bioremediation removes or
immobilizes the pollutants reducing toxicity with a very low environmental impact Generally
microbial communities present in PAH contaminated soils are enriched by microorganisms
able to use them as only carbon source (Heitkamp amp Cerniglia 1988 Gallego et al 2007)
However this process can be affected by a few key environmental factors (Roling-Wilfred et
al 2002) that may be optimized to achieve a more efficient process The molar ratio of
carbon nitrogen and phosphorus (CNP) is very important for the metabolism of the
microorganisms and so for PAH degradation (Bossert amp Bartha 1984 Alexander 1994
Kwok amp Loh 2003) The molar ratio 100101 is frequently considered optimal for
contaminated soils (Bossert amp Bartha 1984 Alexander 1994) while other author have
reported negative or non-effects (Chaicircneau et al 2005) According to Leys et al (2005)
these contradictory results are due to the nutrients ratio required by PAH degrading bacteria
depends on environmental conditions type of bacteria and type of hydrocarbon In addition
the chemical form of those nutrients is also important being the soluble forms (ie iron or
nitrogen in form of phosphate nitrate and ammonium) the most frequent and efficient due to
their higher availability for microorganisms Depending on the microbial community and their
abundance another factor that may improve the PAH degradation is the addition of readily
assimilated such as glucose carbon sources (Zaidi amp Imam 1999)
Moreover the pH is an important factor that affects the solubility of both PAH and
many chemical species in the cultivation broth as well as the metabolism of the
microorganisms showing an optimal range for bacterial degradation between 55 and 78
(Bossert amp Bartha 1984 Wong et al 2001)
In general bioremediation process optimization may be flawed by the lack of studies
showing the simultaneous effect of different environmental factors Hence our main goal was
to set up the optimum values of six abiotic factors CNP molar ratio nitrogen source iron
source iron concentration pH and carbon source for the biodegradation of three PAH
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
52
(naphthalene phenanthrene and anthracene) at 25 ordmC In order to achieve the main objective
we analyzed the effects of the above factors on the microbial growth and the biotic
degradation rate
Materials and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all gt99 purity) were purchased from Sigma-
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) The consortium C2PL05
was not able to degrade PAH significantly without the addition of surfactants (data not
shown) Therefore surfactant Tween-80 (Sigma-Aldrich Steinheim Germany) was selected
as the most efficient biodegradable and non-toxic surfactant (Bautista et al 2009) for the
consortium C2PL05 Bushnell Haas Broth medium (BHB) was purchased from Panreac
(Barcelona Spain) and its composition is 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-
1 KHPO4 1 gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 This base composition was
modified in each experiment as required
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1g of soil (lt 2 mm) was resuspended in 10 ml
of phosphate buffer saline (PBS) and incubated during 12 h in an orbital shaker (Innova 40
New Brunswick Scientific Edison NJ USA) at 150 rpm and 25ordmC under dark conditions
After that 15 ml of the supernatant was inoculated in 50 ml of BHB broth (pH 70) 1 wt
Tween-80 as surfactant and naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1)
as carbon source The culture was incubated at 150 rpm and 25ordmC under dark conditions
until the exponential phase was completed This was confirmed by monitoring the cell density
by absorbance at 600 nm in a spectrophotometer (Spectronic GenesysTM UK) Then the
consortium was stored at 4 ordmC to stop its growth At the beginning of each experiment 500 μl
of the stored consortium was inoculated into the fermentation flasks To identify the microbial
consortium C2PL05 colonies from aliquots of the soil extract were isolated in BHB agar
plates with PAH as only carbon source to confirm that these colonies were PAH degraders
Eight colonies were isolated and transferred onto LB-glucose agar plates in order to increase
microbial biomass for DNA extraction Total DNA of the colonies was extracted using
Microbial DNA isolation kit (MoBio Laboratories) Amplification of the 16S rRNA coding
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
53
region of the DNA was performed as described by Vintildeas et al (2005) using the primers
16F27 and 16R1488 Sequences were edited and assembled using BioEdit 487 software
(Hall 1999) All isolated strains of the consortium C2PL05 were γ-proteobacteria and the
genera present were Enterobacter Pseudomonas and Stenotrophomonas In addition non
culture-dependent molecular techniques as denaturant gradient gel electrophoresis (DGGE)
was performed to know the total biodiversity of the microbial consortium C2PL05 16S rRNA
gen was amplified using the primers 341F-GC and 907R (GC clamp 5acute-CGC CCG CCG
CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995) About 6 of
polyacrylamide (3751 acrylamidebisacrylamide) gels with a 30-60 urea-formamide
denaturant gradient and 075 mm were used in 1xTAE buffer at 200V for 4h at 60 ordmC The
bands were excised and reamplificated to identify the DNA The two genera identified
coincided with genera Pseudomonas and Stenotrophomonas identified by culture-dependent
techniques (more details in Molina et al 2009)
Experimental design
A total of 6 abiotic factors were evaluated To obtain an optimum value three treatments
each in triplicate were performed for each factor The replicates were carried out in 100 ml
Erlenmeyer flasks with 50 ml of BHB medium (pH 70) Tween-80 (1wt) naphthalene
phenanthrene and anthracene (each at 500 mgmiddotl-1) and 500 microl of the C2PL05 consortium
The concentration of the inoculum was 315x106 cells ml-1 of the heterotrophic microorganism
and 695x105 cells ml-1 of the PAH degrading microorganism The number of the
microorganisms capable to degrade any carbon source present in the medium (heterotrophic
microorganisms) and microorganisms capable to degrade PAH as sole carbon source (PAH-
degrading bacteria) were measured by the most probably number (MPN) method (Wrenn amp
Venosa 1996) LB-glucose broth and BHB medium were used to determine heterotrophic
microorganism and PAH degrading microorganism respectively To maintain the same initial
number of cells in each experiment the absorbance of the inoculum was measured and
diluted if necessary before inoculation to reach an optical density of 16 AU The replicates
were incubated in an orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA)
at 150 rpm and 25 ordmC under dark conditions Previous to inoculate the consortium the
Erlenmeyer flasks were shacked overnight to solubilize most of the PAH Samples were
withdrawn at 0 15 24 39 48 64 72 159 and 168 h to monitor the PAH depletion and cell
growth
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
54
Treatment conditions
Composition of BHB base was 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-1 KHPO4 1
gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 The compounds MgSO4 and CaCl2 and their
concentration were constant for all treatments and KHPO4 and K2HPO4 were modified only in
concentration The other components were modified both the concentration and compounds
according to the requirements of the optimized factors PAH at 1500 mgmiddotl-1 (500 mgmiddotl-1 of
naphthalene phenathrene and anthracene) was used as carbon source for all treatments
except for those in which the carbon source was optimized and PAH were mixed with
glucose in a proportion of 50 PAH-glucose or only glucose was added In all cases an
overall carbon concentration of 01176 mmoll-1 was used Once a factor was optimized its
optimum value was kept for the subsequent factor optimization
The levels of each factor studied were selected as described below For the CNP
molar ratio the values employed were 100101 frequently described as optimal (Bossert
and Bartha 1984) 100505 and 1002116 To optimize the nitrogen source NaNO3
NH4(NO3) and (NH4)2SO3 were used The optimal iron source was selected amongst FeCl3
Fe(NO3)3 and Fe2(SO4)3 The concentration levels of the optimal iron form were 005 01 and
02 mmoll-1 and three different pH values were also tested 50 70 and 80 The effect of the
carbon source was determined by adding PAH as only carbon source PAH and glucose
(50 of carbon atoms from each source) or glucose as only carbon source
Bacterial growth
Bacterial growth during the PAH degradation process was monitored at 0 15 24 39 48 64
72 159 and 168 h by spectrophotometric absorbance of the culture media at 600 nm in a
UV-Vis spectrophotometer (Spectronic GenesysTM UK) From the above optical density data
the average of the cell density increments (CDI) was calculated by applying the following
equation
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
55
Kinetic degradation
Naphthalene phenanthrene and anthracene concentrations in the culture media were
analysed using a ProStar 230 HPLC system (Varian Palo Alto CA USA) with a reverse
phase C18 column following the method described in Bautista et al (2009) The
concentration of each PAH was calculated from a standard curve based on peak area using
the absorbance at 254 nm Depletion rate of each PAH (-ri) during the experiments was fitted
to a first order kinetic model (Equation 2)
iBiiAii
i CkCkdt
dCr Eq 2
where C is the concentration of the corresponding PAH kA is the apparent first-order
kinetic constant due to abiotic processes kB is the apparent first-order kinetic constant
due to biological processes t is the time elapsed and the subscript i corresponds to
each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1 wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40 New Brunswick Scientific Edison
NJ USA) at 150 rpm and 25 ordmC under dark conditions PAH concentration in the control
experiment were analysed using the HPLC system described previously The values of kA for
each PAH was calculated by applying eq 2 considering kB asymp 0 since no bacterial consortium
was inoculated
Statistical analysis
In order to evaluate the effects of the treatments on the kinetic biodegradation constant (kB)
and cell density increments (CDI) bifactorials analysis of variance (ANOVA) were used The
variances were checked for homogeneity by applying the Cochranacutes test When indicated
data were transformed to homogenize variances Student-Newman-Keuls (SNK) test was
used to discriminate among different treatments after significant F-test All tests were
performed with the software Statistica 60 for Windows
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
56
Results
Control experiments (Figure 1) show that phenathrene and anthracene concentration was
not affected by any abiotic process since no depletion was observed along the experiment
so that kA asymp 0 h-1 However in the case of naphthalene some degree of abiotic depletion was
measured during the controls yielding an apparent first-order abiotic rate constant of 27x10-
3 plusmn 7x10-5 h1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the optimisation experiments
0 100 200 300 400 500 600 700
20
40
60
80
100
Rem
aini
ng P
AH
(
)
Time (hour)
Figure 1 Naphthalene ( ) phenathrene ( ) and anthracene ( )
depletion due to abiotic processes in control experiments
Table 1 Analysis of variance (ANOVA) summary for the cell density increments (CDI) and the
biotic degradation constant (kB) MS is the means of squares and df degrees of freedom
CDI kB
Factor df MS F-value p-value df MS F-value p-value
CNP ratio 2 27middot10-1 238 4 57middot10-2 566 Error 6 11middot10-2 18 10middot10-3
N source 2 21middot10-1 234 4 90middot10-6 113
Error 6 10middot10-2 18 70middot10-7
Fe source 2 18middot10-2 51 4 30middot10-6 43
Error 6 36middot10-3 18 70middot10-8
Fe Concentration 2 45middot10-1 348 006 4 30middot10-6 38
Error 6 95middot10-2 18 10middot10-7
pH 2 30middot10-2 1103 4 15middot10-4 5
Error 6 27middot10-3 18 33middot10-5
GlucosePAHs 2 54middot10-1 45401 2 66middot10-4 7
Error 6 12middot10-3 12 93middot10-5
a Logarithmically transformed data to achieve homogeneity of variance
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
57
Cell density increments of the consortium for three different treatments of CNP molar
ratio are showed in Figure 2A According to statistical analysis of CDI there was significant
differences between CNP molar ratio (F26 = 238 p lt 001 Table 1) and SNK showed that
treatments with molar ratios of 100101 and 1002116 reached larger increases With
regard to the kinetic biodegradation constant (kB) the interaction between kB of the
treatments with each hydrocarbon was significant (F418 = 57 p lt 0001 Table 1) The SNK
test (Figure 2B) showed that the treatment 1002116 with naphthalene yielded the highest
value whereas the lowest were achieved with 100505 and 100101 for anthracene and
phenanthrene In addition within each PAH group the highest values were observed with
1002116 molar ratio Therefore although there are no differences for CDI between ratios
100101 and 1002116 1002116 molar ratio is the most effective for the PAH degradation
so that this ratio was considered as the optimal
171819202122232425
100101 1002116100505
bb
a
A
CNP molar ratio
CD
I
Naphthalene Phenanthrene Anthracene-35
-30
-25
-20
-15
-10
-05
00B
d
g
e
bc
f
ab
f
Log
k B (
h-1)
Figure 2 (A) Cell density increments of the consortium C2PL05 with the treatments 100505
100101 and 1002116 Error bars show the standard error (B) Differences between treatments
(100101 100505 and 1002116 ) and PAHs in the biodegradation kinetic constant (kB)
The letters show differences between groups (p lt 005 SNK) and the error bars the standard
deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
58
Figure 3A shows that the three different nitrogen sources added had significant effects
on CDI (F26 = 234 p lt 001 Table 1) The SNK test shows that the addition of NaNO3
significantly improved CDI The interaction between PAH and the nitrogen sources were
significant (F418 = 113 p lt 0001 Table 1) and the highest kB values were achieved with
NaNO3 for naphthalene phenanthrene and anthracene (Figure 3B) According to these
results NaNO3 is considered as the best form to supply the nitrogen source for both PAH
degradation and growth of the C2PL05 consortium
19
20
21
22
23
24
25
(NH4)
2SO
4NH4NO
3NaNO
3
a
b
a
A
Nitrogen source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
Bf
ba
e
bcb
dbc
a
kB (
h-1)
Figure 3 (A) Cell density increments of the consortium C2PL05 with the treatments NaNO3 NH4NO3
and (NH4)2SO4 Error bars show the standard error (B) Differences between treatments (NaNO3
NH4NO3 and (NH4)2SO4 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
59
CDI of the treatments performed with three different iron sources (Figure 4A) were
significantly different (F26 = 51 p lt 005 Table 1) Although no significant differences
between adding Fe2(SO4)3 or Fe(NO3)3 were observed the addition of Fe2(SO4)3 contributes
more to CDI than FeCl3 The kB (Figure 4B) showed significant differences in the interaction
between PAH and the different iron sources (F418 = 43 p lt 0001 Table 1) The highest kB
values were observed with Fe2(SO4)3 for the degradation of phenanthrene followed by FeCl3
degrading naphthalene and phenanthrene The lowest values of kB were observed with
Fe(NO3)3 degrading naphthalene and anthracene Nevertheless the most recalcitrant PAH
(phenanthrene and anthracene) showed the highest kB values with Fe2(SO4)3 in agreement
with the highest CDI values also obtained with Fe2(SO4)3
168
172
176
180
184
188
192
196
Fe(NO3)
3 Fe2(SO
4)
3FeCl
3
ab
b
a
A
Iron source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
B
c
a
b
c
b
d
b
a a
k B
(h-1
)
Figure 4 (A) Cell density increments of the consortium C2PL05 with the treatments FeCl3 Fe(NO3)3
and Fe2(SO4)3 Error bars show the standard error (B) Differences between treatments (FeCl3
Fe(NO3)3 and Fe2(SO4) ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
60
Concerning the effect of the iron concentration (Figure 5) supplied in the form of the
optimal Fe2(SO4)3 no significant differences in CDI were found for all three concentration
used (F26 = 348 p = 006 Table 1 Figure 5A) However the interaction between iron
concentration and kB of three PAH was significant (F418 = 38 p lt 0001 Table 1) reaching
the highest values for kB by using an iron concentration of 01 mmoll-1 degrading
naphthalene and phenanthrene (Figure 5B) The lowest values of kB were observed with 005
mmoll-1 and 02 mmoll-1 degrading phenanthrene and anthracene (Figure 4B) Since each
PAH showed the highest kB with 01 mmoll-1 this iron concentration was considered as the
most efficient for the PAH biodegradation process
005 01 02
38
40
42
44
46
48
50
a
a
a
A
Iron concentration (mmol l-1)
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
B
c
f
d
b
e
d
cb
a
k B (
h-1)
Figure 5 (A) Cell density increments of the consortium C2PL05 with the treatments 005 mmolmiddotl-1 01
mmolmiddotl-1 and 02 mmolmiddotl-1 Error bars show the standard error (B) Differences between treatments
(005 mmolmiddotl-1 01 mmolmiddotl-1 and 02 mmolmiddotl-1 ) and PAHs in the biodegradation kinetic
constant (kB) The letters show differences between groups (p lt 005 SNK) and the error bars the
standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
61
With reference to pH Figure 6A and statistical analysis (F26 = 1103 p lt 001 Table 1)
clearly show that the neutral pH of the medium favour the CDI of the consortium The kB of
the three different treatments (Figure 6B) also showed significant differences in the
interaction (F49 = 5 p lt 005 Table 1) The highest value of kB was observed for anthracene
degradation at neutral pH (Figure 6B) The other two PAH naphthalene and phenanthrene
did not show significantly differences between any treatments Therefore given that the
highest values of both parameters (CDI and kB) were observed at pH 7 this value will be
considered as the most efficient for the PAH biodegradation process
5 7 8
215
220
225
230
235
240
245
a
b
a
A
pH
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
25x10-2
30x10-2
B
b
a
ab ab
a
ab
c
ab ab
kB
(h-1
)
Figure 6 (A) Cell density increments of the consortium C2PL05 with the treatments pH 50 pH 70
and pH 80 Error bars show the standard error (B) Differences between treatments (pH 50 pH
70 and pH 80 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
62
The last factor analyzed was the addition of an easily assimilated carbon source
(Figure 7) Regarding to CDI values (Figure 7A) there were significant differences between
treatments (F26 = 45401 p lt 0001 Table 1) The addition of glucose as only carbon source
significantly improved CDI Figure 7B only show the kB of the treatments with PAH (100 or
50 of PAH) therefore the treatment with glucose as only carbon source was not included in
the ANOVA analysis The interaction between PAH and type of carbon source was
significant (F212 = 7 p lt 005 Table 1) The kB for the treatment with PAH and glucose
(5050) was significantly higher for phenanthrene and naphthalene (Figure 6B) although
there were no differences with the treatment for anthracene where PAH were the only carbon
source
PAHs (100)
PAHsGlucose (50)Glucose (100)
18
20
22
24
26
28
Carbon source
b
c
a
A
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-2
4x10-2
6x10-2
8x10-2
1x10-1
B
c
bb
b
b
a
k B (h
-1)
Figure 7 (A) Cell density increments of the consortium C2PL05 with the treatments PAHs (100)
PAHsglucose (5050) and glucose (100) Error bars show the standard error (B) Differences
between treatments (PAHs (100) and PAHs glucose (5050) ) and PAHs in the
biodegradation kinetic constant (kB) The letters show differences between groups (p lt 005 SNK)
and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
63
Discussion
It is important to highlight that the increments of the cell density is a parameter that brings
together all the microbial community whereas the biotic degradation constant is specific for
the PAH degrading microorganisms For that reason when the effect of the factors studied
on CDI and kB yielded opposite results the latter always prevailed since PAH degradation
efficiency is the main goal of the present optimisation study
With regard to the CNP molar ratio some authors consider that low ratios might limit
the bacterial growth (Leys et al 2005) although others show that high molar ratios such as
100101 are optimum for hydrocarbon polluted soils (Flathman et al 1994 Bouchez et al
1995 Eweis et al 1998) However in agreement with Leys et al (2005) our results
confirmed that the most effective molar ratio was the highest (1002116) This result
suggests that the supply of the inorganic nutrients during the PAH biodegradation process
may be needed by the microbial metabolism In addition the form used to supply these
nutrients can affect the metabolism of the microorganism (Carmichael amp Pfaender 1997) and
limit the amount of carbon that bacteria can assimilate limiting in turn the biodegradation
extent Our results showed that nitrate (sodium nitrate) as nitrogen source improved PAH
biodegradation as compared to ammonium This is likely due to the fact that nitrate is more
soluble and available for microorganisms than ammonium which has adsorbent properties
(Schlessinger 1991) The iron is other essential compound to stimulate the microbial activity
on PAH degradation (Dinkla amp Janssen 2003 Santos et al 2008)
On one hand iron acts as a cofactor of enzymes catalysing PAH oxidation (Dinkla amp
Janssen 2003) but it is also related with the production of biosurfactants (Santos et al
2008) These compounds are naturally produced by genera such as Pseudomonas and
Bacillus (Wei et al 2003) increasing the PAH solubility and therefore their bioavailability In
agreement with previous works (Dinkla amp Janssen 2003 Santos et al 2008) our results
confirmed that the addition of iron in a concentration of 01 mmoll-1 makes the
biodegradation more effective Santos et al (2008) stated that there is a limit concentration
above which the growth is inhibited due to toxic effects According to these authors our
results showed lower degradation and growth with the concentration 02 mmoll-1 since this
concentration may be saturating for these microorganisms However opposite to previous
works (Dinkla amp Janssen 2003 Santos et al 2008) the most effective iron form was
Fe2(SO4)3 for the PAH biodegradation likely due to the higher solubility which makes it more
available for the microorganism
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
64
The addition of easy assimilated carbon forms such as glucose for the PAH
degrading process can result in an increment in the total number of bacteria (Wong et al
2001) because PAH degrader population can use multiple carbon sources simultaneously
(Herwijnen et al 2006) However this increment in the microbial biomass was previously
considered (Wong et al 2001) because the utilization of the new carbon source may
increase the lag phase delaying the bacterial growth (Maier et al 2000) Our results
confirmed that PAH degradation was more efficient with the addition of an easy assimilated
carbon source probably because the augmentation of the total heterotrophic population also
enhanced the PAH degrading community Our consortium showed a longer lag phase during
the treatment with glucose than that observed during the treatment with PAH as only carbon
source (data not shown) These results are consistent with a consortium completely adapted
to PAH biodegradation and its enzymatic system requires some adaptation time to start
assimilating the new carbon source (Maier et al 2000)
Depending on the type of soil and the type of PAH to degrade the optimum pH range
can be very variable (Dibble amp Bartha 1979) Some acid resistant gram-positive bacteria
such as Mycobacterium sp show better PAH degradation capabilities under acid condition
because and low pH seems to render the mycobacterial more permeable to hydrophobic
substrates (Kim et al 2005) However other microorganisms belonging to Pseudomonas
genus prefer neutral pH conditions In agreement with previous works (ie Dibble amp Bartha
1979) our results confirmed that neutral pH is optimum for the biodegradation PAH
In summary the current work has shown that the optimization of environmental
parameters may significantly improve the PAH biodegradation process It is also important to
underline that the statistical analysis of data and the combined study of the bacterial growth
and the kinetics of the degradation process provide an accurate interpretation of the
optimisation results Concluding for an optimum bioremediation process is very important to
perform these previous bioassays to decrease the process development time and so the
associated costs
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Master en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
65
References
Alexander M 1994 Biodegradation and Biorremediation Academic Press New York
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse bacteria Int Biodeter
Biodegr 63 913-922
Bossert I amp Bartha R 1984 The fate of petroleum in soil ecosystems In Atlas RM (ed)
Petroleum microbiology Macmillan New York pp441-4473
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Carmichael LM amp Pfaender KF 1997 The effects of inorganic and organic supplements on
the microbial degradation of phenanthrene and pyrene in soils Biodegradation 8 1-
13
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge Appl Environ Microbiol 37 729-739
Dinkla EJT amp Janssen DB 2003 Simultaneous growth on citrate reduces the effects of
iron limitation during toluene degradation in Pseudomonas Microb Ecol 45 97-107
Eweis JB Ergas SJ Chang PY amp Schroeder ED 1998 Bioremediation Principles
McGraw-Hill Boston pp 136-236
Flathman PE Jerger DE amp Exner JH1994 Biorremediation-Field Experiences Lewis
Publishers Boca Raton pp 81-106 383-490
Gallego JL Garciacutea MJ Llamas JF Belloch C Pelaez AI amp Sanchez J 2007
Biodegradation of oil tank botton sludge using microbial consortia Biodegradation 18
269-281
Hall TA 1999 Bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 41 95-98
Heitkamp MA amp Cerniglia CE 1988 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from sediment below an Oil Field Appl Environ Microbiol 54
1612-1614
Kim YH Freeman JP Moody JD Engesse KH amp Cerniglia CE 2005 Effects of pH on
the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1
Appl Environ Microbiol 67 275-285
Kwok Chen-Ko amp Loh Kai-Che 2003 Effects of Singapore soil type on bioavalability of
nutrients in soil bioremediation Adv Environ Res 7 889-900
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
66
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Luning Prak DJ amp Pritchard PH 2002 Solubilization of polycyclic aromatic hydrocarbon
mixtures in micelar non-ionic surfactant solution Water Res 36 3463-3472
Maier MR Pepper LI amp Gerba PC 2000 Enviromental Microbiology Academic Press
Elsevier
Molina MC Gonzalez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz L 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Denaturing gradient gel
electrophoresis of PCR-amplified 16S Rdna a new molecular approach to analyse the
genetic diversity of mixed microbial communities In Akkermans ADL van Elsas JD
de Bruijn FJ (eds) Molecular microbial ecology manual Kluwer Academic Publishers
Dordrecht pp 1-23
Rolling-Wilfred FM Milner M Jones DM Lee K Daniel F Swanell-Richard JP amp Head
IM 2002 Robust hydrocarbon degradation and dynamic of bacterial communities
during nutrients-enhanced oil spillbiorremediation Appl Environ Microbiol 68 5537-
5548
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation an surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Vintildeas M Sabateacute J Guasp C Lalucat J y Solanas AM 2005 Culture-dependent and
independent aproaches establish the complexity of a PAH degrading microbial
consortium Can J Microbiol 51 897-909
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacillus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK Ma KK amp Fang M 2001 Isolation and optimization of
PAH-degradative bacteria from contaminated soil for PAH bioremediation Water Air
Soil Poll 13 1-13
Zaidi BR amp ImamSH 1999 Factors affecting microbial degradation of polycyclic aromatic
hydrocarbon phenanthrene in caribbean coastal water Mar Pollut Bull 38 738-749
Capiacutetulo
Aceptado en Water Air amp Soil Pollution (Febrero 2012)
Simarro R Gonzaacutelez N Bautista LF Molina MC amp Schiavi E
Evaluation of the influence of multiple environmental factors on the biodegradation
of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal
experimental design
Evaluacioacuten de la influencia de muacuteltiples factores ambientales en la biodegradacioacuten de dibenzofurano
fenantreno y pireno por un consorcio bacteriano usando un disentildeo experimental ortogonal
1b
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
69
Abstract
For a bioremediation process to be effective we suggest to perform preliminary studies in
laboratory to describe and characterize physicochemical and biological parameters (type and
concentration of nutrients type and number of microorganisms temperature) of the
environment concerned We consider that these studies should be done by taking into
account the simultaneous interaction between different factors By knowing the response
capacity to pollutants it is possible to select and modify the right experimental conditions to
enhance bioremediation
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
71
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic compounds composed of two
or more aromatics rings High molecular weight PAH (HMW-PAH) with four (ie pyrene) or
more aromatics rings and other heterocyclic aromatic compounds as dibenzofuran both with
high molecular mass are often more difficult to biodegrade that other low molecular weight
PAH (LMW-PAH) due to their lower solubility and biodegradability Many of them have toxic
mutagenic and carcinogenic properties and the effects of PAH as naphthalene or
phenanthrene in animals and humans their toxicity and carcinogenic activity has been
reported and well documented (Sudip et al 2002) In addition PAH are bioaccumulated in
the environment and trophic chains properties that increase with the numbers of rings There
is a natural degradation carried out by microorganism able to use PAH as carbon source
which represents a considerable portion of the bacterial communities present in polluted soils
(Heitkamp amp Cerniglia 1998) However this natural biodegradation may be affected by
environmental factors which optimization allows us to achieve a more efficient process
Temperature is a key factor in the physicochemical properties of PAH as well as in the
metabolism of the microorganisms Although it has been shown that biodegradation of PAH
is possible even at temperatures lower than 5 ordmC (Eriksson et al 2001) it is usually more
efficient at mild temperatures (15-25 ordmC) (Mohn amp Stewart 2000) The carbon nitrogen and
phosphorus (CNP) molar ratio is another important factor in biodegradation process
because affect the dynamics of the bacterial metabolisms changing the PAH conversion
rates and growth of PAH-degrading species (Leys et al 2004) The form in which these
essential nutrients are supplied affects the bioavailability for the microorganism being more
soluble and efficient the oxidated forms (such as nitrates) than reduced forms (such as
ammonium) (Schlessinger 1991)
Surfactants are compounds used to increase the PAH solubility although both
positive (Boochan et al 1998 Jin et al 2007) and negative effects (Boochan et al 1998
Laha amp Luthy 1992) on the biodegradation process has been reported The nature of the
effect depends on several factors such as the type and concentration of surfactant due to
the toxic properties of some of them (Jin et al 2007) and the increasing of toxicity of PAH
produced by increasing their solubility (Thibault et al 1996) Another factor considered is the
inoculum size related to the diversity and effectiveness of the biodegradation because in a
diluted inoculum the minority microorganisms which likely have an important role in the
biodegradation process can be removed (Szaboacute et al 2007) Moreover it has been
reported (Szaboacute et al 2007) that the addition of a readily metabolized carbon source (ie
glucose) improves the PAH degradation possibly due to the increased biomass although in
72
others cases (Wong et al 2000) this better bacterial growth reduced significantly PAH
degradation
We consider that the study of the individual effect of abiotic factors on the
biodegradation capacity of the microbial consortium is incomplete because the effect of one
factor can be influenced by other factors In this work the combination between factors was
optimized by an orthogonal experimental design fraction of the full factorial combination of
the selected environmental factors
Hence our two mains goals are to determine the optimal conditions for the
biodegradation of low (phenanthrene and dibenzophurane) and high (pyrene) molecular
weight PAH by a bacterial degrading consortium (C2PL05) and the study of the influence of
the factors (temperature CNP molar ratio type of nitrogen and iron source iron source
concentration carbon source surfactant concentration and inoculums dilution) in the
biodegradation In order to achieve these objectives we realized an orthogonal experimental
design to take into account all combination between eight factors temperature CNP molar
ratio nitrogen and iron source iron concentration addition of glucose surfactant
concentration and inoculum dilution at three and two levels
Material and methods
Chemicals and media
Dibenzofuran phenanthrene and pyrene (gt99 purity) were purchased from Sigma-Aldrich
Steinheim Germany) Stock mix of the three PAH was prepared by dissolving the necessary
amount in n-hexane (Fluka Steinheim Germany) In previously work (Bautista et al 2009)
we tested that the optimal surfactant for the consortium was the biodegradable and non
toxicTween-80 (Sigma-Aldrich Steinheim Germany) Bushnell-Haas Broth medium (BHB)
was purchased from Panreac (Barcelona Spain) and its original composition (02 g l-1
MgSO4middot7H2O 002 g l-1 CaCl2 2H2O 1 g l-1 KHPO4 1 g l-1 K2HPO4 1 g l-1 NH4NO3 005 g l-1
FeCl3) was modified according to the treatment (see Table 1)
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
73
Table 1 Experimental design
Treatment T
(ordmC) CNP (molar)
N source
Fe
source
Iron source concentration
(mM)
Glucose PAH ()
Surfactant concentration
Inoculum dilution
1 30 100505 (NH4)2SO3 Fe2(SO4)3 02 0100 CMC 10-3
2 20 1002116 (NH4)2SO3 FeNO3 005 0100 + 20CMC 10-2
3 25 100101 NaNO3 FeNO3 02 0100 + 20CMC 10-1
4 20 100505 NaNO3 Fe2(SO4)3 02 5050 + 20CMC 10-2
5 25 100505 NH4NO3 FeNO3 01 5050 CMC 10-2
6 30 100101 NH4NO3 Fe2(SO4)3 005 8020 + 20CMC 10-2
7 30 100101 NaNO3 FeCl3 01 0100 CMC 10-2
8 20 100505 NaNO3 FeCl3 005 8020 CMC 10-1
9 25 1002116 (NH4)2SO3 FeCl3 02 8020 CMC 10-2
10 20 1002116 NH4NO3 Fe2(SO4)3 01 0100 CMC 10-1
11 20 100101 NH4NO3 FeNO3 02 8020 CMC 10-3
12 25 100101 (NH4)2SO3 Fe2(SO4)3 005 5050 CMC 10-1
13 25 1002116 NaNO3 Fe2(SO4)3 01 8020 + 20CMC 10-3
14 30 1002116 NH4NO3 FeCl3 02 5050 + 20CMC 10-1
15 25 100505 NH4NO3 FeCl3 005 0100 + 20CMC 10-3
16 30 1002116 NaNO3 FeNO3 005 5050 CMC 10-3
17 30 100505 (NH4)2SO3 FeNO3 01 8020 + 20CMC 10-1
18 20 100101 (NH4)2SO3 FeCl3 01 5050 + 20CMC 10-3
Bacterial consortium
PAH-degrading consortium C2PL05 was isolated from a soil in a petrochemical complex in
Puertollano (Spain) and was identified and described in Molina et al (2009) All strains of
the consortium C2PL05 isolated by culture-dependent techniques were γ-Proteobacteria
and the strains presents belong to the genera Enterobacter Pseudomonas and
Stenotrophomonas (Molina et al 2009) In addition the diversity of the enriched microbial
consortium was characterised by a non culture-dependent molecular technique such as
denaturing gradient gel electrophoresis (DGGE) following the procedure described
elsewhere (Molina et al 2009) using the primers 341F-GC and 907R (GC clamp 5acute-CGC
CCG CCG CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995)
Experimental design
An orthogonal design form of L18 (37) (21) selected from the module of Statistica (Version 60)
was used to do the multi-factor combination A total of 18 experiments each in triplicate
were carried out in 100 ml Erlenmeyers flask with a total volume of 50 ml of Bushnell-Haas
Broth medium (BHB) (Panreac Barcelona Spain) with an original composition modified
74
according to the treatments requirements (see Table 1) The replicates were incubated in an
orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA) at 150 rpm under dark
conditions but prior to inoculate the consortium the flasks were shaken overnight to
equilibrate and solubilize most of the PAH In Table 1 shows a summary of environmental
conditions and incubation of each treatment Tween-80 concentration was 0012 mM the
critical micellar concentration (CMC) 100 of PAH was equivalent to 03 g l-1 (01 g l-1 of
each PAH) The initial cell concentration of the inoculum consortium was determined by the
most probably number (MPN) method (Wrenn amp Venosa 1983) The number of heterotrophic
microorganisms (315x106 cell ml-1) was measured with Luria Base broth (LB Panreac
Barcelona Spain) with glucose as carbon source and the PAH degrading microorganisms of
the consortium (695x105 cell ml-1) with BHB with PAH mix as carbon source
Cell density
Bacterial density during the PAH degrading process was monitored at 0 15 24 39 48 63
72 87 95 and 159 h by the increase in absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) Throughout the cell growth curve we
calculated the average of the cell densities increments (CDI) applying the equation 1
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and i
corresponds to each sample or sampling time The increments were normalized by
the initial absorbance measurements to correct the effect of the inoculum dilution
PAH extraction and analysis
At the end of each experiment (159 hours) PAH were extracted with dichloromethane and
the residue precipitated was dissolved in 1 ml of acetonitrile for high performance liquid
chromatography (HPLC) analysis using a ProStar 230 HPLC system (Varian Palo Alto CA
USA) with a reversed phase C18 column following the method previously described (Bautista
et al 2009) The residual concentration of each PAH was calculated from a standard curve
based on peak area at a wavelength of 254 nm The average percentage of phenanthrene
pyrene and dibenzofuran and average percentage of total PAH degradation (PD) for each
treatment are shown in Table 2
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
75
Statistical analyses
The effect of the individual parameters on the CDI and on the PD were analysed by a
parametric one-way analysis of variance (ANOVA) The variances were checked for
homogeneity by the Cochranacutes test Students-Newman-Keuls (SNK) test was used to
discriminate among different variables after significant F-test When data were not strictly
parametric Kruskal-Wallis test and Tukey-type multiple comparison test were used
The orthogonal design to determine the optimal conditions for PAH biodegradation is
an alternative to the full factorial test which is impractical when many factors are considered
simultaneously (Chen et al 2008) However the orthogonal test allows a much lower
combination of factors and levels to test the effect of interacting factors
Results and discussion
The consortium C2PL05 degrade phenanthrene pyrene and dibenfuran efficiently in 159 h
(Table 2) and also other PAH as naphthalene and anthracene (Molina et al 2009) The
study of the influence of each factor in the total PD (Figure 1) showed that only the carbon
source influenced in this parameter significantly (Table 3) Results concerning to carbon
source showed that PD were higher when PAH were added as only carbon source (100 of
PAH) The reason why the PD did not show statistical significance between treatments
except for the relative concentration of PAH-glucose may be due to significant changes
produced in PD at earlier times when PAH were still present in the cultivation media
However the carbon source incubation temperature and inoculum dilution were factors that
significantly influenced CDI (Table 3 Figure 2)
76
Table 2 Final percentage degradation of
phenanthrene (Phe) pyrene (pyr) and dibenzofuran
(Dib) and total percentage degradation (total PD) for
each treatment
percentage degradation Treatment Phe Pyr Dib Total PD
1 965 883 864 904 2 969 950 833 917 3 966 895 845 902 4 972 915 921 872 5 969 904 950 882 6 982 935 995 852 7 964 883 859 902 8 977 953 964 823 9 976 936 984 825 10 970 910 895 925 11 979 968 986 888 12 966 889 920 850 13 978 930 993 835 14 966 897 943 871 15 963 881 898 914 16 963 886 951 867 17 977 954 986 861 18 976 930 967 915
The conditions corresponding to listed treatments
are presented in Table 1
100
50
5
100
101
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
82
84
86
88
90
92 T (ordmC)
aa
a
aa
aa
aa
a
Tot
al P
D (
)
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
(SO
4)3
a
a
0acute05 0acute1
0acute2
Fe source
a
a
a
0 -
100
50 -
50
80 -
20
C Fe (mM)
a
b
c
CM
C
+ 2
0 C
MC
Gluc-PAHs
aa
10^-
1
10^-
2
10^-
3DilutionCMC
aa
a
Figure 1 Graphical analysis of average values of total percentage degradation (PD) under
different treatments and levels of the factors () represent the average of the total PD of the
treatments of each level Letters (a b and c) show differences between groups
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
77
Table 3 Analysis of variance (ANOVA) summary for the increments of cell density (CDI) and the total
percentage degradation (PD) of each factor MS is the mean of squares and df degrees of freedom
ANOVA of CDI ANOVA of total PD
Factor df MS F-value p-value df MS F-value p-value
T (ordmC) Error
2 056 1889 2 22 183 ns
51 002 51 12
Molar ratio CNP Error
2 003 069 ns 2 22 183 ns
51 005 51 12
N source Error
2 001 007 ns 2 214 177 ns 51 005 51 121
Fe source Error
2 003 066 ns 2 89 071 ns
51 005 51 126
Fe concentration Error
2 007 146 ns 2 118 095 ns 51 005 51 124
Glucose-PAH Error
2 024 584 2 1802
3085 51 004 51 395
8
CMC Error
1 001 027 ns 1 89 071 ns
52 005 52 125
Inoculum Dilutionb Error
2 331 a 2 113 091 ns 54 6614 51 125
a H-value obtained of Kruskal-Wallis test used for non parametric data Chi-square = 28 Overall
median = 044
p-value lt 001
p-value lt 0001
100
50
5
100
100
1
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
16
17
18
19
20
21
a
a
aa
a
aa
a
c
bCD
I
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
SO
4
Fe source
a
a
0acute05 0acute1
0acute2
C Fe (mM)
a
a
a
0-10
0
50-5
0
80-2
0
Gluc-PAH
a
b
c
CM
C
+ 2
0 C
MC
CMC
aa
10^-
1
10^-
2
10^-
3
00
05
10
15
20
25
30
35C
DI n
orm
aliz
ed
DilutionT (ordmC)
b
a
a
Figure 2 Graphical analysis of average values of cell density increments (CDI) and normalized cell
density increments (CDI normalized) of different treatments and levels of the factors () represent the
average of the CDI or CDI normalized of the treatments of each level Letters (a b and c) show
differences between groups
78
The temperature range considered in the present study might not affect the
biodegradation process since it is considered narrow by some authors (Wong et al 2000)
Nevertheless we observed significant differences in the process at different temperatures
showing an optimum at 25 ordmC for our microbial consortium growth (Figure 2) whereas when
consortium was incubated at 20 ordmC and 30 ordmC microorganisms remained in lag phase These
results were in agreement with the fact that respiration increases exponentially with
temperature (Q10 relationship) (Lloyd amp Taylor 1994) but increasing or decreasing
temperature beyond the optimal value will cause a reduction in microbial respiration We
suggest that moderate fluctuation of temperatures affect microbial growth rate but not
degradation rates because degrading population is able to degrade PAH efficiently in a
temperature range between 20-30 ordmC (Sartoros et al 2005)
The nutrient requirements for microorganisms increase during the biodegradation
process so a low CNP molar ratio can result in a reduced of the metabolic activity of the
degrader microorganisms and thus reduce their potential degrader (Leys et al 2004)
According to this author CNP ratios above 100101 provide enough nutrients to metabolize
the pollutants However our results showed that the CNP ratios supplied to the cultures
even the ratio 100505 did not affect the CDI and total PD This results indicate that the
consortium C2PL05 is able to degrade PAH even under low nutrients conditions due to its
high adaptation to the hard conditions of a chronically contaminated soil The results
concerning the addition of different nitrogen and iron sources did not show significant
difference in CDI and total PD Other works (Schelessinger 1991 Santos et al 2008) have
suggested that the addition of nitrogen in form of nitrates (Schelessinger 1991) and the iron
in form of sulphates or chlorides (Santos et al 2008) is more effective due to their high
solubility
The addition of readily biodegradable carbon source as glucose to a polluted
environment is considered an alternative to promote biodegradation The easy assimilation of
this compound result in an increase in total biomass (heterotrophic and PAH degrader
microorganisms) of the microbial population thereby increasing the degradation capacity of
the community Piruvate are a carbon source that promote the growth of certain degrading
strains as Pseudomonas putida (Lee et al 2003) whereas salicylate induces the synthesis
and activation of degradative enzymes (Chen amp Aitken 1999) Similarly to previous results
observed by Wong et al (2000) in the present study the addition of glucose to the cultures
had significant effects in total PD and CDI (Figure 1 Figure 2) Although the consortium
C2PL05 showed a significantly better growth with 80 of glucose the difference between
treatments (0100 5050 8020 of glucosePAH) showed that PD was higher when PAH
were added as only carbon source Previously it has been described that after a change in
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
79
the type of carbon source supplied to PAH-degrader microorganisms an adaptation period
for the enzymatic system was required reducing the mineralization rate of pollutants (Wong
et al 2000 Maier 2009 Simarro et al 2010) As glucose was added as additional carbon
source our results show an increase in CDI although the PD values decrease significantly
This indicated that glucose enhance the overall growth of consortium but decrease the
biodegradation rate of PAH-degrader population due to the adaptation of the corresponding
enzymatic system So in this case the addition of a readily carbon source retards the
biodegradation process The addition of surfactant to the culture media at concentration
above their CMC is essential to increase PAH degradation rate (Pantsyrnaya et al 2011)
However Yuan et al (2000) reported negative effects when the surfactant was added at
concentration above the CMC because the excess of micelles around PAH reduces their
bioavailability (Mulligan et al 2001) However our results showed that PD and CDI were not
affected by concentrations largely beyond the CMC Some non biodegradable surfactants
can be toxic to bacteria and therefore do not improve the biodegradation process (Bautista et
al 2009) Tween-80 was the optimal surfactant for the strains of the consortium C2PL05
(Bautista et al 2009) However the optimal type of surfactant is determined by the type of
degrading strains involved in the process (Bautista et al 2009) In addition it is important to
consider the possible use of surfactant as a carbon source by the strains preferentially to
PAHs which would reduce the rates of biodegradation (Kim amp Weber 2003)
Further dilution of the inoculum represents the elimination of minority species which
could result in a decrease in the degradation ability of the consortium if the eliminated
species represented an important role in the biodegradation process (Szaboacute et al 2007)
Our results concerning the inoculum concentration showed that this factor significantly
influenced in CDI but had no effect on total PD indicating that the degrading ability of the
consortium has not been altered by the dilution of the same In Gonzalez et al (2011) the
evolution and bacterial succession of the consortium C2PL05 by culture-dependent
techniques are described All of these identified strains were efficient in degradation of PAH
(Bautista et al 2009) but Enterobacter sp was dominant at the beginning of the degradation
process whereas Stenotrophomonas sp and Pseudomonas sp were less abundant In
addition DGGE fingerprint pattern studied and described in Molina et al (2009) showed a
low microbial diversity of the consortium C2PL05 typical of an enriched consortium from
chronically contaminated soil (Vintildeas et al 2005) The results present in this work suggest
that in cultures inoculated with the highest dilution of the consortium (10-3) the less abundant
microorganisms were eliminated reducing the competition for the dominant species which
can grow vigorously
80
The influence of some environmental factors on the biodegradation of PAH can
undermine the effectiveness of the process In this study the combination of all factors
simultaneously by an orthogonal design has allowed to establish considering the interactions
between them the most influential parameters in biodegradation process Finally we
conclude that the only determining factor in biodegradation by consortium C2PL05 is the
carbon source Although cell growth is affected by temperature carbon source and inoculum
dilution these factors not condition the effectiveness of degradation Therefore the optimal
condition for a more efficient degradation by consortium C2PL05 is that the carbon source is
only PAH
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Maacutester en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
81
References
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Boochan S Britz ML amp Stanley GA 1998 Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophila
Biotechnol Bioeng 59 482-494
Chen S-H amp Aitken MD 1999 Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
EnvironSci Technol 33 435ndash439
Chen J Wong MH Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAHs) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in Artic Tundra soil Appl EnvironMicrobiol 67 5107-
5112
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438-9446
Heitkamp MA amp Cerniglia CE 1998 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from Sediment below an oil field Appl EnvironMicrobiol 54
1612-1614
Jin D Jiang X Jing X amp Ou Z 2007 Effects of concenrtration head group and structure of
surfactants on the biodegradation of phenanthrene J Hazard Mater 144 215-221
Kim HS amp Weber WJ 2003 Preferential surfactant utilization by a PAH-degrading strain
effects on micellar solubilization phenomena Environ Sci Technol 37 3574-3580
Laha S amp Luthy RG 1992 Effect of non-ionic surfactants on the solubilization and
mineralization of phenanthrene in soil-water systems Biotechnol Bioeng 40 1367-
1380
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegradation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Leys MN Bastiaens L Verstraete W amp Springael D 2004 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Lloyd J amp Taylor JA 1994 On the temperature dependence of soil respiration Funct Ecol
8 315-323
82
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mulligan CN Young RN amp Gibbs BF 2001 Surfactant enhanced remediation of
contaminated soil a review Eng Geol 60 371-380
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Molecular microbial ecology manual
(Eds Akkermans ADL van Elsas JD Bruijn FJ) Kluwer Academic Publishers
Dordrecht pp 1-23
Pantsyrnaya T Blanchard F Delaunay S Georgen JL Geacuteudon E Guseva E amp Boudrant
J 2011 Effect of surfactants dispersion and temperature on solubility and
biodegradation of phenanthrene in aqueous media Chemosphere 83 29-33
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation and surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Sartoros C Yerushalmi L Beroacuten L amp Guiot S 2005 Effects of surfactant and temperature
on biotransformation kinetics of anthracene and pyrene Chemistry 61 1042-1050
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Sudipt KS Om VS amp Rakesh KJ 2002 Polycyclic aromatic hydrocarbons environmental
pollution and bioremediation Trends Biotechnol 20 243ndash248
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquatic Microbl Ecol 47 1-10
Thibault SL Anderson M amp Frankenberger WTJr 1996 Influence of surfactant on pyrene
desorption and degradation in soils Appl Environ Microbiol 62 283-287
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Poll 139 1-13
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
83
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon degrading bacteria by most-probably-number (MPN) Can J Microbiol
4 252-258
Yuan SY Wei SH amp Chang BV 2000 Biodegradation of polycyclic aromatic
hydrocarbons by a mixed culture Chemosphere 41 1463-1468
Capiacutetulo
Publicado en Bioresource Technology (2011) 102 9438-9446
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA
Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process
Efecto de los surfactantes en la biodegradacioacuten de HAP por un consorcio bacteriano y dinaacutemica de la comunidad
bacteriana durante el proceso
2
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
87
Abstract
The aim of this work was to evaluate the effect of a non-biodegradable (Tergitol NP-10) and
a biodegradable (Tween-80) surfactant on growth degradation rate and microbial dynamics
of a polycyclic aromatic hydrocarbon (PAHs) degrading consortium (C2PL05) from a
petroleum polluted soil applying cultivable and non cultivable techniques Growth and
degradation rate were significantly lower with Tergitol NP-10 than that with Tween-80
Toxicity did not show any significant reduction with Tergitol NP-10 whereas with Tween-80
toxicity was almost depleted (30) after 40 days Regarding to the cultured bacteria
Pseudomonas and Stenotrophomonas groups were dominant during PAH degradation with
Tergitol NP-10 whereas Enterobacter and Stenotrophomonas were dominant with Tween-80
DGGE analyses (PRIMER and MDS) showed that bacteria composition was more similar
between treatments when PAHs were consumed than when PAHs concentration was still
high Community changes between treatments were a consequence of Pseudomonas sp
Sphingomonas sp Sphingobium sp and Agromonas sp
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
89
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic pollutants composed of two
or more fused aromatic rings produced by natural and anthropogenic sources Besides
being toxic carcinogenic and mutagenic compounds the semi-volatile properties of some
PAH make them highly mobile throughout the environment (air soil and water) In addition
PAH have a high trophic transfer and biomagnification within the ecosystems due to the
lipophilic nature and the low water solubility that decreases with molecular weight (Clements
et al 1994) The importance of preventing PAH contamination and the need to remove PAH
from the environment has been recognized institutionally by the Unites States Environmental
Protection Agency (US-EPA) which has proposed 16 PAH as priority pollutants including
naphthalene phenanthrene and anthracene Currently governmental agencies scientist and
engineers have focused their efforts to identify the best methods to remove transform or
isolate these pollutants through a variety of physical chemical and biological processes
Most of these techniques involve expensive manipulation of the pollutant transferring the
problem from one site or phase to another (ie to the atmosphere in the case of cremation)
(Haritash amp Kausshik 2009) However microbial degradation is one of the most important
processes that PAH may undergo compared to others such as photolysis and volatilization
Therefore bioremediation can be an important alternative to transform PAH to less or not
hazardous forms with less input of chemicals energy and time (Haritash amp Kaushik 2009)
Most of the contaminated sites are characterized by the presence of complex mixtures
of pollutants Microorganisms are very sensitive to low concentrations of contaminants and
respond rapidly to environment perturbations (Andreoni et al 2004) Therefore microbial
communities chronically exposed to PAH tend to be dominated by those organisms capable
of use PAH as carbon and energy source (Gallego et al 2007) Even in areas previously
unpolluted there is a proportion of microbial community composed by PAH degrading
bacteria able to degrade PAH (Surridge et al 2009) These microbial communities subjected
to a polluted stress tend to be less diverse depending on the complexity of the composition
and the time of exposure (MacNaughton et al 1999) The biodegradation of hazardous
compounds by bacteria fungi and algae has been widely studied and the success of the
process will be due in part to the ability of the microbes to degrade all the complex pollutant
mixture However most of the PAH degradation studies reported in the literature have used
versatile single strains or have constructed an artificial microbial consortium showing ability
to grow with PAH as only carbon source by mixing together several known strains (Ghazali et
al 2004) Nevertheless pure cultures and synthetic microbial consortia do not represent the
natural behaviour of microbes in the environment since the cooperation among the new
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
90
species is altered In addition changes in microbial communities during pollutant
biotransformation processes are still not deeply studied Microbial diversity in soil
ecosystems can reach values up to 10 billion microorganisms per gram and possibly
thousands of different species although less than 10 can be culturables (Torsvik amp Ovreas
2002) Therefore additional information on biodiversity ecology dynamics and richness of
the degrading microbial community can be obtained by non-culturable techniques such as
DGGE In addition small bacteria cells are not culturable whereas large cells are supposed
to account 80 of the total bacterial volume (Nannipieri et al 2003) Therefore despite their
low proportion culturable bacteria can provide essential information about the structure and
functioning of the microbial communities With the view focused on the final bioremediation
culture-dependent techniques are necessary to obtain microorganisms with the desired
catabolic traits for bioaugmentation processes in polluted soils The PAH degradation is
limited by their low aqueous solubility but surfactants which are amphypatic molecules
enhance the solubility of hydrophobic compounds (Kolomytseva et al 2009) Previous works
(Bautista et al 2009) have shown that efficiency of a consortium named C2PL05 composed
by PAH degrading bacteria was significantly higher using surfactants
One of the main goals of the current work was to understand if culturable and non
culturable techniques are complementary to cover the full richness of a soil microbial
consortium A second purpose of the study was to describe the effect of different surfactants
(biodegradable and non-biodegradable) on growth rate PAH degradation rate and toxicity
reduction of a bacterial consortium (C2PL05) The microbial consortium C2PL05 was
isolated from a soil chronically exposed to petroleum products collected from a
petrochemical complex Finally the work is also aimed to describe the microbial dynamics
along the biodegradation process as a function of the surfactant used to increase the
bioavailability of the PAH
Material and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all 99 purity) were purchased from Sigmandash
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) Reagent grade
dichloromethane and n-hexane were supplied by Scharlau Chemie (Barcelona Spain)
Surfactants (Tween-80 and Tergitol NP-10) used were supplied by Sigma-Aldrich (Steinheim
Alemania) Bushnell-Haas Broth medium (BHB) was purchased from Panreac (Barcelona
Spain) and its composition is 02 g l-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 10 gmiddotl-1 KHPO4
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
91
10 gmiddotl-1 K2HPO4 10 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 Luria-Bertani media (LB) glucose and
phosphate buffer saline (PBS) were purchased from Panreac (Barcelona Spain)
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1 g of sieved soil (lt2 mm) was resuspended in
10 ml of PBS and incubated during 12 h in an orbital shaker (Innova 40 New Brunswick
Scientific Edison NJ USA) at 150 rpm and 25 ordmC under dark conditions After that 15 ml of
the supernatant was inoculated in 50 ml of BHB broth (pH 70) containing 1 wt Tween-80
as surfactant and naphthalene phenanthrene and anthracene (each at 250 mg l-1) as carbon
source Then the culture was incubated at 150 rpm and 25 ordmC under dark conditions until the
exponential phase was completed This was confirmed by monitoring the cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK) Then the consortium was stored at 4 ordmC to
stop growth At the beginning of each experiment 500 μl of the stored consortium (asymp 16 AU)
was inoculated in Erlenmeyer flasks
Experimental design and treatments conditions
To evaluate the influence of Tween-80 and Tergitol NP-10 (biodegradable and non-
biodegradable surfactant respectively) on the degrading capacity of the consortium C2PL05
as well as the evolution of its microbial community two different treatments each in triplicate
were carried out The replicates were performed in 100 ml Erlenmeyer flasks with 50 ml of
BHB medium (pH 70) Tween-80 or Tergitol NP-10 as surfactants (1 vv) a mixture of
naphthalene phenanthrene and anthracene in n-hexane (final concentration 500 mgmiddotl-1) and
500 microl of the C2PL05 consortium (88middot108 heterotrophic cellsmiddotml-1 and 44middot107 PAH degrading
cellsmiddotml-1 for the treatments with Tween-80 73middot105 heterotrophic cellsmiddotml-1 and 24middot103 PAH
degrading cellsmiddotml-1 for treatment with Tergitol NP-10) The replicates were incubated in an
orbital shaker (Innova 40) at 150 rpm and 25 ordmC under dark conditions during 45 days
Previously to inoculate the consortium the Erlenmeyer flasks were shaked overnight to
reach the solubility equilibrium of PAH and to allow the complete evaporation of n-hexane
Samples vigorously shaking to ensure homogeneity were withdrawn twice a day for 45 days
except for the initial 24 hours where the sampling frequency was higher Cell growth PAH
(soluble and precipitated) toxicity and number of heterotrophic and PAH degrading cells
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
92
were measures in all samples To study the dynamic of the microbial consortium through
cultivable and non-cultivable methods samples were withdrawn at 0 15 and 30 days
Bacterial growth MPN and toxicity assays
Bacterial growth was monitored by changes in the absorbance of the culture media at 600
nm using a Spectronic Genesys spectrophotometer According to the Monod equation
(Equation 1) the specific growth rate micro is essentially equal to micromax when substrate limitation
is avoided
SK
S
S
max
(Equation 1)
Therefore from the above optical density data the maximum specific growth rate (micromax)
was estimated as the logarithmized slope of the exponential phase applying the following
equation (Equation 2)
Xdt
dX (Equation 2)
where micromax is the maximum specific growth rate Ks is the half-saturation constant S
is the substrate concentration X is the cell density t is time and micro is the specific
growth rate In order to evaluate the ability of the consortium to growth with
surfactants as only carbon source two parallel treatments were carried out at the
same conditions than the two treatments above described but in absence of PAH
Heterotrophic and PAH-degrading population from the consortium C2PL05 were
enumerated during the PAH degrading process comparing the effect of Tergitol NP-10 and
Tween-80 as surfactants The estimation was performed by using a miniaturized MPN
technique in 96-well microtiter plates with eight replicate wells per dilution Total
heterotrophic microbial population was enumerated in 180 μl of Luria Bertani (LB) medium
with glucose (15 gmiddotl-1) and 20 microl of the microbial consortium PHA-degrading population were
counted in BHB medium (180 microl including the surfactant) 20 microl of a mixture of phenanthrene
anthracene and naphthalene in hexane (each at a final concentration of 500 mgmiddotl-1) and 20 microl
of the microbial consortium in each well The MPN scores were transformed into density
estimates accounting for their corresponding dilution factors
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
93
The toxicity was monitored during PAH degradation and estimations were carried out
using the Microtox assay with the bioluminescent bacterium Vibrio fischeri Three controls
considered as 0 inhibition were prepared with the photobacterium and 2 NaCl (vv) and
three blanks as 100 inhibition containing only 2 NaCl (vv) Samples were salted with
NaCl (2 vv final concentration) and the toxicity was expressed as the percentage of the V
fischeri inhibition after 15 min of incubation at 15 ordmC To study the toxicity of the medium
caused by PAH when the surfactants were not added toxicity evolution was measured from
a treatment with PAH as carbon source and degrading consortia but without surfactant under
same conditions previously described
PAH monitoring
In order to compare the effect of the surfactant on the PAH depletion rate naphthalene
phenanthrene and anthracene concentrations in the culture media were analysed using a
reversed-phase C18 column (Luna C18(2) 75 cm length x 46 mm ID 3 microm particle size
Phenomenex Torrance CA USA) following the method described elsewhere (Bautista et
al 2009) The concentration of each PAH was calculated from a standard curve based on
peak area at 254 nm The apparent first-order kinetic constant (kB) due to biotic processes
was calculated by applying Equation 3
iBiiAii
i CkCkdt
dCr (Equation 3)
where C is the PAH concentration kA is the apparent first-order kinetic constant due to
abiotic processes kB is the apparent first-order kinetic constant due to biological
processes t is the time elapsed and the subscript i corresponds to each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40) at 150 rpm and 25ordmC under dark
conditions PAH concentration in the control experiments were analyzed using the HPLC
system described previously The values of kA for each PAH were calculated by applying Eq
2 considering kB asymp 0 since no bacterial consortium was inoculated The amount of
precipitated and bioadsorbed PAH was measured after centrifugation of the samples Then
dichloromethane was added to the pellet and this extraction was repeated three times and
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
94
the fractions pooled The solvent was evaporated using a nitrogen flow and the extract was
dissolved into a known volume of acetonitrile for HPLC analysis
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
Samples from cultures of the bacterial consortium C2PL05 during the PAH degrading
process were collected to identify the effect of the surfactants (Tergitol NP-10 and Tween-80)
To get about 20-30 colonies isolated at each collecting time samples of each treatment were
streaked onto Petri plates with BHB medium and purified agar and were sprayed with a
mixture of naphthalene phenanthrene and anthracene in n-hexane (final concentration 500
mgl-1) as carbon source The Petri plates were incubated at 25 ordmC under dark conditions
The isolated colonies were transferred onto LB agar-glucose plates in order to increase
microbial biomass for DNA extraction and stored in 50 glycerol (vv) at -80 ordmC In total 91
degrading colonies from the treatment with Tween-80 and 83 degrading colonies from the
treatment with Tergitol NP-10 were isolated
Total DNA was extracted using Microbial DNA isolation kit (MoBio Laboratories
Solano Beach CA USA) to perform the molecular identification of the PAH-degrader
isolated cultured (DIC) Amplification of the 16S rRNA coding region of the DNA was
performed as described by Vintildeas et al (2005) using the primers 16F27 (5rsquo-
AGAGTTTGATCMTGGCTCAG-3rsquo) and 16R1488 (5rsquo-TTACCTTGTTACGACTTCAGG-3rsquo) and
sequenced using the same primers Sequences were edited and assembled using
ChromasPro software version 142 (Technelysium Pty Ltd Tewantin Australia)
All of the 16S rRNA gene sequences were edited and assembled by using BioEdit
software version 487 BLAST search (Madden et al 1996) was used to find nearly identical
sequences for the 16S rRNA sequences determined Sequences were aligned using the Q-
INS-i algorithm (Katoh amp Toh 2008) of the multiple sequence alignment software MAFFT
version 6611 aligning sequences in a single step Sequence data obtained and 34
sequences downloaded from GenBank were used to perform the phylogenetic trees
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates by using PAUP
version 40B10 Maximum parsimony (MP) was also analyzed using PAUP 40B10 as is
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
95
described in Molina et al (2009) Sequences of Aquifex piruphilus were used as out-group
according to previous phylogenetic affiliations (Vintildeas et al 2005)
Denaturing gradient gel electrophoresis from microbial consortium during PAH degrading
process
Non culture dependent molecular techniques such as denaturing gradient gel
electrophoresis (DGGE) were performed to know the effect of the surfactant on the total
biodiversity of the microbial consortium C2PL05 during the PAH degradation process and
compared with the initial composition of the consortium The V3 to V5 variable regions of the
16S rRNA gene were amplified using the primers set 16S 518F and 16S 338R-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primers 338R-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded onto a 10
(wtvol) polyacrilamide gels that was 075 mm tick with a denaturing gradient of 35-65
(100 denaturant contained 7 M urea and 40 formamide) DGGE was performed in 1xTAE
buffer (20 M Tris-acetate 100 mM Na2EDTA pH 74) using a DGGE 2401 system (CBS
Scientific Co Del Mar CA USA) at 80 V and 60 ordmC for 16 h Gels were stained for 45 min in
1xTAE buffer containing Syber-Gold (500 μlmiddotl-1) and viewed under UV light Predominant
bands in DGGE gel were excised with a sterile razor blade and diluted in 50 μl of deionized
water overnight at 4ordmC Due to impossibility of reamplified bands DNA of the bands was
cloned in the pGEM-T Easy Vector (Promega Madison WI) Sequence of this PAH-degrader
uncultured bacterium (DUB) were edited and assembled as described above and included in
the matrix to perform the phylogenetic tree as described previously using the identification
code DUB
Statistical analyses
The maximum specific growth rate (micromax) and the kinetic constant of PAH biodegradation (kB)
were evaluated by both one and two-way analysis of variance (ANOVA) using Statistica 60
software (Statsoft Inc Tulsa OK USA) to determine differences between PAH (naphthalene
phenanthrene and anthracene) and surfactants (Tween-80 and Tergitol NP-10) Prior to
analyses Cochranrsquos C-test was used to check the assumption of homogeneity of variances
Student-Newman-Keuls test (SNK) was used to discriminate among different treatments after
significant F-test Differences in microbial assemblages were graphically evaluated for each
factor combination (surfactant and time) with non-metric multidimensional scaling (MDS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
96
using PRIMER software SIMPER method was used to identify the percent contribution of
each band to the dissimilarity or similarity in microbial assemblages between and within
combination of factors Based on Viejo (2009) bands were considered ldquohighly influentialrdquo if
they contributed to the first 70 of cumulative percentage of average dissimilaritysimilarity
betweenwithin combination of factors
Results and discussion
Bacterial growth and toxicity media during biodegradation of PAH
Since some surfactants can be used as carbon sources cell growth of the consortium was
measured with surfactant and PAH and only with surfactant without PAH to test the ability of
consortium to degrade and grow with both surfactants (Figure 1A) The microbial consortium
C2PL05 growth was significantly lower with Tergitol NP-10 than that reached with Tween-80
which showed the best cell growth with a maximum density (Figure 1A) In addition the
growth curve with PAH and Tergitol NP-10 showed a longer latent phase (36 hours) than
with PAH and Tween-80 (lt 12 hours) The specific growth rate (micromax) of the consortium
C2PL05 was significantly higher (Table 1A) with Tween-80 than that with Tergitol NP-10 The
results showed that Tween-80 was biodegradable for consortium C2PL05 since that
surfactant was used as the only carbon source (Figure 1A) Finally when using Tergitol NP-
10 as the only carbon source growth was not observed so that this surfactant was not
considered biodegradable for the consortium
Toxicity test (bioluminescence inhibition in Vibrio fischeri) indicates that high values
observed during the PAH degrading process with Tergitol NP-10 is caused at the initial time
by both PAH and surfactant (Figure 1B) However when PAH are totally consumed (40-45
days) toxicity still remained high and constant which means that toxicity is only due to the
Tergitol NP-10 (Figure 1B) The toxicity of PAH + biodegradable surfactant (Tween-80)
treatment decreased as the PAH and the surfactant were consumed and was almost
depleted (30) after 40 days of cultivation The toxicity showed a slight increment at the
beginning of the degradation process (Figure 1B) as a consequence of the potential
accumulation of intermediate PAH degradation products (Molina et al 2009)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
97
00
02
04
06
08
10
12
14
16
18
0 5 10 15 20 25 30 35 40 45
30
40
50
60
70
80
90
100
Tox
icity
(
)
Time (day)
B
A
Abs
orba
nce 60
0 nm
(A
U)
Figure 1 (A) Cell density of the consortium C2PL05 with PAH and Tween-80 () with
Tween-80 () with PAH and Tergitol NP-10() and with Tergitol NP-10 () (B)
Toxicity of the cultivation media during degradation of PAH by the consortium C2PL05
grown with Tween-80 () Tergitol NP-10 () and of the control experiment PAHs
without surfactants ()
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
98
The residual total concentration of three PAH of the treatments with surfactants and
the treatments without any surfactants added is shown in Figure 2 The consortium was not
able to consume the PAH when surfactants were not added PAH biodegradation by the
consortium C2PL05 was higher and faster (15 days) with Tween-80 than with Tergitol NP-10
(40 days) In all cases when surfactant was used no significant amount of PAH were
detected in precipitated or bioadsorbed form at the end of each experiment which means
that all final residual PAHs were soluble
0 5 10 15 20 25 30 35 40 45
0
10
20
30
40
50
60
70
80
90
100
Res
idua
l con
cent
ratio
n of
PA
Hs
()
Time (days)
Figure 2 Residual total PAH concentration (wt) in the treatment with Tween-80
() Tergitol NP-10 () and without surfactant ()
According to previous works (Bautista et al 2009 Molina et al 2009) these results
confirm that this consortium is adapted to grow with PAH as only carbon source and can
degrade PAH efficiently when surfactant is added According to control experiments (PAH
without consortium C2PL05) phenathrene and anthracene concentration was not affected by
any abiotic process (kA asymp 0 h-1) in the case of naphthalene some degree of abiotic depletion
was measured during the controls yielding an apparent first-order abiotic rate constant of
27middot10-3 plusmn 7middot10-5 h-1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the treatments so this not influence in the high
biodegradation rate of naphthalene for Tween-80 treatments The biotic depletion rate (kB) of
the three PAH was significantly higher for Tween-80 than that calculated for Tergitol NP-10
(Table 1B) There were no significant differences between PAH for Tergitol NP-10 (2 x 10-3 plusmn
4 x 10-4) whereas in the case of Tween-80 the value of kB for naphthalene (3 x 10-2 plusmn 6 x 10-4)
was higher than that for phenanthrene and anthracene (1 x 10-2 plusmn 4 x 10-4)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
99
Table 1 Analysis of variance (ANOVA) for the effects of surfactants on the specific
growth rate micromax (A) and for the effects of the surfactants and PAH on the biotic
degradation rate kB (B) of the C2PL05 consortium SS is the sum of squares and df
the degrees of freedom
Effect (A) SS df F-value p-value
Surfactant 16 1 782 0001
Error 0021 2
Effect (B) SS df F-value p-value
PAH 15middot10-4 2 779 0001
Surfactant 82middot10-4 1 4042 0001
PAH x Surfactant 12middot10-4 2 624 0001
Error 203middot10-7 12
Molecular characterization of the cultured bacteria of the consortium C2PL05 and dynamics
during the PAH degradation
The identification of cultured microorganisms and their phylogenetic relationships are keys to
understand the biodegradation and ecological processes in the microbial consortia From the
consortium C2PL05 grown with Tween-80 91 strains were isolated and sequenced From
them 7 different genotypes of PAH-degrading cultures (DIC-1 JA DIC-2 JA DIC-5 JA DIC-6
JA DIC-7 JA DIC-8JA and DIC-9JA) were identified by 16S rRNA For the treatment with
Tergitol NP-10 83 strains were isolated and sequenced and 6 different genotypes were
identified (DIC-1 RS DIC-2 RS DIC-3 RS DIC-4 RS DIC-5 RS and DIC-6 JA) One of the
isolated cultures from Tergitol NP-10 showed an identical sequence to one of the strains
grown with Tween-80 therefore the previous code (DIC-6JA) was kept Table 2 show a
summary of the PAH-degrader cultures identification The aligned matrix contained 1576
unambiguous nucleotide position characters with 424 parsimony-informative Parsimony
analysis of the data matrix yielded 10 parsimonious trees with CI = 0609 and RI = 0873 In
the parsimonic consensus tree 758 of the clades were strongly supported by boostrap
values higher or equal to 70 (Figure 3) All cultivable strains identified were γ-
proteobacteria (gram-negative) and were located in three clades Pseudomonas clade
Enterobacter clade and Stenotrophomonas clade These results are consistent with those of
Vintildeas et al (2005) who observed a strong dominance of gram negative bacteria in PAH
contaminated soil during the bioremediation process In Pseudomonas clade (Figure 3) DIC
are located in three clearly groups So DIC-2RS and DIC-3RS were grouped with P
frederiksbergensis which has been previously described in polluted soils (ie Holtze et al
2006) showing ability to reduce the oxidative stress generated during the PAH degrading
process DIC-1JA DIC-2JA (Tween-80) and DIC-1RS (Tergitol NP-10) were nested in very
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
100
solid group characterized by the presence of the type strain P koreensis previously studied
as an agricultural soil species (Kwon et al 2003) and DIC-5RS was located in P putida
group well known by their capacity to degrade high molecular weight PAH (Samantha et al
2002) to produce surfactants (Kruijt et al 2009) and to resist high temperature and salinity
(Egamberdieva amp Kucharova 2009) So several species of Pseudomonas (ie P putida P
fluorescens) have been widely studied in bioremediation (Molina et al 2009) and the present
results confirmed that it was the most representative group with the non biodegraded
surfactant treatment DIC-7JA DIC-8JA and DIC-9JA (Tween-80) which were identified as E
cloacae (Table 2) belonged to the Enterobacter clade with a strongly statistic support (Figure
3) In this clade DIC-4RS (Tergitol NP-10) is genetically related with E ludwigii which has
been recently described as relevant medical species (Hoffman et al 2005) but completely
unknown his PAH degrading capacity Enterobacter genus has been traditionally studied by
its animal gut symbiotic function but rarely recognized as a soil PAH degrading group
(Toledo et al 2006) In this phylogenetic tree E cloacae and E ludwiggi were not resolved
This result is according to Roggenkamp (2007) who consider necessary to use more
molecular markers within Enterobacter taxonomical group in order to contrast the
phylogenetic relationships In addition Enterobacter genera may not be a monophyletic
group (Kampfer et al 2005) Therefore more phylogenetic studies need to be done to clarify
the species concept within this group Finally DIC-5JA (Tween-80) and DIC-6JA isolated
from experiments using both surfactants (Tween-80 and Tergitol NP) are clearly belong to
type strain Stenotrophomonas clade genetically close to S maltophiliaT (Table 2) which has
been described as PAH-degrader (Zocca et al 2004)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
101
Figure 3 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) from the consortium C2PL05 with Tergitol NP (DIC-1JA ndash DIC-9JA)
and Tween-80 (DIC-1RS ndash DIC-5RS) and PAH-degrader uncultured bacteria (DUB) obtained from
DGGE of the consortium with both surfactant at 0 15 and 30 days of the process Boostrap values of
neighbourjoining and parsimonus higher than 50 are showed on the branch of the tree (NJMP) No
incongruence between parsimony and neighbour joining topology were detected Pseudomonas
genus has been designated as P Pantoea genus as Pa Sphingobium as S and Sphingomonas as
Sp Xantomonas as X and Xyxella as Xy T= type strain
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
102
Table 2 Bacteria identification and percentage of similarity from the GenBank data base Degrading
uncultured bacteria (DUB) form DGGE bands and degrading isolates cultured (DIC)
Colonies identified by cultivable techniques
DIC simil Mayor relationship with bacteria
of GenBank(acc No) Phylogenetic group
DIC-1RSb 980 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ)
DIC-2RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-3RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-4RS b 990 Enterobacter ludwigii (AJ853891) Enterobacter cloacae (EU733519)
Enterobacteriaceae (γ)
DIC-5RS b 990 Pseudomonas putida (EU046322) Pseudomonadaceae (γ) DIC-6JA-6RS c 1000 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-1JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-2JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-5JA a 9964 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-7JA a 9985 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-8JA a 9993 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-9JA a 100 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ)
Identification by non-cultivable techniques
DUB Band
simil Mayor relationship with bacteria
of GenBank (acc No) Phylogenetic group
DUB-1RS a 1 970 Uncultured Nitrobacteria sp (AM990004) Caulobacteraceae (α) DUB-2RS b 21 980 Bradyrhizobium sp (HQ171485) Bradyrhizobiaceae (α) DUB-3RS b 24 940 Uncultured bacterium (AY939443) -- DUB-4RS b 24 100 Uncultured Pseudomonas sp (HM561497) Pseudomonadaceae (γ) DUB-10RSb 28 980 Uncultured Sphingomonas sp (HM438638) Sphingomonadaceae(α) DUB-11RSa 28 960 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-6RS b 29 980 Pseudomonas stutzeri (HQ130335) Pseudomonadaceae (γ) DUB-8RS b 29 980 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-5RS b 29 990 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-7RS b 29 980 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-9RS b 30 970 Bacterium (AJ295668) --
a DIC or DUB belonging to treatments with Tween-80 b DIC or DUB belonging to treatments with Tergitol NP-10 c DIC or DUB belonging to treatments with Tween-80 and Tergitol NP-10
With respect to the dynamics of the microorganisms isolated from the microbial
consortium C2PL05 (Figure 4) Pseudomonas (DIC-1RS DIC-2RS and DIC-5RS Figure 4A
4B) with a percentage around 60 and Stenotrophomonas (only DIC-6JA Figure 4A and
4D) with presence of 90 were dominant groups during the PAH degrading process with
Tergitol NP-10 at 0 and 30 days in the case of Pseudomonas and at 15 days in the case of
Stenothrophomonas Enterobacter (DIC-4RS Figure 4A 4D) only was present at the end of
the process with a percentage around 40 With Tergitol NP-10 Pseudomonas sp group
was dominant coincident with the highest relative contribution of PAH degrading bacteria to
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
103
total heterotrophic bacteria at the beginning (33 of contribution) and at the end of the
degradation process (41) However Enterobacter (DIC-7JA DIC-8JA and DIC-9JA Figure
4E and 4H) with a maximum presence of 98 at 0 days and Stenotrophomonas (DIC-6JA
Figure 4E and 4G) with a maximum presence of 85 at the end of the process were
dominant with the biodegradable Tween-80 Thus Enterobacter sp seems to start the PAH
degradation process and Stenotrophomonas to finish it but at 15 days three groups coexist
within a contribution ranging 20 to 50 (Figure 4E) Therefore in agreement with other
authors (Colores et al 2000) the results of the present work confirm changes in the
bacterial (cultured and non-cultured) consortium succession during the PAH degrading
process driven by surfactant effects According to Allen et al (1999) the diversity of the
bacteria cellular walls may explain the different tolerance to grow depending on the
surfactant used Previous works (Piskonen amp Itaumlvaara 2004) have shown the capacity of
some bacteria to use both surfactants (Tergitol NP-10 and Tween-80) as carbon sources
However in agreement with recent studies (Bautista et al 2009) the present work confirms
that Tergitol NP-10 is not degradable by the consortium C2PL05 These results showed a
drastic change of the consortium composition after the addition of surfactant
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
104
0 15 30
0102030405060708090
100
102030405060708090
100
D
C
B
A
0 15 30
F DIC-1JA DIC-2JA
E
G DIC-6JA DIC-5JA
0 15 30
H
Time (day)
DIC-7JA DIC-8JA DIC-9JA
Pse
udom
onas
ribot
ypes
(
)
DIC-1RS DIC-2RS DIC-3RS DIC-5RS
102030405060708090
100
Ste
notr
opho
mon
as
ribot
ypes
(
)
DIC-6JA
0 15 30
102030405060708090
100
Ent
erob
acte
r rib
otyp
es (
)
DIC-4RS
Time (days)
Tot
al s
trai
ns (
)
Figure 4 (A) Dynamics of the microbial consortium C2PL05 during PAH degradation process with
Tergitol NP-10 and (E) with Tween-80 as surfactants Isolated and identified genus were
Pseudomonas () Stenotrophomonas () and Enterobacter () Dynamics and succession of
the (B) Pseudomonas (C) Stenotrophomonas and (D) Enterobacter ribotypes with Tergitol NP-10
as surfactant Dynamics and succession of the (F) Pseudomonas (G) Stenotrophomonas and (H)
Enterobacter ribotypes
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
105
Biodiversity and evolution of the non-cultivable bacteria of the consortium during PAH
degradation
The most influential DGGE bands to similarity 70 of contribution according to the results of
PRIMER analyses were cloned and identified allowing to know the bands and species
responsible of similarities and dissimilarities SIMPER procedure (Clarke 1993) was used to
identify the percentage contribution () that each band made to the measures of the Bray-
Curtis similarity between treatments at each surfactant (Tween-80 and Tergitol-NP) and time
(initial time after 15 and 30 days) Bands were selected as lsquoimportantrsquo to be identified if they
contributed to the first 70 of cumulative percentage of average similarity between
treatments Summary of the identification process are shown in Table 2 Phylogenetic
relationship of these degrading uncultured bacteria was included in the previous
parsymonious tree (Figure 3) In total 11 uncultured bacteria were identified DUB-4RS
DUB-6RS DUB-8RS and DUB-11RS were located in the Pseudomonas clade but these
uncultured bacteria were no grouped with a particular species of the genus DUB-5RS DUB-
7RS were identified as Sphingobium sp and DUB-10RS as Sphingomonas sp and located
in the Sphingobium and Sphingomonas clade respectivelly DUB-2RS was nested in
Bradyrhizobium clade because was identified as Bradyrhizobium sp and this clade was
supported by the type strain B japonicum In the same way DUB-1RS identified as
Uncultured Nitrobacteria was located in the Nitrobacteria clade belonged to N
hamadeniensis type strain Finally DUB-3RS and DUB-9RS were not identified with a
particular genus so they were located in a clade composed by uncultured bacteria The
phylogenetic relationship of these degrading uncultured bacteria allows expanding
knowledge about the consortium composition and process development Some of them
belong to α-proteobacteria DUB-5RS and DUB-7RS were related to Sphingobium group and
DUB-10RS with Sphingomonas clade thought this relationship should be confirmed
considering the low boostrap values Sphingomonas is a genus frequently isolated as PAH
degrader (Jing et al 2007) and important in the degradation of phenanthrene metabolites
(Tao et al 2007) Similarly Sphingobium sp has been described as PAH degrader
specifically in phenanthrene degradation process (Jing et al 2007) DUB-2RS belonged to
Bradyrhizobiaceae phylogenetic group and although Bradyrhizobium are genera barely
described as PAH degrading bacteria some studies based on PAH degradation by chemical
oxidation and biodegradation process have described that this plant-associated bacteria are
involved in the degradation of extracting agent used in PAH biodegradation techniques in
soils (Rafin et al 2009) DUB-1RS is a genotype related to Nitrobacteria clade However
Nitrobacteria has not been described as PAH degrader but this bacteria transform nitrites in
nitrates from the oxidation of nitrites (Modrogan et al 2010) and it is likely involved in the
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
106
nitrites oxidation process when the bioavailability of PAH in the media are low and so it is
not toxic for this bacteria Finally DUB-8RS DUB-6RS and DUB-11RS showed a high
similitude with Pseudomonas strain though the phylogenetic relationship with Pseudomonas
clade of DUB-11RS should be confirmed
Analysis of DGGE gel (Figure 5) showed that treatment with Tergitol NP-10 had very
few changes during biodegradation process whereas when the consortium was grown with
the biodegradable surfactant Tween-80 more changes were observed Similarity (Table 3)
between treatments were compared and analyzed by type of surfactant (Tween-80 vs
Tergitol NP-10) or by sampling time (15 days vs 30 days) The MDS analysis (Table 3)
showed the lowest values of Bray Curtis similarity coefficient between the consortium at
initial time (T0 not exposed to PAH and surfactants) with the PAH and Tween-80 after 15
days (16) and 30 days (7) However the similarity of T0 with PAH and Tergitol NP-10 after 15
days (22) and 30 days (26) was much higher Similarity between time treatments (15 and 30
days) within Tergitol NP-10 (56) was higher than with Tween-80 (32) The similarity within
treatments with Tween-80 was mainly due to the bands 1 and 29 (Table 3 Uncultured
Nitrobacteria and Sphingobium and Pseudomonas respectively see Table 2) whereas the
similarity within Tergitol NP-10 treatment was due to bands 1 and 30 (Table 3 Uncultured
Nitrobacteria and Uncultured bacteria respectively see Table 2)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
107
Figure 5 Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen fragments
from the consortium C2PL05 with initial inoculum (lane 1) with Tween-80 at 15 (lane 2) and 30 (lane 4)
days with Tergitol NP-10 at 15 (lane 3) and 30 (lane 5) days and molecular weight markers (lane 0)
According to PRIMER analysis similar bands between treatments (15 and 30 days) with Tergitol NP-
10 () and between treatments (15 and 30 days) with Tween-80 () are shown
1 Uncultured Nitrobacteria sp(DUB-1RS) 21 Bradyrhizobium sp (DUB-2RS) 24 Uncultured bacterium (DUB-3RS)
Uncultured Pseudomonas (DUB-4RS) 28 Uncultured Sphingomonas sp (DUB-10RS)
Pseudomonas sp (DUB-11RS) 29 Pseudomonas stutzeri (DUB-6RS) Pseudomonas sp
(DUB-8RS) Sphingobium sp(DUB-5RS DUB-7RS)
30 Uncultured Bacterium (DUB-9RS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
108
Table 3 Bands contributing to approximately the first 70 of cumulative percentage
of average similarity () Bands were grouped by surfactant and time
Band Tween-80 TergitolNP-10 15 days 30 days 1 3828 2105 2707 3014 29 2969 1509
30 2469 19
24 881 3447
27 845
21 516
Cumulative similarity () 3168 4479 4479 3391 Cloning was not possible
The genera identified in this work have been previously described as capable to
degrade the three PAH completely and efficiently with a reduction of the toxicity (Bautista et
al 2009) In the case of the treatment with Tween-80 the lower biodiversity may be caused
by a few dominant species of these genera driven during the PAH degradation process by
antagonist and synergic bacterial interactions and not by differences in the functional
capacities However when consortium grows with a non-biodegradable surfactant there is
higher biodiversity of species and interaction because the activity of various functional
groups can be required to deal the unfavorable environmental conditions
Conclusions
The choice of surfactants to increase bioavailability of pollutants is critical for in situ
bioremediation because toxicity can persist when surfactants are not biodegraded
Nevertheless surfactants affect the dynamics of microbial populations in a stable PAH-
degrading consortium From the application point of view the combination of culturable and
non culturable identification techniques may let to optimize the bioremediation process For
bioaugmentation processes culturable tools help to select the more appropriate bacteria
allowing growing enough biomass before adding to the environment However for
biostimulation process it is important to know the complete consortium composition to
enhance their natural activities
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
109
Acknowledgment
Authors are deeply indebted to Raquel Sanz Laura Saacutenchez and Laura Garciacutea and for their
support during the development of the experiments Authors also gratefully acknowledged
the financial support from the Spanish Ministry of Environment (Research project 1320062-
11) and Fundacioacuten Alfonso Martiacuten Escudero Authors also thank Repsol-YPF for providing
the soil samples This work is framed within the Official Maacutester en Ciencia y Tecnologiacutea
Ambiental from Universidad Rey Juan Carlos
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
110
References
Allen CRC Boyd DR Hempenstall F Larkin MJ amp Sharma D 1999 Contrasting effects
of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons
to cis-dihydrodiols by soil bacteria Appl Environ Microbiol 65 1335-1339
Andreoni V Cavalca L Rao MA Nocerino G Bernasconi S DellrsquoAmico E Colombo M
amp Gianfreda L 2004 Bacterial communities and enzyme activities of PAH polluted
soils Chemosphere 57 401-412
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 30 1ndash10
Clements WH Oris JT amp Wissing TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Lepomis macrochirus
Archiv Environ Contam Toxicol 26 261ndash266
Colores GM Macur RE Ward DM amp Inskeep WP 2000 Molecular analysis of
surfactant-driven microbial population shifts in hydrcarbon-contaminated soil Appl
Environ Microbiol 66 2959-2964
Egamberdieva D A amp Kucharova Z 2009 Selection for root colonising bacteria stimulating
wheat growth in saline soils Biol Fert Soils 45 563ndash571
Gallego RJS Garciacutea-Martiacutenez MJ Llamas JF Belloch C Pelaacuteez AI amp Saacutenchez J
2007 Biodegradation of oil tank bottom sludge using microbial consortia
Biodegradation 18 269ndash281
Ghazali FM Rahman RNZA Salleh AB amp Basri M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hydrocarbons (PAH) A review J Hazard Mater 169 1-15
Hoffmann H Stindl S Stumpf A Mehlen A Monget D Heesemann J Schleifer KH amp
Roggenkamp A 2005 Description of Enterobacter ludwigii sp Nov a novel
Enterobacter species of clinical relevance Syst Appl Microbiol 28 206ndash212
Holtze MS Nielsen P Ekelund F Rasmussen LD amp Johnsen K 2006 Mercury affects
the distribution of culturable species of Pseudomonas Appl Soil Ecol 31 228ndash238
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor R 1969 Evolution of protein molecules in Mammalian protein
metabolism (H Munro ed) Academic Press New York
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
111
Katoh K amp Toh H 2008 Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMC Bioinformatics 9 paper
212
Kampfer P Ruppel S amp Remus R 2005 Enterobacter radicincitans sp Nov a plant
growth promoting species of the family Enterobactriaceae Syst Appl Microbiol 28
213ndash221
Kolomytseva MP Randazzo D Baskunov BP Scozzafava A Briganti F amp Ludmila A
2009 Role of surfactants in optimizing fluorene assimilation and intermediate
formation by Rhodococcus rhodochrous VKM B-2469 Bioresource Technol 100
839-844
Kruijt M Tran H amp Raaijmakers JM 2009 Functional genetic and chemical
characterization of biosurfactants produced by plant growth-promoting Pseudomonas
putida J Appl Microbiol 107 546-556
Kwon SW Jong WS Kim S Park IC Yoon SH Park DH Lim CK amp Go SJ 2003
Pseudomonas koreensis sp Nov Pseudomonas umsongensis sp Nov and
Pseudomonas jinjuensis sp Nov novel species from farm soils in Korea Int J Syst
Evol Microbiol 53 21ndash27
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang Y amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Modrogan C Diaconu E Orbulet OD amp Miron AR 2010 Forecasting Study for Nitrate Ion
Removal Using Reactive Barriers Rev Chim 6 580-584
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions Eur J Soil Sci 54 655-670
Piskonen R amp Itaumlvaara M 2004 Evaluation of chemical pretreatment of contaminated soil
for improved PAH bioremediation Appl Microbiol Biotechnol 65 627-634
Rafin C Veignie E Fayeulle A amp Surpateanu G 2009 Benzo[a]pyrene degradation using
simultaneously combined chemical oxidation biotreatment with Fusarium solani and
cyclodextrins Bioresource Technol 100 3157-3160
Roggenkamp A 2007 Phylogenetic analysis of enteric species of the family
Enterobacteriaceae using the oric-iocus Syst Appl Microbiol 30 180-188
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
112
Samantha SK Singh OV amp Jain RK 2002 Polycyclic aromatic hydrocarbons
environmental pollution and bioremediation Trends Biotechnol 20 243-248
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil in Singh
A Kuhad RC Ward OP (Eds) Adv Appl Biorem p 103-121 Springer Berlin
Tao X-Q Lu G-N Dang Z Yi X-Y amp Yang C 2007 Isolation of ohenanthrene-degrading
bacteria and characterization of phenanthrene metabolites Worl J Biotechnol 23
647-6554
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities Syst Appl Microbiol 29 244ndash252
Torsvik V amp Ovreas L 2002 Microbial diversity and function in soil from genes to
ecosystems Curr Opin Microbiol 5 240ndash245
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Mar Eco- Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Zocca C Gregori SD VisentiniF amp Vallini G 2004 Biodiversity amongst cultivable
polycyclic aromatic hydrocarbon-transforming bacteria isolated from an abandoned
industrial site FEMS Microbiol Lett 238 375-382
Capiacutetulo
Enviado a FEMS Microbiology Ecology en Diciembre 2012
Simarro R Gonzaacutelez N Bautista LF amp Molina MC
High molecular weight PAH biodegradation by a wood degrading
bacterial consortium at low temperatures
Biodegradacioacuten de hidrocarburos de alto peso molecular por un consorcio bacteriano
degradador de madera a bajas temperaturas
3
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
115
Abstract
The aim of this work was to evaluate the ability of two bacterial consortia (C2PL05 and
BOS08) extracted from very different environments to degrade low (naphthalene
phenanthrene anthracene) and high (pyrene and perylene) molecular weight polycyclic
aromatic hydrocarbons (PAH) at high (15-25ordmC) and low (5-15ordmC) temperature ranges
C2PL05 was isolated from a soil in an area chronically and heavily contaminated with
petroleum hydrocarbons and BOS08 from decomposing wood in an unpolluted forest free of
PAH Bacterial consortia were described by cultivable and no-cultivable techniques (DGGE)
PAH-degrading bacterial population measured by most probable number (MPN)
enumeration increased during the exponential phase Toxicity estimated by MicrotoxTM
method was reduced to low levels and the final PAH depletion determined by high-
performance liquid chromatography (HPLC) confirmed the high degree of low and high
molecular weight PAH degradation capacity of both consortia The PAH degrading capacity
was also confirmed at low temperatures and specially by consortium BOS08 where strains
of Acinetobacter sp Pseudomonas sp Ralstonia sp and Microbacterium sp were identified
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
117
Introcuduction
Polycyclic aromatic hydrocarbons (PAH) constitute a diverse class of organic compounds
formed by two or more aromatic rings in several structural configurations having
carcinogenic mutagenic and toxic properties Therefore environment contamination by PAH
is currently a problem of concern and it has been shown that bioremediation is the most
efficient practice retrieving the original conditions of the ecosystem (Haritash amp Kaushik
2009) However the high molecular weight PAH (HMW-PAH) such as pyrene
benzo[a]pyrene or benzo[b]fluoranthene are generally recalcitrant and resistant to microbial
attack due to their low solubility and bioavailability Therefore these compounds are highly
persistent in the environment and bioaccumulated in organisms (Lafortune et al 2009)
Studies on PAH biodegradation with less than three rings have been the subject of many
reviews (ie Sutherland et al 1995) However there is a lack of knowledge about the
HMWndashPAH biodegradation (Kanaly amp Harayama 2000)
Microbial communities play an important role in the biological removal of pollutants in
soils (MacNaughton et al 1999) Therefore changes in environmental condition may alter
species diversity of the soil microbiota and their metabolic rates (Margesin amp Schinner
2001) In areas chronically polluted by PAH there are abundant bacteria able to degrade
those toxic contaminants by using them as sole carbon and energy sources (Taketani et al
2010) Recent works (Tian et al 2008 Surridge et al 2009 Couling et al 2010) have
reported the potential ability to degrade PAH by microorganisms apparently not previously
exposed to those toxic compounds This is extensively known for lignin degrading white rot-
fungi that produce a set of extracellular enzymes such as oxidases and peroxidases (Wong
2009) with low substrate specificity that expand their oxidative action beyond lignin being
capable to degrade other complex phenolic compounds and PAH (ie Canet et al 2001)
Although less extensively than in fungus PAH degradation capacity have been also reported
in this type of environment in bacteria belonged to genera Pseudomonas (Zimmermann
1990 McMahon et al 2007) However according to Couling et al (2010) the wide-spread
capacity to degrade PAH by microbial communities even from unpolluted soils can be
explained by the fact that PAH are ubiquitously distributed by natural process throughout the
environment at low concentration enough for bacteria to develop degrading capacity
Regardless of these issues there are some abiotic factors such as temperature that
may greatly influence biodegradation process It has been shown (Mohn amp Stewart 2000)
that although biodegradation of PAH is more efficient in the range 20-30 ordmC it can be carried
out even in colder (lt5 ordmC) environments (Eriksson et al 2001) At low temperature diffusion
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
118
and solution rates and so bioavailability of PAH decreases (Haritash amp Kaushik 2009)
Simultaneously the microbial metabolism is slowed-down increasing the lag period (Atlas amp
Bartha 1972 Eriksson et al 2001) However and according to the hypothesis that
degrading microorganisms are present in most of ecosystems there are degrading bacteria
adapted to low temperatures (Yakimov et al 2003 Brakstad amp Bonaunet 2006) that can
express degrading capacity So the study of biodegradation at low temperatures is important
since the temperature of more than 90 of the seawater volume is below 5 ordmC In addition
PAH and anthropic discharges sometimes have occurred and may occur in sea water (Bode
et al 2006 Soriano et al 2006) or in cold and even extreme environments such as in
Alaska (Bence et al 1996)
The main goal of this work was to study the effect of low temperature on HMW-PAH
degradation rate by two different consortia isolated from two different environments one from
decay wood in an unpolluted forest (consortium BOS08) and other from a polluted soil
exposed to hydrocarbons The purpose of the present work was also to describe the
microbial dynamics along the biodegradation process as a function of temperature and type
of consortium used
Materials and methods
Chemicals and media
Naphthalene phenanthrene anthracene pyrene and perylene (all gt99 purity) purchased
from Sigma-Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) were prepared
in a stock solution in n-hexane (Fluka Steinheim Germany) to get a final concentration of
002 gl-1 for naphthalene phenanthrene and anthracene 001 gl-1 for pyrene and 0005 gl -1
for perylene Tween-80 purchased from Sigma-Aldrich was added according to previously
work (Bautista et al 2009) Composition of optimized Bushnell Haas Broth medium (BHB)
(Simarro et al 2010) was 02 g l -1 MgSO4middot7H2O 002 g l -1 CaCl2 2H2O 0088 g l -1 KHPO4
0088 g l -1 K2HPO4 209 g l -1 NaNO3 0015 g l -1 Fe2(SO4)3
Physicochemical characterization of soils and isolation of bacterial consortia
Consortia C2PL05 was isolated from a permanently polluted soil from a petroleum refinery
(Ciudad Real Spain) with a range of environmental temperatures from 10 ordmC in winter to 25
ordmC in summer The consortium BOS08 was extracted from dead wood in a pristine Atlantic
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
119
forest in Fragas do Eume Galicia Spain (latitude 43ordm 4175acute north longitude 8ordm 0683acute west)
with oaks as the dominant flora species and with a range of temperatures of 10 ordmC in winter
and 18 ordmC in summer To obtain the microbial consortia sieved soil and the wood sample
were suspended in PBS (110) and stirred overnight at 25 ordmC Then 15 ml of each extract
was inoculated in 50 ml of BHB (pH 70) with Tween-80 1 (vv) as surfactant and
naphthalene phenanthrene anthracene pyrene and perylene (each at 500 mg l -1) as carbon
sources Each culture were incubated in an orbital shaker at 150 rpm 25 ordmC and dark
conditions until the exponential phase was completed (asymp 5 days) monitoring cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK)
Sieved (lt2 mm) river sand was used as substrate Prior to use it was burned at 550
ordmC in a furnace to remove organic matter and microorganisms Water holding capacity (WHC)
of the river sand was measured following the method described by Wilke (2005)
Experimental design and treatments conditions
15 microcosms (triplicates by five different incubation times) were performed with consortium
C2PL05 at high temperature range (H) 16 hours with light at 25 ordmC followed by 8 hours in
the dark at 15 ordmC Another 15 microcosms with consortium C2PL05 were incubated at low
temperature range (L) 16 hours with light at 15 ordmC followed by 8 hours in the dark at 5 ordmC
The same experiments were performed with consortium BOS08 Microcosms were incubated
in suitable chambers equipped with temperature lightdarkness cycle and humidity (60)
control systems Each microcosms contained 90 g of sterilized sand 18 ml of BHB (60 of
WHC) with Tween-80 1 (vv) 2 ml of PAH stock solution in n-hexane (final amount of PAH
per tray of 20 mg of naphthalene 20 mg of phenanthrene 20 mg of anthracene 10 mg of
pyrene and 5 mg of perylene) and 35 ml of bacterial consortium (0088 AU = 275x104
cellsmiddotml -1 for C2PL05 and 0051 AU = 286 x 104 cellsmiddotml-1 for BOS08)
Bacterial growth MPN and toxicity assays
Bacterial density during the PAH degrading process was monitored at 0 11 33 66 101 and
137 days by changes in the absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) From the absorbance data the
intrinsic growth rate in the exponential phase was calculated by applying Equation 1
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
120
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time Increments were normalized by
absorbance measurements at initial time (day 0) to correct the inoculum dilution effect
Heterotrophic and PAH-degrading population from the consortia were estimated by a
miniaturized most probably number technique (MPN) in 96-well microtiter plates with eight
replicate wells per dilution (Wrenn amp Venosa 1996) Total heterotrophic microbial population
was estimated in 180 μl of Luria Bertani (LB) medium with glucose (15 gl -1) and 20 microl of the
microbial consortium PAH-degrading population in the inoculum was estimated in 180 microl of
BHB medium containing Tween-80 (1 vv) 10 microl of PAH stock mix solution as only carbon
source (n-hexane was allowed to evaporate prior to inoculation) and 20 microl of the microbial
consortium in each well
Toxicity during the PAH degradation was also monitored through screening analysis of
the samples following the MicrotoxTM method with the luminescent bacterium Vibrio fischeri
following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15 ordmC
Monitoring of PAH biodegradation
To confirm that consortium BOS08 was not previously exposed to PAH samples were
extracted with acetone and n-hexane according to Joslashrgensen et al (2005) and the
identification was performed by GC-MS analysis of the extract A gas chromatograph (model
CP3800 Varian Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary
column (15 m length 025 mm ID 025 μm film thickness) was coupled to a quadruple
mass-spectrometer detector (Model 1200L Varian) The stationary phase was composed by
phenyl (5) and dimethylpolysiloxane (95) as carried gas ice in the mobile phase
Temperature gradient program used was initial temperature of 80 ordmC for 2 min temperature
increase to 300 ordmC at the rate of 1 ordmC min-1 final temperature of 300 ordmC for 15 min with a
final duration of the method of 39 min In addition total petroleum hydrocarbons (TPH) in
both soils were extracted and quantified as is described previously
PAH from microcosms were extracted and analyzed at initial and final time to estimate
the total percentage of PAH depletion by gas cromatography using the gas cromatograph
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
121
equiped and protocol described previuosly For this 100 g of soil from each replicate were
dried overnight at room temperature and PAH were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inyect 05 μl in
the FDI chromatograph
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
To identify cultivable microorganisms samples from each microcosm were collected at zero
33 and 101 days of the biodegradation process To extract the microorganisms 15 g of soil
were suspended in PBS (110) and incubated overnight in an orbital shaker at 150 rpm
maintaining the same temperature and light conditions than during the incubation process
To get about 10 PAH-degrading colonies isolated 100 ml of the supernatant were placed
onto Petri plates with BHB medium and purified agar and were sprayed with a stock mix
solution of naphthalene phenanthrene anthracene pyrene and perylene (final concentration
500 mgL-1) as carbon source and incubated at the same temperature conditions
Total DNA of the PAH-degrading isolated cultures (DIC) was extracted using Microbial
DNA kit (MoBio Laboratories Solano Beach CA USA) and amplified using primers 16S F27
and 16S R1488 (Lane et al 1991) according to the ExTaq HS DNA polymerase protocol
(Molina et al 2009) Sequences were edited and assembled using ChromasPro software
version 142 (Technelysium Pty Ltd Tewantin Australia) to check for reading errors and
when possible resolving ambiguities BLAST search (Madden et al 1996 available at URL
httpncbinlmnihgovBLAST) was used to find nearly identical sequences for the 16S
rRNA sequences determined Sequences were aligned using the Q-INS-i algorithm (Katoh amp
Toh 2008a) of the multiple sequence alignment software MAFFT version 6611 (Katoh amp
Toh 2008b) aligning sequences in a single step
All identified sequence (by culture and no-culture techniques) and more similar
sequences downloaded from GenBank were used to perform the phylogenetic tree
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates using PAUP
40B10 (Swofford 2003) In addition maximum parsimony (MP) was also analyzed (Molina
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
122
et al 2009) Sequences of Aquifex piruphilus and Hydrogenobacter hydrogenophylus were
used as out-group
Denaturing gradient gel electrophoresis (DGGE) from microbial consortia during PAH
degrading process
A non culture-dependent molecular techniques as DGGE was performed to know the effect
of the temperature on total biodiversity of both microbial consortia during the PAH
degradation process by comparing the treatment at zero 33 and 101 day with the initial
composition of the consortia Total DNA was extracted from 025 g of the samples using
Microbial Power DNA isolation kit (MoBio Laboratories Solano Beach CA USA) and
amplified using the primers set 16S 338F-GC and 16S 518R according to ExTaq HS DNA
polymerase protocol (Promega Corp Madison WI USA) PCR product was loaded onto a
10 (wv) polyacrilamide gel with a denaturing gradient from 35 to 65 denaturant Gel
were stained with Syber-Gold and viewed under UV light and predominant bands in DGGE
gel were excised Due to impossibility to reamplify bands DNA of the bands was cloned in
the pGEM-T Easy Vector (Promega Madison WI) PAH-degrader uncultured bacterium
(DUB) were edited and assembled as described above and included in the matrix to perform
the phylogenetic tree Images of DGGE were digitalized and processed using the UN-Scan-It
gel analysis software version 60 (Silk Scientific US)
To identifiy the presence of fungi in the consortium BOS08 during the process total
DNA was extracted from the samples using Microbial Power DNA isolation kit (MoBio
Laboratories Solano Beach CA USA) and amplified with the primers set 18S ITS1F and
ITS4 according to Quiagen Multiplex PCR kit protocol DNA of Clitocybe metachroa was
extracted using DNeasy Plant Mini Kit (Quiagen) from the mushroom for use as PCR
positive PCR products were visualized under UV light on an agarose gel (1 ) using Syber-
Gold as intercalating agent
Statistical analysis
In order to evaluate the effects of inocula type and temperature on the final percentage of
PAH depletion and on the intrinsic growth rate (μ) bifactorial analysis of variance (ANOVA)
were used The variances were checked for homogeneity by the Cochranacutes test Student-
Newman-Keuls (SNK) test was used to discriminate among different treatments after
significant F-test representing this difference by letters in the graphs Data were considered
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
123
significant when p-value was lt 005 All tests were done with the software Statistica 60 for
Windows Differences in microbial assemblages were graphically evaluated for each factor
combination (time type of consortium and temperature) with a non-metric multidimensional
scaling (MDS) using PRIMER software (Clarke 1993) SIMPER method was used to identify
the percent contribution of each band from DGGE to the dissimilarity or similarity in microbial
assemblages between and within combination of factors Based on Viejo (2009) bands were
considered ldquohighly influentialrdquo if they contributed to the first 60 of cumulative percentage of
average dissimilaritysimilarity betweenwithin combination of factors
Results
Hydrocarbons in soils
Figure 1 shows GC-MS analysis of the extracted hydrocarbons from samples where both
consortia were isolated Soil samples where C2PL05 consortium was isolated contained 64
wt of total petroleum hydrocarbons (TPH) However no traces of PAH or any other
petroleum hydrocarbons were detected within samples where BOS08 consortium was
obtained
0 5 10 15 20 25 30 35
BO S08
C 2PL05
tim e (m in)
Figure 1 GC-MS total ion chromatogram from solvent extracted hydrocarbons in soils where
consortia C2PL05 and BOS08 were isolated
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
124
Cell growth intrinsic growth MPN and toxicity assays
Figure 2 (A B) shows the growth of both microbial consortia during PAH biodegradation
process Lag phases were absent and long exponential phases (until day 66 approximately)
were observed in all treatments except with the C2PL05 consortium at low temperature
(finished at day 11) In general higher cell densities were achieved in those microcosms
incubated in the higher temperature range Despite similar cell densities reached with both
consortia and both temperature levels the values of the intrinsic growth rate (μ) during the
exponential phase (Table 1) showed significant differences between consortia and
temperatures of incubation but not in their interaction (Table 2A) Differences between
treatments showed that the highest μ was obtained at high temperatures (25 ordmC-15 ordmC) and
with BOS08 consortium
Figure 2 (C D) showed that the initial number of PAH-degrading bacteria were at least
one order of magnitude lower than heterotrophic bacteria in both consortia The highest
heterotrophic bacteria concentration was reached after 33 days of incubation approximately
to a final value of 108- 109 cells g-1 soil (four orders of magnitude above the initial values)
The highest contribution of PAH-degrading bacteria to total heterotrophic bacteria was
observed at 33 days of incubation No differences were observed between temperature
ranges From 33 days both type of populations started to decrease but PAH-degrading
bacteria of consortia increased again at 101 days reaching values at the end of the process
similar to the initial ones
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
125
0 11 33 66 101 137
005
010
015
020
025
030
035
0 11 33 66 101 137
0 33 101 137102
103
104
105
106
107
108
109
0 33 101 137Time (day)Time (day)
Time (day)
Abs
orba
nce 6
00nm
(A
U)
Time (day)
DC
BA
cell
g so
il
Figure 2 Cell growth of consortia C2PL05 (A) and BOS08 (B) at high () and low () temperature
range during PAH biodegradation and MPN for consortia C2PL05 (C) and BOS08 (D) of heterotrophic
(squares) and PAH-degrading (circles) cultivated at high (filled symbols) and low (empty symbols)
temperature range
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
126
Table 1 Intrinsic growth rate (μ) and biodegradation percentage of phenanthrene (Phe) anthracene
(Ant) pyrene (Pyr) perilene (Per) and total PAH (Tot) at final time for consortia C2PL05 and BOS08 at
high (H) and low (L) temperature range Superscript letters (a to c) show differences between groups
(plt005 SNK) and plusmn SD the standard deviation
μ
Treatment d-1x10-3 plusmnSD x10-3
C2PL05 H 158 b 09 C2PL05 L 105 a 17
BOS08 H 241 c 17
BOS08 L 189 b 12
PAH biodegradation ()
Treatment Phe plusmn SD Ant plusmn SD Pyr plusmn SD Per plusmn SD Total plusmn SD
C2PL05 H 954 plusmn 04 993 plusmn 01 270 plusmn 62 986 plusmn 01 989 c plusmn 04
C2PL05 L 801 plusmn 61 459 plusmn 158 470 plusmn 118 538 plusmn 190 543 a plusmn 109
BOS08 H 938 plusmn 27 993 plusmn 04 472 plusmn 130 864 plusmn 61 866 bc plusmn 60
BOS08 L 940 plusmn 31 579 plusmn 31 542 plusmn 102 691 plusmn 137 677 ab plusmn 77
Table 2 Analysis of variance (ANOVA) of the effects on μ (A) total PAH biodegradation (B) and
biodegradation of pyrene and perilene (C) SS is the sum of squares and df the degree of freedoms
Factor df SS F
p-value
A) μ
Temperature a 1 36 x 10-3 5931 Consortium b 1 83 x 10-5 136
Temperature x Consortium 1 20 x 10-4 343 ns
Error 8 49 x 10-5 0001
B) Total PAH biodegradation ()
Treatment c 3 3526 73
Error 8 1281
C) Biodegradation of pyrene and perilene ()
Treatment c 3 11249 11 ns
PAH d 1 85098 251
Treatment x PAH 3 31949 31 ns
Error 16 54225
a high (15-25ordmC) or low (5-15ordmC) temperature range b consortium C2PL05 or BOS08 c C2PL05 at
high and temperature range or BOS08 at high and low temperature range d naphthalene
phenanthrene anthracene pyrene and perylene p lt 005 p lt 001 p lt 0001
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
127
With regard to toxicity values (Figure 3) complete detoxification were achieved at the
end of each treatment except for consortium C2PL05 (percentage of toxicity 40) incubated
at low temperature (Figure 3A) When consortium BOS08 was incubated at low temperature
there was a time period between 11 and 66 days that toxicity increased (Figure 3B)
0 11 33 66 101 137
0
20
40
60
80
100
0 11 33 66 101 137
BA
Time (day)
Tox
icity
(
)
Time (day)
Figure 3 Toxicity of microcosms with consortium C2PL05 (A) and BOS08 (B) incubated at high ()
and low () temperature range during PAH biodegradation process
Biodegradation of PAH
PAH biodegradation results are shown in Table 1 PAH depletion showed significantly
differences (Table 2B) within the consortium C2PL05 with highest values at high temperature
and the lowest at low temperature (Table 1) Those differences were not observed within the
BOS08 consortium and PAH depletion showed average values between values of C2PL05
depletion Regarding each individual PAH naphthalene was completely degraded at final
time 80 of phenanthrene was depleted in all treatments and anthracene and perylene
were further reduced at high (gt85) rather than low temperature (gt50) However pyrene
was significantly less consumed by the consortia than perylene (Table 1 and Table 2C)
Phylogenetic analyses
Phylogenetic relationships of the degrading isolated cultures and degrading uncultured
bacteria are shown in Figure 4 The aligned matrix contains 1349 unambiguous nucleotide
position characters with 505 parsimony-informative and 173 characters excluded Parsimony
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
128
analysis of the data matrix yielded 87 parsimonious trees with CI = 0756 RI = 0945 and a
length of 1096 Figure 4 also shows the topology of the neighbour joining tree
Inconsistencies were not found when analysing boostrap values of neighbour joining (NJ)
and maximum parsimony (MP)
Figure 4 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) and degrading uncultured bacteria (DUB) obtained from DGGE of the
consortia and cultivable identification process at day 0 33 and Boostrap values of neighbour joining
(NJ) and parsimonious (MP) are showed on the branch of the tree (NJMP) No incongruence between
parsimony and neighbour joining topology were detected Pseudomonas genus has been designated
as P Psychrobacter genus as Ps Acinetobacter as A and Ralstonia as R T= type strain
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
129
DIC-46-RS (Rhodococcus sp) DIC-47RS (Bacillus psychrodurans) and DUB-25RS
(Microbacterium sp) were not included in the phylogenetic tree due to their high phylogenetic
distance with most of the DIC and DUB Phylogenetic tree was composed by bacteria
belonged to γ- and β-Proteobacteria Group of γ- Proteobacteria was composed by
Acinetobacter clade Psychrobacter clade and Pseudomonas clade whereas β-
Proteobacteria group was only composed by Ralstonia clade Within Acinetobacter clade
although the identity approximation (BLAST option Genbank) reported A johnsonii and A
haemolyicus such as the species closest to some of the DIC and DUB the incorporation of
the types strains in the phylogenetic tree species do not showed a clear monophyletic group
Thus and as a restriction molecular identification of these strains (Table 3) was exclusively
restricted to genus level that is Actinobacter sp A similar criteria was taken for
Pseudomonas clade where molecular identifications carry out through BLAST were not
supported by the monophyletic hypothesis when type strains were included in the analysis
Psycrobacter clade sister group of Acinetobacter clade are represented by Psychrobacter
urativorans type strain (DQ143924T) in which DIC-14RS and DIC-23RS are nested β-
Proteobacteria is only composed by Ralstonia clade confirmed by RinsidiosaT (FJ772078T)
although DICs included in this clade are more related with the strain Ralsonia sp AF488779
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
130
Table 3 Identification and similarity () to bacteria from GenBank of cultivable strains
and DGGE bands (non-cultivable bacteria)
Days Consortium Temperature Strains Molecular Identification
(genera) 33
C2PL05
15 ordmC-5 ordmC
DIC-7RS DIC-8RS DIC-9RS DIC-11RS DIC-10RS DIC-12RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-13RS DIC-14RS DIC-15RS DIC-46RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Psychrobacter urativorans Pseudomonas sp Rhodococcus sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-16RS DIC-17RS DIC-18RS DIC-19RS DIC-20RS DIC-21RS DIC-22RS DUB-25RS DUB-26RS
Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-23RS DIC-47RS DUB-22RS DUB-23RS DUB-24RS DUB-25RS DUB-26RS
Psychrobacter urativorans Bacillus psychrodurans Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
101
C2PL05
15ordmC-5ordmC
DIC-24RS DIC-25RS DIC-26RS DIC-27RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-28RS DIC-29RS DIC-30RS DIC-31RS DIC-32RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-33RS DIC-34RS DIC-35RS DIC-36RS DIC-37RS DIC-38RS DIC-39RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
131
25 ordmC-15 ordmC
DIC-40RS DIC-41RS DIC-42RS DIC-43RS DIC-44RS DIC-45RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
Diversity and evolution of cultivated and uncultivated bacteria and dynamics during PAH
biodegradation
PCR analysis to identify fungal DNA in BOS08 was negative for the initial period of the
biodegradation process at both temperatures ranges Fungal DNA was only positive at high
temperatures and the end of the biodegradation process (101 and 137 days)
A minimum of 10 colonies were isolated and molecularly identified from the four
treatments at days 33 and 101 by cultivated methods The most influential bands of DGGE
to 60 of contribution to similarity (Figure 5 Table 4) according to the results of PRIMER
analysis were cloned and identified with the except of bands 2 4 27 and 36 that were not
cloned after several attempts likely due to DNA degradation The results of the identification
by cultivated and uncultivated methods (Table 3 Figure 5) show that different strains of
Acinetobacter (DUB-26RS uncultured Acinetobacter sp) and Microbacterium bands 24
(DUB-26RS uncultured Acinetobacter sp) and 22 (DUB-25RS Microbaterium sp)
respectively were always present in both consortia (Figure 5) both at high and low
temperatures However it should be also noted that Rhodococcus sp strains are unique to
C2PL05 consortium whereas Ralstonia sp and Bacillus sp were only found in BOS08
consortium being all of the above DIC strains (Table 3) In depth analysis of the community
of microorganisms through DGGE fingerprints and further identification of the bands allowed
to establish those bands responsible for the similarities between treatments (Table 4) and the
most influential factor MDS (Figure 6) shows that both time and temperature have and
important effects on C2PL05 microbial diversity whereas only time had effect on BOS08
consortium Both consortia tend to equal their microbial compositions as the exposed time
increase (Figure 6) The highest average of similarity (5327 ) was observed at day 101
being bands 36 4 (unidentified) and 24 (DUB-26RS Acinetobacter sp) responsible for that
similarity The lowest similarity (3543 ) was observed within the consortium C2PL05 (Table
4) being the high abundance of the band 20 (DUB-24RS Pseudomonas sp) and the lack of
the band 22 (DUB-25R Microbacterium sp) responsible of the dissimilarity Concluding it
can be observed that bands 20 (DUB-24RS Pseudomonas sp) 22 (DUB-25R
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
132
Microbacterium sp) 24 (DUB-26RS Acinetobacter sp) 36 and 4 (both unidentified) were
the most responsible for the similarity or dissimilarity between bacterial communities of
different treatments Another band showing lower contribution to these percentages but yet
cloned was band 12 from which two genotypes were identified (DUB-22RS and DUB-23RS)
as Pseudomonas sp Regarding to identification of DIC strains (Table 3) Rhodococcus sp
was exclusive of C2PL05 consortium and Ralstonia sp and Bacillus sp were only found in
BOS08 consortium
Table 4 Bands contribution to 60 similarity primer between treatments grouped by time type
of bacterial consortium and incubation temperature Average similarity of the groups determine
by SIMPER method
Time (day) Consortium Temperature
Band DUB 0 33 101 C2PL0 BOS0 High Low
22 DUB-25RS 2855 2789 2581 20 DUB-24RS 2993 2521 1797 2366
36 Unidentified 3546 1029 210
4 Unidentified 2855 1120 2362 1755 2315 175
27 Unidentified 139
2 Unidentified 1198
24 DUB-26RS 929
Cumulative similarity () 5710 5781 5595 6081 6134 5710 524Average similarity () 4433 4070 5327 3543 4660 4433 405
Unidentified bands from DGGE after several attempts to clone
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
133
Figure 5 Denaturant gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen
fragments from the consortium C2PL05 (line 1 to 5) and consortium BOS08 (line 6 to 10) Line 0
contains the molecular weight markers lines 1 and 6 correspond to initial time lines 2 and 7 to
high temperature range at day 33 lines 3 and 8 to high temperature range at day 101 lines 4
and 9 to low temperature range at day 33 and lines 5 and 10 to low temperature range at day
101
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
134
Figure 6 Multidimensional scaling (MDS) plot showing the similarity
between consortia BOS08 (BO) and C2PL05 (C2) incubated at low
(superscript L) and high (superscript H) temperature at day 0 33 and
101(subscripts 0 1 and 2 respectively)
Discussion
PAH degradation capability of bacterial consortia
Consortium BOS08 was isolated from a pristine soil since hydrocarbons and especially PAH
were not detected Opposite results were observed for samples where consortium C2PL05
was extracted with a large amount (64 wt) of petroleum compounds (ltC40) measured
However both consortia proved to be able to efficiently degrade HMW-PAH even at low
temperature range (5-15 ordmC) However both consortia have shown lower pyrene than
perylene depletion rates despite the former has lower molecular size and higher aqueous
solubility and bioavailability and lower hydrophobicity Previous work (Alves et al 2005)
have reported that UV and visible light can activate the chemical structure of some PAH
inducing changes in toxicity However whereas these authors classified phototoxicity of
pyrene and perylene as positive other phototoxic classifications (Mekenyan et al 1994)
consider pyrene as extremely toxic and perylene as moderately toxic So the high toxicity
level of pyrene due to phototoxic effect may explain the lower depletion rates of pyrene
opposite to that expected from their physicochemical properties above mentioned
Contrary to previous works (Spain amp ven Veld 1983 Jhonsen amp Karlson 2005) the
consortium BOS08 has not needed the pre-exposure to PAH to induce microbial adaptation
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
135
and consequently degradation of those pollutants In agreement with previous works
(Margesin amp Schinner 2001) our results have showed that the addition of PAH to the forest
consortium BOS08 was rapidly followed by an initial increase of PAH degrading bacteria
Considering the origin of consortium BOS08 extracted from a soil rich in organic matter and
decaying wood is possible that biodegradation process may be associated with wood
degrading bacteria and fungi However results confirmed that initial conditions when PAH
concentration was high fungi were not present Fungi appeared just at the end of the
biodegradation process (101 and 137 days) and only at high temperature when high PAH
concentration was already depleted and toxicity was low These results therefore confirm
that biodegradation process was mainly carried out by bacteria when PAH concentration and
toxicity were high
PAH degradation ability is a general characteristic present in some microbial
communities when community is exposed to PAH (Macleod amp Semple 2002 Jhonsen amp
Karlson 2005 Tian et al 2008) Microbial consortia were obtained from highly different
levels of contamination However although high differences were observed at the initial
microbial composition of both consortia they share some strains (Microbacterium sp and
Acinetobacter sp) The lower diversity found within the C2PL05 consortium (more details in
Molina et al 2009) obtained from a chronically and heavily polluted area with petroleum
hydrocarbons is typical of aged soils exposed to PAH These pollutants drive the selection of
specific bacteria that are able to degrade them (Vintildeas et al 2005)
Most of the identified species by DGGE (culture-independent rRNA approaches) in this
work were γ-proteobacteria (Pseudomonas and Acinetobacter) except DUB-26RS 98
similar to Microbacterium sp belonging to Actinobacteria phylum In agreement with previous
works (Harayama et al 2004) identification results retrieved by culture-dependent methods
showed some differences from those identified by the culture-independent rRNA
approaches DIC identified by culturable techniques belonged to a greater extend to
Proteobacteria phylum γ-Proteobacteria (Pseudomonas Pshycrobacter Acinetobacter) and
β-Proteobacteria (Ralstonia) Only two cultivable strains DIC-46RS and DIC-47RS identified
as Rhodococcus sp and Bacillus psychrodurans belonged to Actinobacteria and Firmicutes
phylum respectively Genera as Bacillus Pseudomonas and Ralstonia were identified within
the consortium BOS08 obtained from decaying wood in a pristine forest These genera are
typical from decomposing wood systems and have been previously mentioned as important
aerobic cellulose-degrading bacteria such as Bacillus sp (Lynd et al 2002) or degraders of
the highly oxidized oxalate (Pseudomonas sp Ralstonia sp) which is released by white-rot
fungi during degradation of lignocellulose (Dutton amp Evans 1996) Lignin is one of the most
slowly degraded components of dead plants and the major contributor to the formation of
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
136
humus as it decomposes The breakdown of lignin is mediated by extracellular enzymes
such as laccase lignin peroxidise and manganese peroxidase (Hatakka 1994 Hatakka
2001) The lack of specificity and the high oxidant activity of these enzymes make them able
to degrade different components as PAH (ie Pickard 1999) For this reason Bacillus
Pseudomonas and particularly Ralstonia identified within the consortium BOS08 and
typical from decomposing wood systems have been also previously identified as degrader of
aromatic compounds (Zhuang et al 2002 Chauhan et al 2008 Luo et al 2009) While
many eukaryotic laccases have been identified and studied laccase activity has been
reported in relatively few bacteria these include some strains identified in our decomposing
wood consortium BOS08 such as Ralstonia sp and Bacillus sp and others like Azospirillum
lipoferum Marinomonas mediterranea Amycolatopsis sp Streptomyces coelicolor
Arthrobacter cholorophenolicus and Rhodococcus opacus (McMahon et al 2007 Dawkar et
al 2009 Brown et al 2011)
HMW-PAH degradation at low temperatures
In the last 10 years research in regard to HMW-PAH biodegradation has been carried out
mainly through single bacterial strains or artificial microbial consortia and at optimal
temperatures (Kanaly amp Harayama 2000 Kanaly amp Harayama 2010) However there is a
lack of knowledge focused on HMW-PAH biodegradation at difficult conditions such as low
temperatures by full microbial consortia Temperature is a key factor in physicochemical
properties of PAH and in the control of PAH biodegradation metabolism in microorganisms
The diffusion rate of PAH into the aqueous phase increases with temperature and so PAH
bioavailability (Haritash amp Kaushik 2009) and PAH metabolism rate (Leahy amp Colwell 1990)
In agreement with previous results (Eriksson et al 2001) PAH biodegradation rates were
significantly higher at moderate temperatures (15-25 ordmC) because metabolic activity
diffusion and mass transfer was facilitated However there are also microorganisms with
capacity to efficiently degrade HMW-PAH even at lower temperatures (Margesin et al 2002)
as microorganisms present at both consortia (BOS08 and C2PL05)
Genera as Acinetobacter and Pseudomonas identified from both consortia growing at
low temperature have been previously reported as typical strains from cold and petroleum-
contaminated sites being capable to grow using solely hydrocarbons (MacCormack amp Fraile
1997 Eriksson et al 2003 Margesin et al 2003) According to previously works that
considered this genera as cold-tolerant (Margesin et al 2003 Ma et al 2006) our results
showed that they grow and efficiently degrade HMW-PAH at low temperature range (5-15 ordmC)
but with significantly lower rates than those at higher temperature In addition whereas time
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
137
was an influence factor in bacterial communities distribution temperature only affected to
C2PL05 consortium Possibly these results can be related with the environmental
temperature of the sites where consortia were extracted Whereas bacterial community of
BOS08 are adapted to temperatures below 20 ordmC all year C2PL05 consortium is adapted to
a range with maximum temperatures above 20 ordmC Hence although this consortium had cold-
tolerant species that degrade at low temperatures their probably less proportion than in the
BOS08 consortium resulted in differences between percentages of PAH depletion and
evolution of the bacterial community in function of temperature Therefore the cold-adapted
microorganisms are important for the in-situ biodegradation in cold environments
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (Projects 11-37320053-
B and 0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
138
References
amp Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int Biodet
Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bode A Gonzaacutelez N Lorenzo J Valencia J Varela MM amp Varela M 2006 Enhanced
bacterioplankton activity after the Prestige oil spill off Galicia NW Spain Aquatic
Microb Ecol 43 33-41
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0ndash5degC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Brown ME Walker MC Nakashige TG Iavarone AT amp Chang M 2011 Discovery and
characterization of heme enzymes from unsequenced bacteria Application to microbial
lignin degradation J Am Chem Soc 4518006-18009
Canet R Birnstingl JG Malcolm DG Lopez-Real JM amp Beck AJ 2001 Biodegradation
of polycyclic aromatic hydrocarbons (PAH) by native microflora and combinations of
white-rot fungi in a coal-tar contaminated soil Bioresource Technol 76113-117
Chauhan A Fazlurrahman Oakeshot JG amp Jain RK 2008 Bacterial metabolism of
polycyclic aromatic hydrocarbons strategies for bioremediation Indian J Microbiol 48
95-113
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158 3411-
3420
Dawkar VV Jadhav UU Telke AA amp Govindwar SP 2009 Peroxidase from Bacillus sp
VUS and its role in the decolorization of textile dyes Biotechnol Bioprocess Eng 14
361-368
Dutton MV amp Evans CS 1996 Oxalate production by fungi its role in pathogenicity and
ecology in the soil environment Can J Microbiol 42 881ndash895
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
139
Eriksson M Jong-Ok Ka amp Mohn WW 2001 Effects of low temperature and freeze-thaw
cycles on hydrocarbon biodegradation in Arctic Tundra soil Appl Environ Microbiol
675107-5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Harayama S Kasai Y amp Hara A 2004 Microbial communities in oil-contaminated seawater
Curr Opin Biotechnol 15 205-214
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycoilyclic aromatic
hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microb Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M Steinbuchel A(eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Johonsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-
does it depend on PAH exposure Microb Ecol 50 488ndash495
Joslashrgensen KS Jaumlrvinen O Sainio P Salminen J amp Suortti AM 2005 Quantification of
soil contamination In Margesin R Schinner F (eds) Manual of soil analysis
monitoring and assessing soil bioremediation Springer Berlin pp 97-119
Kanaly RA amp Harayama S 2000 Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059ndash2067
Kanaly RA amp Harayama S 2010 Advances in the field of high-molecular-weight polycyclic
aromatic hydrocarbon biodegradation by bacteria Microb Biotechnol 3 136ndash164
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Lafortune I Juteau P Deacuteziel E Leacutepine F Beaudet R amp Villemur R 2009 Bacterial
diversity of a consortium degrading high-molecular-weight polycyclic aromatic
hydrocarbons in a two-liquid phase biosystem Microb Ecol 57 455-468
Lane DJ 1991 16S23S sequencing In E Stackebrandt and M Goodfellow (ed) Nucleic
acid techniques in bacterial systematic John Wiley amp Sons Chischester UK
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environments
Microbiol Rev 54 305-315
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
140
Luo YR Tian Y Huang X Yan CL Hong HS Lin GH amp Zheng TL 2009 Analysis of
community structure of a microbial consortium capable of degrading benzo(a)pyrene
by DGGE Marine Poll Bull 58 1159-1163
Lynd LR Weimer PJ van Zyl WH amp Pretorius IS 2002 Microbial cellulose utilization
fundamentals and biotechnology Microbiol Mol Biol Rev 66 506ndash577
MacCormack WP amp Fraile ER 1997 Characterization of a hydrocarbon degrading
psychrotrophic Antarctic bacterium Antarct Sci 9 150-155
Macleod CJA amp Semple KT 2002 The adaptation of two similar soils to pyrene catabolism
Environ Pollut 119357-364
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Madden TL Tatusov RL Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts Extremophiles
7451ndash458
McMahon AM Doyle EM Brooksm S amp OacuteConnor KE 2007 Biochemical
charcaterization of the coexisting tyrosinase and laccase in the soil bacterium
Pseudomonas putida F6 Enzyme Microb Tech 401435-1441
Mekenyan OG Ankly GT Veith GD amp Call DJ 1994 QSAR for photoinduced toxicity I
Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere
28 567
Microbics Corporation 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mohn WW amp Stewart GR 2000 Limiting factors for hydrocarbon biodegradation at low
temperature in Artic soils Soil Biol Biochem 321161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Pickard MA Roman R Tinoco R Vazquez-Duhalt R 1999 Polycyclic aromatic
hydrocarbon metabolism by white rot fungi and oxidation by Coriolopsis gallica UAMH
8260 laccase Appl Environ Microbiol 65 3805-3809
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
141
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Soriano JA Vintildeas L Franco MA Gonzaacutelez JJ Ortiz L Bayona JM amp Albaigeacutes J 2006
Spatial and temporal trends of petroleum hydrocarbons in wild mussels from the
Galician coast (NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-
90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil In Singh
A Kuhad RC Ward OP (eds) Adv Appl Biorem 103-121 Springer Berliacuten
Sutherland JB Rafii F Khan AA amp Cerniglia CE 1995 Mechanisms of polycyclic
aromatic hydrocarbon degradation p 269ndash306 In L Y Young and C E Cerniglia
(ed) Microbial transformation and degradation of toxic organic chemicals Wiley-Liss
New York NY
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of Xiamen
China Marine Pollut Bull 56 1184-1191
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-95
Wong WSD 2009 Structure and action of ligninolytic enzymes Appl Biochem Biotechnol
157 174-209
Wrenn BA amp Venosa AD 1996 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
142
Yakimov MM Giuliano L Gentile G Crisafi E Chernikova TN Abraham W-R Luumlnsdorf
H Timmis KN amp Golyshin PN 2003 Oleispira antarctica gen nov sp nov a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water Int J
System Evol Microbiol 53779-785
Zhuang W-Q Tay J-H Maszenan AM amp Tay STL 2002 Bacillus naphthovorans spnov
from oil contaminated tropical marine sediments and its role in naphthalene
biodegradation ApplMicrobiol Biotechnol 58547-553
Zimmermann W 1990 Degradation of lignin by bacteria J Biotechnol 13119-130
Proteobacteria
Capiacutetulo
Manuscrito ineacutedito
Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez M amp Peacuterez L
Assessment the efficient of bioremediation techniques (biostimulation bioaugmentation
and natural attenuation) in a creosote polluted soil change in bacterial community
Evaluacioacuten de la eficacia de teacutecnicas de biorremediacioacuten (bioestimulacioacuten bioaumento y
atenuacioacuten natural) en un suelo contaminado con creosota cambios en la comunidad bacteriana
4
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
145
Abstract
The aim of the present work was to assess different bioremediation treatments
(bioaugmentation bioestimulation combination of both and natural attenuation) applied to a
creosote polluted soil with a purpose of determine the most effective technique in removal of
pollutant Toxicity microbial respiration degradation of creosote and PAH (antharcene
phenathrene and pyrene) as well as evolution of bacterial communities by non culture-
dependent molecular technique DGGE were analyzed Results showed that creosote was
degraded through time without significant differences between treatments but PAH were
better degraded by treatment with biostimulation Low temperatures at which the process
was developed negatively conditioned the degradation rates and microbial metabolism as
show our results DGGE results revealed that biostimulated treatment displayed the highest
microbial biodiversity However at the end of the bioremediation process no treatment
showed a similar community to autochthonous consortium The degrader uncultured bacteria
identified belonged to Pseudomonas Sphingomonas Flexibacter all of them involved in
degradation process Particularly interesting was the identification of two uncultured bacteria
belonged to genera Pantoea and Balneimonas did not previously describe as such
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
147
Introduction
Creosote is a persistent chemical compound derived from burning carbons as coal between
900-1200 ordmC and has been used as a wood preservative It is composed of approximately
85 polycyclic aromatic hydrocarbons (PAH) 10 phenolic compounds and 5 nitrogen
and sulfur PAH are a class of fused-aromatic compounds toxic mutagenic bioaccumulative
and persistent in the environment and so the United State Environmental Protection Agency
(US EPA) considered that the removal of these compounds is important and priority Against
physical and chemical methods bioremediation is the most effective versatile and
economical technique to eliminate PAH Microbial degradation is the main process in natural
decontamination and in the biological removal of pollutants in soils chronically contaminated
(MacNaughton et al 1999) in which degrading-bacteria are abundant (Taketani et al
2010) However recently works have reported (Tian et al 2008 Couling et al 2010) the
potential ability to degrade PAH of microorganisms from soils apparently not exposed
previously to those toxic compounds The technique based on this degradation capacity of
indigenous bacteria is the natural attenuation This technique avoid damage in the habitat
(Dowty et al 2001) allowing to retrieve the original conditions of the ecosystem converting
the toxic compounds into harmless (Kaplan amp Kitts 2004 Haritash amp Kaushik 2009)
However this method require a long period or time to remove the toxic components because
the number of degrading microorganisms in soils only represents about 10 of the total
population (Yu et al 2005a) Many of the bioremediation studies are focused on the
bioaugmentation which consist in the inoculation of allochthonous degrading
microorganisms (ie Atagana 2006) However bioaugmentation is a complicate technique
to study because a negative or positive effect depends on the interaction between the
inocula and the indigenous population due to the competition for resources mainly nutrients
(Yu et al 2005b) Other bioremediation techniques as biostimulation consist in to empower
the degrading capacity of the indigenous community by the addition of nutrients to avoid
metabolic limitations (ie Vintildeas et al 2005)
However inconsistent results have been reported with all these previuos treatments
Previous studies have shown that biodegradation rates can be increased (Mills et al 2004)
and have no effect influenced negatively with biostimulation (Yu et al 2005a Chen et al
2008) Similar enhance of biodegradation rates (Atagana et al 2006) and not significant
differences (Vintildeas et al 2005 Yu et al 2005b) have been described with bioaugmentation
It is necessary taking in to account that each contaminated site can respond in a different
way (Vintildeas et al 2005) therefore to carry out an in situ bioremediation process it will be
necessary to design a laboratory-scale assays to determine what technique is more efficient
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
148
on the biodegradation process and the effect on the microbial diversity In addition
previously works (Gonzalez et al 2011) showed that although PAH were completely
consumed by microorganisms toxicity values remained above the threshold of the non-
toxicity Although most of the work not perform toxicity assays these are necessary to
determine effectiveness of a biodegradation The main goal of the present study is to
determine through a laboratory-scale assays the most effective bioremediation technique in
decontamination of creosote contaminated soil evaluating changes in bacterial community
and the toxicity values
Materials and methods
Chemical media and inoculated consortium
The fraction of creosote used in this study was composed of 26 of PAH (naphthalene
05 phenanthrene 51 anthracene 122 pyrene 31 dibenzofurane 13 and
acenaphthene47) Creosote was diluted in acetonitrile (purchased form Sigma Aldrich
Steinheim Germany) in a stock solution of a final concentration of 0439 gmiddotml-1 containing
0117 g PAHmiddotml-1 The culture mediums LuriandashBertani (LB) and Bushnell-Haas Broth (BHB)
were purchased from Panreac (Barcelona Spain) Biostimulated treatments were amended
with BHB as inorganic nutrients source which composition was optimized for PAH-degrading
consortium (C2PL05 consortium) in a previously work (Simarro et al 2010) with the optimum
composition 02 gmiddotlminus1 MgSO4 7H2O 002 gmiddotlminus1 CaCl2 2H2O 0281 gmiddotlminus1 KHPO4 0281 gmiddotlminus1
K2HPO4 002 gmiddotlminus1 NH4NO3 0195 gmiddotlminus1 Fe2(SO4)3 According to Bautista et al(2009) Tween-
80 was the optimal surfactant for PAH biodegradation by bacteria and was added in a critical
micellar concentration (CMC) of 300 μlmiddotml-1 (0012 mM) Bioaugmented treatments were
inoculated with the PAH-degrading consortium C2PL05 extracted from a permanently PAH
contaminated soil from a refinery in Ciudad Real (Spain) and previously identified and
described in Molina et al(2009)
Experimental design
Five different treatments in microcosms designated as T1 to T5 (see Table 1) were carried
out each in duplicate for five sampling times zero 6 40 145 and 176 days from December
2009 to May 2010 In total 40 microcosms containing 550g of natural soil samples collected
from an uncontaminated area of Rey Juan Carlos University in Madrid (Spain) were carried
out The soil obtained from the first top 20 cm and sieved by 2 mm was located in plastic
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
149
trays and randomly arranged outdoor in terrace and protected with a plastic to avoid the rain
and snow on them Each tray except the treatment T1 contained 56 ml of a creosote
solution in n-hexano (0439 g ml-1) with final amount of creosote per tray of 25 g
Microcosms were maintained at 40 of water holding capacity (WHC) considered as
optimum during bioremediation process (Vintildeas et al 2005) For biostimulation microcosms
samples were hydrated with the required amount of the optimum BHB while in treatment no
biostimulated samples were hydrated with only mili-Q water Bioaugmented treatments were
inoculated with 5ml of the consortium C2PL05 (2015x107 plusmn 427x106 cellsmiddotg soil-1 of
heterotrophic microorganisms and 177x105 plusmn 101x105 cellsmiddotg soil-1 of creosote-degrading
microorganisms)
Table 1 Summary of the treatment conditions
Code Treatments Conditions
T1 Untreated soil (control) Uncontaminated soil
T2 Natural attenuation Contaminated soil with 56 ml creosote moistened 40WHC
with 1054 ml mili-Q water
T3 Biostimulation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1104 ml BHB
T4 Bioaugmentation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml mili-Q water 5 ml consortium
C2PL05
T5 Biostimulation
+ Bioaugmentation
Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml BHB inoculated with 5 ml
Characterization of soil and environmental conditions
The water holding capacity (WHC) was measured following the method described by Wilke
(2005) and the water content was calculated through the difference between the wet and dry
weigh after drying at 60ordmC during 1 hour pH was measured using a GLP 21 micro pHmeter
(Crison Barceona Spain) resuspending 1 g of the soil in mili-Q water (110) and incubating it
in an orbital shaker at 150 rpm at 25 ordmC during 1 h Temperature which the experiments were
developed was recorded on a temperature loggers (Tidbit Loggers Onset Computer
Pocasset Mass) located in the site
Total heterotrophic microorganisms (HM) and creosote-degrading microorganisms
(C-DM) of the microbial population of the natural soil was counted using a miniaturized most
probable number technique (MPN) in 96-well microtiter plates with eight replicates per
dilution (Wrenn amp Venosa 1996) The number of cells was calculated with Most Probable
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
150
Number Calculator software Version 404 (Klee 1993)To extract the microorganisms from
the soil 1 g of soil was resuspended in 10 ml of phosphate buffer saline (PBS) and was
shaker at 150 rpm at 25 ordmC during 24 h The HM were determined in 180 μl of LB medium
with glucose (15 gl-1) and C-DM were counted in 180 μl of BHB medium with 10 μl of
creosote stock solution as carbon source
Respiration and toxicity assays
To measure the respiration during the experiments 10 g of soil moistened with 232 ml of
mili-Q water (to maintain a water capacity of 40 WHC) was incubated in duplicate in a
desiccator during 14 days at 25ordmC Replicates contained 14 ml of NaOH 02 M to absorb the
CO2 produced by microorganisms The vials were periodically replaced and checked
calorimetrically with HCl (01M) and phenolphthalein as indicator The test was doing with
BaCl2 (01 M) in excess to ensure the precipitation of carbonates The numbers of moles of
CO2 produced were calculated as a difference between initial moles of NaOH in the
replicates and moles of NaOH checked with HCl (moles of NaOH free)
The toxicity evolution during the PAH degradation was also monitored through a short
screening of the samples with the Microtox TM method with the luminescent bacterium Vibrio
fischeri following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15ordmC
Monitoring the removal of creosote and polycyclic aromatic hydrocarbons
Organic compounds were extracted and analyzed from the microcosms samples at 0 6 40
145 and 176 days by gas chromatography-mass spectrometry (GC-MS) to estimate the
creosote and percentage of PAH depletion A gas cromatograph (model CP3800 Varian
Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary column (15 m
length 025 mm ID 025 μm film thickness) was coupled to a quadruple mass-spectrometer
detector (Model 1200L Varian) The stationary phase was composed by phenyl (5) and
dimethylpolysiloxane (95) as carried gas ice in the mobile phase Temperature gradient
program used was initial temperature of 80 ordmC for 2 min temperature increase to 300 ordmC at
the rate of 1ordmC min-1 final temperature of 300 ordmC for 15 min with a final duration of the
method of 39 min Organic compounds were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inject 05 μl in
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
151
the FDI chromatograph The concentration of each PAH and creosote was calculated from
the chromatograph of the standard curves
DNA extraction molecular and phylogenetic analysis for characterization of the total
microbial population in the microcosms
Non culture-dependent molecular techniques as denaturing gradient gel electrophoresis
(DGGE) was performed to identify non-culture microorganisms and to compared the
biodiversity between treatments and its evolution at 145 and 176 days of the process Total
community DNA was extracted from 25 g of the soil samples using Microbial Power Soil
DNA isolation kit (MoBio Laboratories Solano Beach CA USA) In total suitable yields of
high molecular-weight DNA (5-20 μgg of soil-1) were obtained The V3 to V5 variable regions
of the 16S rRNA gene were amplified using the primers set 16S 518R and 16S 338F-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primer 338F-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded on to a 10
(wtvol) polyacrylamide gels that was 075mm tick and the denaturing gradients used ranged
from 35 to 65 denaturant (more details in Gonzalez et al 2011) Gel were stained with
Syber-Gold and viewed under UV light and predominant bands were excised and diluted in
50μl of mili-Q water Due to impossibility of reamplified bands DNA of the bands was cloned
in the pGEM-T Easy Vector (Promega Madison WI) Plasmids were purified using the High
Pure plasmid Isolation Kit (Roche) and sequenced using the internal primers 338F and 518R
Creosote-degrader uncultured bacterium (DUB) were edited and assembled using version
487 of the BioEdit program (Hall 1999) BLAST search (Madden et al 1996) was used to
find nearly identical sequences for the 16S rRNA sequences determined All DUB identified
sequence and 25 similar sequences downloaded from GenBank were used to perform the
phylogenetic tree Sequences were aligned using the Q-INS-i algorithm (Katoh amp Toh 2008a)
of the multiple sequence alignment software MAFFT version 6611 (Katoh amp Toh 2008b)
aligning sequences in a single step Sequence divergence was computed in terms of the
number of nucleotide differences per site between of sequences according to the Jukes and
Cantor algorithm (1969) The distance matrix for all pair wise sequence combinations was
analyzed with the neighbour-joining method (NJ) of phylogenetic tree construction with 1000
bootstrap replicates by using version PAUP 40B10 (Swofford 2003) In addition maximum
parsimony (MP) was also analyzed (Molina et al 2009) Sequences of Sphirochatea
americans belonged to Sphirochaetes phylum were used as out-group (Gupta amp Griffiths
2002) Images of DGGE were digitalized and DGGE bands were processed using the UN-
Scan-It gel analysis software version 60 (Silk Scientific US)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
152
Statistical analysis
In order to evaluate the effects of treatments on intrinsic growth rate (μ) toxicity degradation
of organic compounds and respiration analysis of variance (ANOVA) were used The
variances were checked for homogeneity by the Cochranacutes test Student-Newman-Keuls
(SNK) test was used to discriminate among different treatments after significant F-test
representing these differences by letters in the graphs Data were considered significant
when p-value was lt 005 All tests were done with the software Statistica 60 for Windows
Differences in microbial assemblages by biostimulation by bioaugmentation and by time
(145 and 176 days) were graphically evaluated with a non-metric multidimensional scaling
(MDS) using PRIMER software (Clarke 1993) The previous period to 145 days was
considered a period of cold conditions and the time from 145 to 176 days a period of higher
temperatures SIMPER method was used to identify the percent contribution of each band to
the similarity in microbial assemblages between factors Bands were considered ldquohighly
influentialrdquo if they contributed to the first 60 of cumulative percentage of average similarity
betweenwithin combination of factors In addition Shannon index (Hacute) was calculated from
DGGE bands applying equation 2 to estimate the ecological diversity of each treatment at
136 and 145 days
Equation 2
where pi is the proportion in the gel of the band i with respect to the total of all bands
detected calculated as coefficient between band intensity and total intensity of all
bands (Baek et al 2007)
Results
Physical chemical and biological characteristics of the natural soil used for the treatments
pH of the soil was slightly basic 84 and the water content of the soil was 10 although the
soil had a high WHC (521) possibly due to their sandy character Initial proportion of C-DM
from natural soil represented only 088 of the total heterotrophic population with a number
of microorganisms two order of magnitude higher (201 x 107 plusmn 427 x 106 cells g soil-1)
Figure 1 shows that the evolution of the monthly average temperature observed during the
experiment and the last 30 years Average temperature decreased progressively from
October to January from 16 ordmC to a minimum average of 6 ordmC starting to increase
progressively to reach a mean value of 21 ordmC in June
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
153
October
November
DecemberJanuary
FebruaryMarch
April MayJune
468
10121416182022
0 day
40 day
145 day
176 day
6 dayT
empe
ratu
re (
ordmC)
Month
Figure 1 evolution of the normal values of temperature (square) and evolution of
the monthly average temperature observed (circle) during the experiment
Respiration of the microbial population
Table 2A shows the ANOVA results concerning to the accumulated values of CO2 produced
for each treatment in each time period (from 0- to 6 days from 40 to 145 days and from 145
to 176 days) Due to interval time was the only significant factor (Table 2A) differences in
percentage of accumulative CO2 by sampling times (6 40 145 and 176 days) were analyzed
and showed in Figure 2 Differences between sampling times showed that the accumulated
percentage of CO2 was significantly higher at 176 days than at other time
6 40 145 17600
10x10-4
20x10-4
30x10-4
40x10-4
50x10-4
a a
b
aCO
2 mol
esg
of
soil
Time (days)
Figure 2 accumulated CO2 issue at 6 40 145 and 176 days Error bars show the
standard deviation and the letters show significant differences between groups
(plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
154
Toxicity assays
Changes on the toxicity during the creosote degradation process (Figure 3A) showed that all
treatments had a similar evolution T1 (uncontaminated) was not toxic (lt20 ) but toxicity of
treatments with creosote increased constantly from initial value of 26 to a values higher
than 50 Only during last period of time (145 to 176 days) toxicity started to decrease
slightly Despite similar toxicity values reached with the treatments interaction between time
periods (0 to 6 days 40 to 145 days and 145 to 176 days) and treatments showed significant
differences (Table 2B) Differences between groups by both significant factors (Figure 3B)
showed that toxicity of all treatments in first time period was significantly lower than in the
other periods Differences in toxicity between the two last periods were only significant for
treatment T4 in which toxicity increase progressively from the beginning
0 6 20 40 56 77 84 91 98 1051121251321411760
10
20
30
40
50
60
70
80
90
100 BA
Tox
icity
(
)
Time (days)T2 T3 T4 T5
c
c
c
b
c
bc
bcbc
aa
aa
Treatment
Figure 3 (A) evolution of the toxicity () of the treatment T1 (square) T2 (circle) T3 (triangle) T4
(inverted triangle) and T5 (rhombus) during the experiment (B) percentage of toxicity of the treatment
in the interval times 1 (black bars) from 0- to 6 days interval 2 (with bars) from 6 to 40 days and
interval 3 (gray bars) from 40 to 176 days Error bars show the standard deviation and letters
differences between groups
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
155
Biodegradation of creosote and polycyclic aromatic hydrocarbons
The results concerning the chromatography performed on the microcosms at 0 40 145 and
176 days are shown in Figure 4 Creosote depletion during first 40 days was very low
compared with the intensive degradation occurred from 40 to 145 days in which the greatest
amount of creosote was eliminated (asymp 60-80) In addition difference between residual
concentration of PAH at final time by type of PAH (phenanthrene anthracene and pyrene)
and treatment were analyzed (Table 2C) Both factor were significantly influential although
was not the interaction between them Differences by PAH (Figure 4B) showed that
anthracene degradation was significantly higher than other PAH and differences by
treatments (Figure 4C) showed that difference were only significant between treatment T3
and T2 lower in the treatment T3
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
156
T1 T2 T3 T4 T50000
0005
0010
0015
0020
0025
0030
0035
0040
g cr
eoso
te
g so
il
Phenanthrene Anthracene Pyrene0
102030405060708090
100
C
aab
abb
a
bb
B
A
Ave
rage
res
idua
l con
cenr
atio
n of
PA
H (
)
T2 T3 T4 T50
102030405060708090
100
Tot
al r
esid
ual c
once
ntra
tion
of
PA
H (
)
Figure 4 (A) creosote depletion during the experiment at sampling times 6 days (black
bars) 40 days (with bars) 145 days (grey bars) and 176 days ( ) (B) average residual
concentration at 176 days of the identified PAH (phenanthrene anthracene and pyrene)
and (B) average residual concentration of the identified PAH as a function of applied
treatment (C) Error bars show the standard error and the letters show significant
differences between groups (plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
157
Table 2 Analysis of variance (ANOVA) of the effects on the μ of the
heteroptrophic population (A) μ of the creosote degrading microorganisms (B)
accumulated value of CO2 (C) toxicity (D) and residual concentration of PAH (E) SS is
the sum of squares and df the degree of freedoms
Factor df SS F P
C) Accumulated value of CO2 (n=40) Time interval 3 65-5 3112
Treatment 4 60-6 202 ns
Interval x Treatment 12 11-5 134 ns
Error 20 14-5
D)Toxicity (n=24) Time interval 2 907133 11075
Treatment 3 12090 098 ns
Interval x Treatment 6 122138 497
Error 12 49143
E) Residual concentration of the PAH (n=24) Treatment 3 95148 548
PAH 2 168113 1452
Treatment x PAH 6 17847 051 ns
Error 12 69486
p-value lt 005
p-value lt 001
p-value lt 0001
Diversity and evolution of the uncultivated bacteria and dynamics during the PAH
degradation
The effects of different treatments on the structure and dynamics of the bacterial community
at 145 days and 176 days were analyzed by DGGE (Figure 5) At 145 days 8 bands (3 4 10
810 16 17 26 and 27 see Figure 5) were cloned and 6 different genotypes (DUB 12-RS to
DUB-17RS) were identified whereas at 176 days 5 bands (4 112 113 22 and 26 see
Figure 5) and 6 different genotypes (DUB-12RS DUB-13RS DUB-18RS DUB-19RS DUB-
20RS and DUB-21RS) were identified Most influential bands considered as 60 of
contribution to similarity according to the results of PRIMER analysis is showed at the Table
3 Similarities between treatments at 145 and 176 days were compared and analyzed as a
function of the addition of nutrients (biostimulated vs no biostimulated treatments) and the
addition of degrading consortium C2PL05 (bioaugmentated vs no bioaugmentated
treatments) The addition of nutrients was the factor that best explained differences between
treatments and so results in Table 3 are as a function of the addition of nutrients At 145
days no-biostimulated treatments T1 T2 and T4 were only similar in 402 whereas
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
158
biostimulated treatments (T3 and T5) were 6567 (Table 3) The patter were slightly
opposite at 176 days where no-biostimulated treatments were more similar (7026 ) than
biostimulated treatments (average similarity 4384 ) In addition at 145 days (Figure 6A)
natural attenuation (T2) was the only similar treatment to microbial community from the
uncontaminated treatment (T1) However at 176 days (Figure 6B) bacterial communities
from all treatments were highly different to the treatment T1 and there was no defined group
In addition PRIMER analysis allowed us to estimate the Shannon diversity index (Hacute) for
each treatments at 145 and 176 days indicating that the bacterial diversity increased for the
treatments T1 (3328) T3 (4154) and T5 (3739) remarkably higher in the treatment T4
Table 3 Bands contribution to 60 similarity primer between treatments grouped by
treatments biostimulated and no biostimulated at 145 days and 176 days Average
similarity of the groups determined by SIMPER method
145 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
3 DUB-12RS
DUB-17RS 2875
16 DUB-17RS 1826
17 DUB-12RS
DUB-16RS 1414
18 Unidentified 3363
19 Unidentified 3363
Cumulative similarity () 6725 6115 Average similarity () 402 6567
176 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
11 Unidentified 2116 13 Unidentified 2078 1794
23 Unidentified 2225 2294
26 DUB-13RS 1296
Cumulative similarity () 6418 5383 Average similarity () 7026 4384
bands from DGGE unidentified after several attempts to clone
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
159
Figure 5 Denaturing gradient gel electrophoresis (DGGE) at 145 days (A) and 176 days (B) of PCR-
amplified 16S rDNA gen fragments from the consortium C2PL05 (lane B) control experiment (lane C)
treatment with natural attenuation T1 (lane T1)biostimulated treatment T2 (lane T2) bioaugmentated
treatment T3 (lane T3) bioaugmentated treatment T4 (lane T4) and biostimulated and
bioaugmentated treatment t5 (lane T5) Lane A is the molecular weigh marker Numbers are the
bands cloning
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
160
Figure 6 proximity analysis (MDS) based on the Bray-Curtis dissimilarity
matrix of each treatment from the bands obtained in DGGE at 145 days (A)
and 176 days (B)
Phylogenetic analyses
Phylogenetic relationships of the degrading uncultured bacteria are shown in Figure 7 The
aligned matrix contained 1373 unambiguous nucleotide position characters with 496
parsimony-informative Parsimony analysis of the data matrix yielded 87 parsimonious trees
with CI = 0671 RI = 0767 and a length of 1452 Figure 6 also shows the topology of the
maximum parsimony (MP) tree with the bootstrap values of the maximum parsimony and
neighbour joining analyses Inconsistencies were not found between parsimony and
neighbour joining (NJ) topology
Phylogenetic tree was composed by bacteria belonged to Proteobacteria (α- and γ-
Proteobacteria) and Bacteroidetes phylum From DUB-12RS to DUB-17RS were located in
the Pseudomonadaceae clade in which it can be observed five clearly species groups DUB-
13RS and DUB-15RS identified as Pseudomonas trivialensis (HM134251) and P poae
(HM640290) respectively were in an undifferentiated group supported by P trivialensis and
P poae type-strains DUB-14RS similar to P viridiflava (HM190224) formed a group
supported by P viridiflavaT (HM190229) DUB-12RS 98 similar to P fluorescens (GQ
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
161
496662) was grouped with P fluorescensT (D84013) DUB-16RS was identified as
uncultured Pseudomonas sp (HQ677222) and classified in an indefinite group Finally the
last group of the Pseudomonadaceae clade was formed by DUB17-RS 98 similar to P
parafulva (HQ406758) and grouped with P parafulvaT (D84015) DUB-21RS was nested in
the Enterobacteriaceae clade due to it was identified with 99 of similarity as Pantoea
Brenneri (HM163514) This clade is supported by types-strains of other species of Pantoea
as Pantoea agglomeransT (FJ613819) and other enteric bacteria as Enterobacter cloacaeT
(AJ251469) DUB nested in Enterobacteriaceae and Pseudomonadaceae clade were γ-
Proteobacteria In α-Proteobacteria class are included Rhizobiales and
Sphingomonadaceae clades In the first clade formed by uncultured Balneimonas and
Rihzobiales bacterium supported by Balneimonas floculansT was nested DUB-19-RS 99
similar to an uncultured Balneimonas strain (HM799006) In Sphingomonadaceae clade was
nested DUB-20RS identified as uncultured Sphingomonadales bacterium DUB-18RS was
similar in 99 to Uncultured Flexibacteriaceae bacterium and was nested in Cytophagaceae
clade belonging to Bacteroidetes phylum
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
162
Figure 7 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrading uncultured bacteria (DUB) obtained from DGGE of the treatments 145 and 176 days of the
process Boostrap values of neighbourjoining and parsimony higher than 50 are showed on the
branch of the tree (NJMP) No incongruence between parsimony and neighbour joining topology were
detected Pseudomonas genus has been designated as P Pantoea genus as Pa Balneimonas as B
and Bacteriovorax as Ba Hidrogenymonas as H Flexibacerium as F T= type strain
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
163
Discussion
The estimated time of experimentation (176 days) was considered adequate to the complete
bioremediation of the soil according to previous studies developed at low temperatures (15
ordmC ndash 5 ordmC) in which toxicity was reduced below 20 in 101 days and PAH were removed in
137 days above 60 (Simarro et al under review) However our results confirm that
toxicity evaluation of the samples is necessary to know the real status of the polluted soil
because despite creosote was degraded almost entirely (Figure 4A) at the end of the
experiment toxicity remained constant and high during the process (Figure 3A) Possibly the
low temperatures under which was developed the most of the experiment slowed the
biodegradation rates of creosote and its immediate products which may be the cause of
such toxicity In addtion the most removal of creosote (Figure 4A) and higher respiration
rates (Figure 2) occurred from 40 days when temperature began to increase Hence our
results according to other authors (Margesin et al 2002) show that biodegradation at low
temperatures is possible although with low biodegradation rates due to slowdown on the
diffusion rate PAH bioavailability and metabolisms rates (Haritash amp Kaushik 2009 Leahy amp
Colwell 1990)
As in a previously work (Margesin amp Schinner 2001) no significant differences were
observed between treatments in degradation of creosote The final percentage of creosote
depletion above 60 in all treatments including natural attenuation confirm that indigenous
community of the soil degrade creosote efficiently Concurring with these results high
number of creosote-degradaing microorganisms were enumerated in the natural soil at the
time in which the disturbance occurred There is much controversy over whether
preexposure to a pollutant is required for degradation (Johnsen amp Karlson 2005) or if it is a
characteristic intrinsically present in some species of the microbial community that is
expressed when community is exposed to a pollutant (Tian et al 2008 Spain amp van Veld
1983) According to Tian et al 2008) and similarly as in previuosly work in which a wood
degrading consotium from a free polluted soil degraded PAH efficiently bacterial consortium
from natural soil never preexposed to creosota was able to efficiently degrade the
contaminant
Traditionally is widely tested (Yachi amp Loreau 1999) and accepted that higher
diversity leads to greater protection against disturbances (Vilaacute 1998) because the
functionality is higher Bacterial diversity of the biostimulated treatments (T3 and T5) notably
increased during the biodegradation process and showed (T3) a significantly enhance of the
PAH depletion Hence the higher biodiversity of the biostimulated treatment could contribute
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
164
to the increased of PAH degradation Overall the soil microbial community was significantly
altered in the soil with the addition of creosote is evidenced by the reduction of the size or
diversity of the various population of the treatments precisely in treatments no biostimulated
Long-term exposure (175 days) of the soil community to a constant stress such as creosote
contamination could permanently change the community structure as it observed in DGGEN
AND mds Bioaugmentation (T4 and T5) not resulted in a significant increase of the reduction
of creosote or PAH possibly due to the high adaptability of the indigenous consortium to
degrade PAH The relationship between inoculated and autochthonous consortium largely
condition the results of bioaugmentation Some authors (ie Herwijnen et al2005 Andrenoi
amp Gianfreda 2007) purpose that this technique only has positive effects when indigenous
consortium is no capable to degrade The indigenous microbial community demonstrated
capacity to degrade creosote explains the ineffectiveness of bioaugmentation A study of the
bacterial communities during a bioremediation process is important because such as
demonstrate our results bioremediation techniques cause changes in microbial communities
Most of the DUB identified have been previously related with biodegradation process
of PAH creosote andor diesel 60 of the DUB identified (DUB-12RS to DUB17RS)
belonged to Pseudomonas genus widely studied in bioremediation (ie Ma et al 2006
Molina et al 2009) Our results showed that it was the unique representative group at 145
days and the most representative at 176 days of the biodegradation process However in
this work it has been identified some species of Pseudomonas grouped in P trivialis P poae
and P Viridiflava clades (DUB-13RS DUB-15RS and DUB-14RS respectively) less
commonly described in biodegradation process (ie Bogan et al 2003) α-Proteobacteria
class was composed by DUB-19RS (Uncultured balneimonas) and DUB-20RS (Uncultured
Sphingomonadales bacterium) DUB-18RS belonged to phylum Bacteroidetes previously
identified in degradation of high-molecular-mass organic matter in marine ecosystems in
petroleum degradation process at low temperatures and in PAH degradation during
bioremediation of creoste-contaminated soils (Cotrell amp Kiechman 2000a Brakstad et al
2006 Vintildeas et al 2005) Something important to emphasize is the identification of the
Pantoea brenneri (DUB-21RS Enterobacteriaceae clade) and an uncultured Balneimonas
bacteria (DUB-19RS Metylbacteriaceae Rhizobiales clade) as creosote degrader because
have not been previously described as such However very few reports have indicated the
ability to degrade PAH of some genera of the enteric bacteria group as Enterobacter (Molina
et al 2009) Klebsiella (Grant et al 1967) or Escherichia (Diaz et al 2001)
In conclusion temperature is a very influential factor in ex situ biodegradation process
that control biodegradation rates toxicity reduction availability of contaminant and bacterial
metabolisms and so is an important factor to take into account during bioremediation
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
165
process Biostimulation was the technique which more efficiently removed PAH compared
with natural attenuation In this work bioaugmentation not resulted in an increment of the
creosote depletion probably due to the ability of the indigenous consortium to degrade
Bioremediation techniques produce change in the bacterial communities which is important
to study to evaluate damage in the habitat and restore capability of the ecosystem
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
166
References
Andreoni V amp Gianfreda L 2007 Bioremediation and monitoring of aromatic-polluted
habitats Appl Microbiol Biotechnol 76 287-308
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Baek SH Kim KH Yin CR Jeon CO Im WT Kim KK amp Lee ST 2003 Isolation and
characterization of bacteria capable of degrading phenol and reducing nitrate under
low-oxygen conditions Curr Microbiol 47462-466
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Behrendt U Ulrich A amp Schumann P 2003 Fluorescent pseudomonas associated with the
phyllosphere of grasses Pseudomonas trivialis sp nov Pseudomonas poae sp nov
and Pseudomonas congelans sp nov Int J Syst Evol Microbiol 53 1461ndash1469
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0-5 ordmC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Bodour AA Wang JM Brusseau ML amp Maier RM 2003 Temporal changes in culturable
phenatrhene degraders in response to long-term exposure to phenantrhene in a soil
column system Environ Microbiol 5 888-895
Bogan BW Lahner LMamp Sullivan WR 2003 Degradation of straight-chain aliphatic and
high molecular weight polycyclic aromatic hydrocarbons by a strain of Mycobacterium
austroafricanum J Appl Microbiol 94 230-239
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Pollut Bull 57 695-702
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Austral Ecol 18 117-143
Cotrell MT amp Kirchman DL 2000 Natural assemblages of marine proteobacteria and
members of Cytophaga-Flavobacter cluster consuming low- and high molecular
weight dissolved organic matter Appl Environ Microbiol 66 1692-1697
Couling NR Towel MG Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158
3411-3420
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
167
Diaz E Fernandez A Prieto MA amp Garcia JL 2001 Bioremediation of aromatic
compounds by Eschericlia coli Microbiol Mol Biol Rev 65 523-569
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosm
simulation Marine Environ Res 52 195-211
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grant DJW 1967 Kinetic aspect of the growth of Klebsiella aerogenes with some
benzenoid carbon sources J Gen Microbiol 46 213-224
Hall TA 1999 bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 4195-98
Haritash AK Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJWuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kaplan CW Kitts CK 2004 Bacterial succession in a petroleum land treatment unit Appl
Environ Microbiol 70 1777-1786
Karen M amp Chistoserdov AY 2001 Phylogenetic analysis of the sucession of bacterial
communities in the Great South Bay (Long Island) Microb Ecol 35 85-95
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Klee AJ 1993 A computer program for the determination of the most probable number and
its confidence limits J Microbiol Methods 18 91-98
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Loacutepez Z Vila J Ortega-Calvo JJ amp Grifoll M 2008 Simultaneous biodegradation of
creosote-polycyclic aromatic hydrocarbons by a pyrene-degrading Mycobacterium
Appl Microbiol Biotechnol 78 165-172
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
168
MaY Wang L amp Shao Z 2006 Pseudomonas the dominant polycyclic aromatic
hydrocarbon-degrading bacteria isolated from Antarctic soils and the role of large
plasmids in horizontal gene transfer Environ Microbiol 8 455ndash465
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Methods
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
McConkey BJ Duxbury CL Dixon DG amp Greenberg BM 1997 Toxicity of a PAH
photooxidation product to the bacteria Photobacterium phosphoreum and the
duckweed Lemna gibba Effects of phenanthrene and its primary photoproduct
phenanthrenequinone Environ Toxicol Chem 16 892-899
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill App
Environ Microbiol 65 3566-3574
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2011 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Pollut 217 365-374Surridge
AKJ Wehner FC amp Cloete TE 2009 Bioremediation of polluted soil En Singh A
Kuhad RC Ward OP (eds) Adv Appl Biorem p103-121 Springer Berliacuten
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull 56 1184-1191
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
169
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol Progr Ser 390 55-65
Vilagrave M 1998 Efectos de la diversidad de especies en el funcionamiento de los ecosistemas
Orsis 13 105-117
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-97
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Yachi S amp Loreau M 1999 Biodiversity and ecosystem productivity in a fluctuating
environment The insurance hypothesis Proc Natl Acad Sci USA 96 1463-1468
Yu SH Ke L Wong YS amp Tam NFY 2005a Biodegradation of polycyclic aromatic
hydrocarbons (PAHs) by a consortium enrichment from mangrove sediments Environ
Int 32 149-154
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005b Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
bull Discusioacutengeneral
II
Discusioacuten general
173
Discusioacuten general
Temperatura y otros factores ambientales determinantes en un proceso de
biodegradacioacuten
El resultado final de la aplicacioacuten directa de teacutecnicas de biorremediacioacuten en un medio
contaminado estaacute fuertemente influenciado por los paraacutemetros ambientales Por este motivo
son numerosos los estudios (ej Chaicircneau et al 2005 Cheung amp Kinkle 2005 Leys et al
2005 Chen et al 2008) realizados para optimizar y en la medida de lo posible modificar
tanto los factores bioacuteticos como abioacuteticos Frecuentemente la optimizacioacuten se ha llevado a
cabo considerando exclusivamente un solo factor implicado por ejemplo la temperatura
(Torres et al 2005) la concentracioacuten de nutrientes y la relacioacuten CNP (Leys et al 2005) o
el tipo de nutrientes y los surfactantes adicionados (Cheung amp Kinkle 2005) Pocos son los
estudios en los que se valoran dos o tres factores conjuntamente (Kaumlstner et al 1998
Cheung amp Kinkle 2005) y menos auacuten en los que se combinan maacutes de cuatro paraacutemetros
variables Chen et al (2008) destacoacute la importancia de evaluar en el proceso de
optimizacioacuten tanto los efectos individuales como los derivados de la interaccioacuten entre
factores mediante un meacutetodo factorial completo La optimizacioacuten de un proceso de
biorremediacioacuten previo a la aplicacioacuten in situ es fundamental y un disentildeo ortogonal del
experimento va a permitir ademaacutes considerar los efectos sineacutergicos y antagoacutenicos
derivados de la interaccioacuten entre las variables bioacuteticas y abioacuteticas (Chen et al 2008) Los
resultados obtenidos en los dos trabajos de optimizacioacuten que componen el capiacutetulo 1
demuestran que los factores ambientales significativamente influyentes en la tasa de
biodegradacioacuten (kB) de HAP son diferentes cuando se fijan como constantes todos los
paraacutemetros excepto uno (capiacutetulo 1a) que cuando todos los paraacutemetros se consideran
variables y se combinan en un anaacutelisis ortogonal (capiacutetulo 1b) Sin embargo los resultados
obtenidos de un anaacutelisis factorial no invalidan la optimizacioacuten individual la cual es necesaria
y maacutes adecuada en casos en los que tan soacutelo interesa estudiar la influencia de un
determinado factor en el proceso de biodegradacioacuten En algunos casos determinados
paraacutemetros ambientales fijos e inamovibles (ej bajas temperaturas) dificultan el proceso de
biodegradacioacuten y mediante la optimizacioacuten individual y posterior modificacioacuten de otros
factores del medio (ej nutrientes fuente de carbono) se consigue aumentar la eficacia del
proceso Ademaacutes como resultado de la optimizacioacuten indiviadual de factores realizada en el
capiacutetulo 1a de la presente tesis se obtuvo un medio de crecimiento oacuteptimo (capiacutetulo 1) que
que se usoacute en ensayos y experimentos posteriores (capiacutetulos 3 y 4)
Discusioacuten general
174
Dada la elevada variabilidad de resultados que se pueden obtener en la eficacia de
biodegradacioacuten en funcioacuten de los factores ambientales y sus modificaciones proponemos
que los ensayos de optimizacioacuten del proceso para determinar las condiciones oacuteptimas del
mismo es fundamental para maximizar la eficacia (tiempo y costes) de la aplicacioacuten in situ
De entre todos los factores ambientales limitantes de la biodegradacioacuten de
hidrocarburos del petroacuteleo como son los HAP la temperatura es uno de los que maacutes
condiciona la eficacia del mismo (Chen et al 2008) En la presente tesis los procesos de
biodegradacioacuten realizados a bajas temperaturas (capiacutetulo 3 y 4) con el objetivo de evaluar la
influencia de este factor en la eficacia de degradacioacuten y en la comunidad bacteriana
muestran que la degradacioacuten del contaminante es menor a temperaturas inferiores a 15ordmC
(Margesin et al 2002) La notable ralentizacioacuten de las tasas de crecimiento bacteriano y
degradacioacuten a temperaturas bajas (capiacutetulos 3 y 4) fue debida a la menor solubilidad de los
HAP (Haritash amp Kaushik 2009) y al decrecimiento del metabolismo microbiano (Leahy amp
Colwell 1990) Los estudios centrados en la obtencioacuten de la temperatura oacuteptima durante los
procesos de degradacioacuten de HAP por un consorcio bacteriano (Capiacutetulos 1a 1b y 3) han
determinado que no existe un valor oacuteptimo sino maacutes bien un rango oacuteptimo que oscila entre
los 20ordmC y los 30ordmC Tal y como concreta Chen et al (2008) son las fluctuaciones amplias
de temperatura lo que dificulta el proceso de biodegradacioacuten Cuando el rango de variacioacuten
es estrecho y ademaacutes se encuentra dentro de los valores oacuteptimos la influencia es
significativamente despreciable (capiacutetulo 1b) Sin embargo hay que tener presente que
existen ecosistemas susceptibles de ser contaminados en zonas cuyas condiciones
climaacuteticas son extremas Histoacutericamente grandes desastres ecoloacutegicos se han producido en
aacutereas cuyas temperaturas medias estaacuten muy por debajo del rango oacuteptimo como es el caso
del petrolero Exxon Vadez en Alaska (Bence et al 1996) o el Prestige en Espantildea (Soriano
et al 2006) A pesar de la evidente importancia de este aspecto poco se sabe sin embargo
de la degradacioacuten de HAP a temperaturas friacuteas comprendidas entre los 5 ordmC-15 ordmC la cual
es posible gracias a la presencia de especies psicrotolerantes y psicroacutefilas (ldquocold-adaptedrdquo)
(Margesin amp Schinner 2001) Alguna de estas especies que han adquirido o que poseen
intriacutensecamente la capacidad para degradar hidrocarburos pertenecen a los geacuteneros
Pseudomonas Acinetobacter o Pshycrobacter (Eriksson et al 2003 Margesin et al 2003)
La identificacioacuten de estos geacuteneros en los consorcios bacterianos (C2PL05 y BOS08)
posiblemente ha sido determinante en los procesos de biodegradacioacuten a bajas temperaturas
(capiacutetulos 3 y 4) ya que aunque con menores tasas que a temperaturas altas la
biodegradacioacuten ha sido posible Estas especies son claves para el mantenimiento de dicha
comunidad ya que su actividad metaboacutelica durante periodos de bajas temperaturas o en
ambientes permanentemente friacuteos permite la mineralizacioacuten de los hidrocarburos y
subsecuente formacioacuten de otros compuestos maacutes sencillos y faacuteciles de degradar por el resto
Discusioacuten general
175
de las especies del consorcio o la comunidad (Pelz et al 1999) La utilizacioacuten de consorcios
bacterianos adaptados a climas friacuteos compuestos por especies con capacidad degradadora
puede ser una medida de actuacioacuten fundamental en aacutereas extremas Ademaacutes a partir de
estas cepas psicrotolerantes y psicroacutefilas se estaacuten aislando enzimas oxidativas capaces de
trabajar a bajas temperaturas con un importante potencial en procesos biotecnoloacutegicos
(Cavicchioli et al 2002)
Consorcios bacterianos durante un proceso de biodegradacioacuten factores que
determinan la sucesioacuten de especies
La sucesioacuten de especies en un consorcio durante un proceso de biodegradacioacuten depende
en gran medida de ciertas caracteriacutesticas celulares y metaboacutelicas de las especies que lo
componen sobre todo cuando la fuente de carbono son HAP de alto peso molecular
(Mueller et al 1997) Por ejemplo algunas especies de Pseudomonas (P aeruginosa
Soberon-Chavez et al 2005) tienen la capacidad de producir biosurfactantes para aumentar
la biodisponibilidad de HAP o bien como es el caso de las Gram-positivas la presencia de
una uacutenica membrana permite un transporte maacutes eficaz de los HAP al interior de la ceacutelula
(Mueller et al 1997) En la mayoriacutea de los casos las sustancias que se presentan como
recalcitrantes para una especie individual pueden metabolizarse a traveacutes de secuencias
cataboacutelicas complementarias que presentan las diferentes especies de un consorcio
(Fritsche 1985) De ahiacute que con los consorcios microbianos se puedan obtener tasas de
degradacioacuten mucho maacutes elevadas que con cepas individuales (Bautista et al 2009) Sin
embargo la estabilidad y eficacia de un consorcio bacteriano estaacuten determinadas por las
relaciones de supervivencia entre las especies que lo componen Un caso en el que las
asociaciones bacterianas son fundamentales son los procesos de biorremediacioacuten a bajas
temperaturas ya que tal y como Leahy amp Cowell (1990) exponen los consorcios bacterianos
cuentan con una capacidad enzimaacutetica maacutes amplia que especies aisladas y por tanto
mayor versatilidad y superioridad de supervivencia
Una modificacioacuten sobre el consorcio como es la dilucioacuten del mismo (capiacutetulo 1b)
puede afectar a las tasas de degradacioacuten finales precisamente porque modifican las
relaciones inicialmente establecidas entre las especies Igualmente este paraacutemetro puede
modificar el patroacuten de crecimiento sin que esto suponga un cambio significativo en la tasa de
degradacioacuten (capiacutetulo 1b) hecho que dependeraacute de la capacidad degradadora de la especie
favorecida (Szaboacute et al 2007) Por tanto la concentracioacuten del inoacuteculo introducido en un
medio contaminado puede condicionar la eficacia del proceso
Discusioacuten general
176
En los diferentes experimentos que componen los capiacutetulos de este proyecto doctoral
no se han realizado pruebas fisioloacutegicas para estudiar las rutas metaboacutelicas o la importancia
relativa del cometabolismo que condicionen la sucesioacuten o composicioacuten de especies de una
comunidad Sin embargo los anaacutelisis de la comunidad bacteriana a traveacutes de la
identificacioacuten de especies cultivables (capiacutetulos 2 y 3) y no cultivables (capiacutetulos 2 3 y 4)
mediante teacutecnicas moleculares indican que la comunidad bacteriana cambia y por tanto
existe una sucesioacuten y coexistencia determinada de especies en el tiempo Los resultados
obtenidos en el capiacutetulo 2 indican que las especies del consorcio cambian en funcioacuten de la
fuente de carbono disponible (HAP y subproductos de degradacioacuten de HAP) y la presencia
de determinados surfactantes (Tween-80 y HAP o solo HAP) por lo que eacutestos pueden ser
factores que intervienen en la sucesioacuten de especies en un consorcio En muchos procesos
de biodegradacioacuten es comuacuten la adicioacuten de ciertas fuentes de carbono para aumentar la
biomasa de los consorcios bacterianos o cepas concretas y acelerar por tanto el proceso de
biodegradacioacuten (Chen amp Aitken 1999 Lee et al 2003) Sin embargo dada la mencionada
influencia de la fuente de carbono sobre la composicioacuten de especies el resultado de esta
medida puede ser negativo en consorcios bacterianos en los que coexistan especies
degradadoras de una determinada fuente de carbono (ej HAP) con otras que no lo son
(capiacutetulo 1a y 1b) Este hecho es debido a que la adaptacioacuten a la nueva fuente de carbono
de los microorganismos degradadores de HAP se traduce en un aumento de la fase de
latencia y por tanto en un retraso de la tasa de degradacioacuten (Maier et al 2009) Este
fenoacutemeno se pudo observar con claridad cuando se suministroacute al consorcio degradador
C2PL05 glucosa como uacutenica fuente de carbono o en combinacioacuten con HAP (capiacutetulos 1a y
1b)
Nuevas especies bacterianas degradadoras de HAP
La identificacioacuten de especies en los numerosos trabajos de biodegradacioacuten realizados hasta
el momento verifican la existencia de una importante variedad de bacterias degradadoras
de HAP Sin embargo esto no implica que no haya taxa particularmente bien adaptados a
medios contaminados (Mueller et al 1997) y que frecuentemente esteacuten involucrados en
procesos de biodegradacioacuten Este es el caso de geacuteneros como Pseudomonas
Acinetobacter Sphingomonas y Stenothrophomonas identificados durante los ensayos que
componen los capiacutetulos 2 3 y 4 Ademaacutes de la identificacioacuten de especies pertenecientes a
estos geacuteneros ampliamente descritos en procesos de biodegradacioacuten (ej Pseudomonas
Sphingomonas Sphingobium Ralstonia Flexibacter Rhodococcus y Bacillus) cabe
destacar la importancia del aislamiento e identificacioacuten de secuencias englobadas en nuevos
geacuteneros degradadores ineacuteditos hasta el momento o cuya implicacioacuten en estos procesos es
Discusioacuten general
177
escasa Este es el caso de Enterobacter cloacae y E ludwigii (γ-Proteobacterias)
identificadas en el consorcio C2PL05 como degradadoras de HAP de bajo peso molecular
Incluso en un estudio previo (Bautista et al 2009) se ha determinado que la eficacia
degradadora de este geacutenero es mucho maacutes eficaz que otras especies degradadoras
frecuentemente descritas como Pseudomonas fluorescens o Stenotrophomonas maltophilia
Pantoea aglomerans (γ-Proteobacterias) es otra Enterobacteriaceae identificada por primera
vez como degradadora de (capiacutetulo 4) En escasas ocasiones (Toledo et al 2006) una
especie de la familia Enterobacteraceae ha sido identificada como degradadora de HAP o
de crudo (Zhang et al 2010) Asiacute mismo es la primera vez que bacterias Gram-positivas
pertenecientes a los geacuteneros Balneimonas sp (capiacutetulo 4) Bradyrhizobium sp y
Nitrobacteria sp (capiacutetulo 2) todas α-Proteobacterias y por otro lado el geacutenero
Microbacterium sp (Phylum Actinobacterias Capiacutetulo 3) se relacionan con procesos de
biodegradacioacuten de HAP y en procesos de mineralizacioacuten de sustancias recalcitrantes La
presencia de estos organismos debe quedar justificada por su capacidad degradadora dado
que han sido identificadas a partir de bandas de gran intensidad en DGGE teacutecnica que se
ha realizado con muestras procedentes de ensayos de biodegradacioacuten de HAP y creosota
(capiacutetulos 2 3 y 4) Es decir su mera presencia en el consorcio no parece justificable por
causas aleatorias sino maacutes bien por su implicacioacuten directa en los procesos metaboacutelicos
asociados a la degradacioacuten Por ejemplo el aislamiento e identificacioacuten en el capiacutetulo 2 de
especies del geacutenero Nitrobacteria podriacutea estar relacionada con la reduccioacuten de nitritos
presentes en el medio contaminado (capiacutetulo 2 Gonzaacutelez et al 2010)
Los resultados de identificacioacuten mediante teacutecnicas moleculares muestran la evidente
variedad de geacuteneros implicados en estos procesos La variabilidad observada fue mucho
menos intensa con las teacutecnicas moleculares dependientes de cultivo (capiacutetulo 2) ya que tan
solo entre un 1 y un 10 del total de bacterias del suelo son cultivables (Nannipieri et al
2003) Algunos autores (Menn et al 1993 Okpokwasili et al 1986) proponen que los genes
cataboacutelicos para la degradacioacuten de HAP probablemente se transmitan horizontalmente
mediante plaacutesmidos entre bacterias pertenecientes a grupos taxonoacutemicos muy diferentes
Mueller et al (1997) afirman que no es probable encontrar una clara relacioacuten entre grupos
taxonoacutemicos de bacterias y la produccioacuten de enzimas implicadas en la degradacioacuten de
hidrocarburos aromaacuteticos Por tanto no es extrantildeo que genes homoacutelogos (en este caso
degradativos) se expresen en bacterias que taxonoacutemicamente estaacuten muy poco relacionadas
(capiacutetulos 2 3 y 4) otorgando una alta variabilidad al conjunto de bacterias con capacidad
degradadora
Discusioacuten general
178
Preexposicioacuten a los HAP iquestes necesaria para una biodegradacioacuten eficaz HAP
Tradicionalmente algunos autores han sugerido que la preexposicioacuten de bacterias a un
determinado contaminante es necesaria para la adaptacioacuten y consecuente degradacioacuten
(Spain amp van Veld 1983) o para un aumento en la tasa del proceso (Haritash amp Kaushik
2009) Sin embargo autores como Johnsen amp Karlson (2005) se plantean si eacutesta es una
capacidad presente en las comunidades microbianas independientemente de su previa
exposicioacuten o si es una capacidad inducida por la exposicioacuten a elevados niveles de
contaminante Los procesos de biodegradacioacuten realizados con consorcios bacterianos
procedentes de zonas libres de contaminacioacuten por HAP (capiacutetulos 3 y 4) indican que eacutesta
es una capacidad intriacutenseca en las bacterias e independiente de la previa exposicioacuten y que
se manifiesta ante un periodo de contaminacioacuten Los geacuteneros identificados en el capiacutetulo 3
(Ralstonia Pseudomonas o Bacillus) son propios de sistemas con un alto contenido en
madera en descomposicioacuten en los que contribuyen a la degradacioacuten de lignocelulosa
celulosa y sus subproductos mediante enzimas oxidativas (Rastogi et al 2009) Las
enzimas lignoliacuteticas de los hongos saproacutefitos degradan compuestos con estructuras
quiacutemicas similares a la lignina como son los HAP (Hatakka 1994 2001 Barr amp Aust 1994
Meulenberg et al 1997) Por tanto las especies bacterianas con la bateriacutea enzimaacutetica para
degradar subproductos de lignina y celulosa pueden tambieacuten adaptarse y metabolizar HAP
(Tian et al 2008 Couling et al 2010) La capacidad degradadora de este tipo de
compuestos no solo se transmite de manera vertical sino que la transferencia horizontal de
genes puede ser tambien un factor determinante para la adquisicioacuten de esta capacidad entre
los microorganismos del consorcio o comunidad
Los resultados referentes a la alta capacidad degradativa que muestra el consorcio
BOS08 procedente de una zona limpia (capiacutetulo 3) gozan de una extraordinaria importancia
a nivel aplicado y ecoloacutegico La mayoriacutea de los trabajos que estudian el posible paralelismo
entre la degradacioacuten de lignina y la de compuestos aromaacuteticos se han llevado a cabo con
hongos maderables de la llamada ldquopodredumbre blancardquo El hecho de que un consorcio
bacteriano no adaptado a la degradacioacuten de HAP sea capaz de metabolizar eficazmente
HAP de alto peso molecular y ademaacutes disminuya la toxicidad del medio por debajo del
umbral de la toxicidad incluso a bajas temperaturas sin duda abre un campo de
investigacioacuten muy amplio dentro de la biorremediacioacuten Ecofisioloacutegicamente hablando
resultan tambieacuten de gran intereacutes estas espcies que han sido capaces de readaptar su
bateriacutea enzimaacutetica para metabolizar una fuente de carbono altamente recalcitrante y toacutexica
que no estaba presente en su medio natural
Discusioacuten general
179
Posibles actuaciones en un medio contaminado
Ante un caso de contaminacioacuten de un medio con HAP o sustancias que los contengan la
biorremediacioacuten resulta una de las teacutecnicas maacutes eficaces y respetuosas con el medio La
atenuacioacuten natural del contaminante por los microorganismos presentes en el propio medio
depende seguacuten Frosyth et al (1995) del tamantildeo de la poblacioacuten degradadora autoacutectona No
obstante los resultados obtenidos durante el proceso de biorremediacioacuten de un suelo
contaminado con creosota (capiacutetulo 4) indican que los resultados que puede ofrecer la
atenuacioacuten natural no dependen uacutenicamente del nuacutemero inicial de microorganismos
degradadores Las pruebas realizadas indicaron en el momento que se produjo la
contaminacioacuten la actividad degradadora era nula aunque tras un corto peridodo de
exposicioacuten al mismo comenzoacute la actividad de los microorganismos degradadores Esto
quiere decir que aunque en un primer momento la poblacioacuten degradadora sea miacutenima la
presencia del contaminante favorece su dominancia y hace patente su capacidad
degradadora Ademaacutes hay que tener en cuenta varias de las cuestiones abordadas en
apartados previos como son la rapidez y facilidad que tienen los microorganismos para
transferir esta capacidad incluso entre diferentes taxas (Menn et al 1993) o la alta
adaptabilidad a una nueva fuente de carbono Sin embargo la atenuacioacuten natural es una
teacutecnica muy ventajosa porque evita dantildeos en la comunidad bacteriana del medio a
diferencia de cualquier otra actuacioacuten que en menor o mayor medida modifican las
condiciones originales del ecosistema
Uno de los principales problemas de la biorremediacioacuten es el tiempo necesario para
la completa eliminacioacuten del contaminante del medio para lo cual se han desarrollado
estrategias de actuacioacuten con el uacutenico objetivo de acelerar y mejorar la eficacia del proceso
La bioestimulacioacuten tiene como principal objetivo potenciar la capacidad degradadora de los
microorganismos degradadores autoacutectonos mediante la adicioacuten de nutrientes inorgaacutenicos al
medio contaminado Sin embargo los resultados referentes a esta teacutecnica no son
concluyentes dada la elevada variabilidad de los mismo Los casos en los que la
bioestimulacioacuten favorece el proceso de biodegradacioacuten estaacuten estrechamente relacionados
con el impedimento de que los nutrientes se conviertan en un factor limitante para los
microorganismos ya que tal y como expone Leys et al (2005) los requerimientos de
nitroacutegeno y foacutesforo aumentan notablemente durante un episodio de contaminacioacuten Sin
embargo son numerosos los estudios que han obtenido resultados desfavorables con esta
teacutecnica debido a cuestiones relacionadas con altos iacutendices de salinidad (Braddock et al
1997) o tal y como se observa en el capiacutetulo 4 con los cambios que la bioestimulacioacuten
genera en la comunidad bacteriana que en muchos casos inducen a relaciones negativas
entre las especies de la comunidad debido a la competencia por los nutrientes (Rolling-
Discusioacuten general
180
Willfred et al 2002) Por otra parte la bioestimulacioacuten durante el proceso de
biorremediacioacuten del suelo contaminado con creosota (capiacutetulo 4) no favorecioacute
significativamente la biodegradacioacuten del contaminante Estos resultados se pueden atribuir a
una concentracioacuten de nutrientes suficientes en el medio o bien a la raacutepida y efectiva
capacidad degradativa de creosota que mostraron los microorganismos autoacutectonos
El bioaumento es una teacutecnica que pretende incrementar la eficacia del proceso de
biorremediacioacuten mediante el inoacuteculo a la poblacioacuten autoacutectona de una poblacioacuten
degradadora previamente definida como tal Sin embargo es un tratamiento complejo cuyos
resultados dependen de algo tan desconocido y variable como son las relaciones entre
especies y comunidades (Yu et al 2005) Por ello no hay gran nuacutemero de artiacuteculos en los
que se describan resultados favorables de esta teacutecnica pero podemos resumir que las
consecuencias del bioaumento dependen fundamentalmente de dos cuestiones Una de
ellas es que las relaciones de competencia que se establecen entre la comunidad
introducida y autoacutectona sean negativas para la poblacioacuten degradadora (Vintildeas et al 2005
Yu et al 2005) relaciones que principalmente estaacuten dirigidas por la competicioacuten por los
recursos (Yu et al 2005) La inexistencia de efectos significativos del bioaumento durante el
proceso de bodegradacioacuten de creosota (capiacutetulo 4) al igual que los descritos por Herwignen
et al (2005) indican que la presencia de una comunidad bacteriana autoacutectona con
capacidad degradadora o que se adapta raacutepidamente como es nuestro caso puede ser otra
de las cuestiones que hagan que el bioaumento no favorezca el proceso
Los ensayos de biorremediacioacuten realizados durante la presente tesis y los
consultados en las diferentes referencias bibliograficas nos llevan a concluir una vez maacutes
que los efectos de las diferentes teacutecnicas de biorremediacioacuten dependen de las condiciones
del medio contaminado y de la poblacioacuten bacteriana que alberga Por ello un estudio previo
que indique las caracteriacutesticas bioacuteticas (capacidad degradadora composicioacuten y evolucioacuten de
la comunidad bacteriana) y abioacuteticas (temperatura ambiente y caracteriacutesticas fisico-quiacutemicas
del suelo) del mismo asiacute como un breve ensayo a escala de laboratorio donde se apliquen
las diferentes teacutecnicas y seleccionando las maacutes adecuadas mejora en gran medida la
efectividad de la biorremediacioacuten in situ
Conclusiones generales
III
Conclusiones generales
183
Conclusiones generales
De los trabajos llevados a cabo en esta tesis doctoral se pueden extraer las siguientes
conclusiones generales
1 La optimizacioacuten de los factores abioacuteticos y bioacuteticos hace que el proceso de
biodegradacioacuten sea maacutes eficaz y permite modificarlo mediante estrategias de
biorremediacioacuten
2 Los factores que realmente influyen significativamente en un proceso se observan
mediante un estudio ortogonal de los mismos porque permite evaluar las
interacciones entre los factores seleccionados
3 No todos los ambientales son limitantes para la degradacioacuten de HAP Po ejemplo la
bioestimulacioacuten con nutrientes inorgaacutenicos no es efectiva en casos en los que la
cantidad de nutrientes en el medio es suficiente La adicioacuten de glucosa como fuente
adicional de carbono no es necesaria cuando el consorcio esta adaptado a los HAP
como fuente de carbono
4 Las actuaciones basadas en la adicioacuten de fuentes de carbono adicionales a los HAP
no son efectivas cuando los consorcios o cepas bacterianas estaacuten adaptadas a los
HAP porque esto supone un periodo de readaptacioacuten
5 La fuente de carbono disponible en cada momento durante un proceso de
biodegradacioacuten de HAP y otras sustancias en el medio como los surfactantes
condicionan la presencia de especies y por tanto la sucesioacuten de las mismas
6 La aparicioacuten de nuevas especies previamente no descritas como degradadoras
puede estar relacionada con la transferencia horizontal de genes degradativos que
en muchos casos ocurre entre grupos taxonoacutemicos poco relacionados lo que
ampliariacutea auacuten maacutes la expresioacuten de la capacidad degradativa en la comunidad
7 La identificacioacuten en un consorcio procedente de una zona limpia y rica en materia
orgaacutenica de especies fundamentales en sistemas de degradacioacuten de madera
sugiere que las enzimas oxidativas usadas por estas especies en la degradacioacuten de
subproductos de lignina y celulosa se emplean en la degradacioacuten de HAP Por tanto
Conclusiones generales
184
la previa exposicioacuten de los consorcios bacterianos o cepas individuales a un
contaminante no es necesaria cuando tienen una bateriacutea enzimaacutetica que se puede
adaptar y metabolizar el contaminante
8 El papel de las especies bacterianas adaptadas a la degradacioacuten de HAP en
ambientes friacuteos (Tordf lt 15ordmC) es fundamental para la biorremediacioacuten en climas
extremos Ademaacutes la actividad de estas especies en periodos de bajas temperaturas
permite el crecimiento de otras especies de la comunidad bacteriana a partir de los
subproductos de degradacioacuten
9 El bioaumento es una teacutecnica cuyos resultados estaacuten ampliamente influenciados por
las relaciones que se establecen entre la comunidad autoacutectona e introducida y soacutelo
se recomienda en aquellos casos en los que la comunidad autoacutectona no tenga
microorganismos degradadores o no sean capaces de desarrollar esta capacidad
Referencias bibliograacuteficas
IV
Referencias bibliograacuteficas
187
Referencias bibliograacuteficas
Aislabie J Foght J amp Saul D 2000 Aromatic hydrocarbon-degrading bacteria from soil near
Scott Base Antarctica Polar Biol 23 183-188
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Baek KH Yoon BD Kim BH Cho DH Lee IS Oh HM amp Kim HS 2007 Monitoring of
microbial diversity and activity during bioremediation of crude oil-contaminated soil
with different treatments J Microbiol Biotechnol 17 67-73
Barkay T amp Pritchart H 1988 Adaptation of aquatic microbial communities to pollutant
stress Microbiol Sci 5165-169
Barr DP amp Aust SD 1994 Mechanisms with rot fungi use to degrade pollutants Environ
Sci Technol 28 78A-87A
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Braddock JF Ruth ML Catterall PH Walworth JL amp McCarthynd KA 1997
Enhancement and inhibition of microbial activity in hydrocarbon contaminated arctic
soil implication for nutrients amended bioremediation Environ Sci Technol 31
2078-2084
Cavicchioli R Siddiqui KS Andrews D amp Sower KR 2002 Low temperature
extremophiles and their applications Curr Opin Biotechnol 13 253-261
Cerniglia1984 Microbial metabolism of polycyclic aromatic hydrocarbons Adv Appl
Microbiol 30 31-71
Cerniglia 1992 Biodegradation of polycyclic aromatic hydrocarbons Biodegradation 2-3
351-368
Referencias bibliograacuteficas
188
Chaicircneau CH Morel J Dupont J Bury E amp Oudot J 1999 Comparison of the fuel oil
biodegradation potential of hydrocarbon assimilating microorganisms isolated from a
temperate agricultural soil Sci Total Environ 227 237-247
Chaicircneau CH Rogeus G Yeacutepreacutemian C amp Outdot J 2005 Effects of nutrients
concentration on the biodegradation of crude oil and associated microbial
populations in the soil Soil Biol Biochem 37 1490-1497
Chauhan A Fazlurrahman Oakeshott JG amp Jain RK 2008 Bacterial metabolisms of
polycyclic aromatic hydrocarbons strategies for remediation Indian J Microbiol
4895-113
Chen S-H amp Aitken MD 1999Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
Environ Sci Technol 33 435ndash439
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of polycyclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Cheung P-Y amp Kinkle BK 2005 Effect of nutrients and surfactant on pyrene mineralization
and Mycobacterium spp populations in contaminated soil Soil Biol Biochem 37
1401-1405
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Clements WH Oris JT amp Wissin TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Leponis macrochirus
Arch Environ Contam Toxicol 26261-266
Colwell RR Mills AL Walker JD Garcia Tello P amp Campos V 1978 Microbial ecological
studies at the Metula spill in the Strait of Magellan J Fish Res Board Can 35573-
580
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Poll 158 3411-
3420
Das K amp Mukherjee AK 2006 Crude petroleum-oil biodegradation efficiency of Bacillus
subtillis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India Bioresour Technol 98 1339-1345
Delille D amp Pelletier E 2002 Natural attenuation of diesel-oil contamination in a subantartic
soil (Crozet island) Polar Biol 25 682-687
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge App Environ Mirobiol 37 729-739
Referencias bibliograacuteficas
189
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosms
simulation Marine Environ Res 52 195-211
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in artic tundra soil Appl Environ Microbiol 67 5107-
5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap
Evolution 39 783-791
Fiechter A 1992 Biosurfactants moving towards industrial application Trends Biotechnol
10 208-217
Fritsche JD 1985 Nature and significance of microbial cometabolism of xenobiotics J
Basic Bacteriol 25 603-619
Forsyth JV Tsao YM amp Bleam RD 1995 Biorremediation when is augmentation needed
In Hinchee RE Fredrickson J amp Alleman BC (Eds) Bioaugmentation for site
remediation Battelle Press Columbus pp 1-14
Ghazali FM Rahman RNZA Salleh AB amp Basr M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grimberg SJ Stringfellow WT amp Aitken MD 1996 Quantifying the biodegradation of
phenanthrene by Pseudomonas stutzeri P16 in the presence of a nonionic surfactant
Appl Environ Microbiol 62 2387-2392
Habe H amp Omori T 2003 Gentics of polycyclic aromatic hydrocarbon metabolisms in
diverse aerobic bacteria Biosci Biotechnol Biochem 67 225-243
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of polycyclic aromatic
hydrocarbons (PAHs) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microbial Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M amp Steinbuchel A (eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJ Wuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
Referencias bibliograacuteficas
190
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Internacional Agency for Research on Cancer 1972-1990 Monographs on the evaluation of
carcinogenics risks on human International Agency for Research on Cancer Lyons
France
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Johnsen AR Wick LY amp Harms H 2005 Principles of microbial PAH-degradation in soil
Environ Pollut 133 71-84
Johnsen AR Lipthay JR Sorensen SJ Ekelund F Christensen P Andersen O
Karlson U amp Jcobsen CS 2006 Microbial degradation of street dust polycyclic
aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil
Environ Microbiol 8535-545
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kanaly RA amp Harayama S 2000 Biodegradation of high molecular weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059-2067
Kaumlstner M Breueer-Jammali M amp Mahro B 1998 Impact of inoculation protocols salinity
and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil Appl Environ Microbiol 64 359-362
Kim Y H Freeman J P Moody J D Engesse K H amp Cerniglia C E 2005 Effects of pH
on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii
PYR-1 Appl Environ Microbiol 67 275ndash285
Koeber R Bayona JM amp Niessner R 1999 Determination of benzene[a]pyrene diones in
air particulates matter with liquid chromatography mass spectrometry Environ Sci
Technol 33 1552-1558
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Lee ML Novotny MV amp Bartle KD 1981 Analytical chemistry of polycyclic aromatic
hydrocarbons Academic Press Inc New York NY
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegrdation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Referencias bibliograacuteficas
191
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation by
Mycobacterium and Sphingomonas in soil Appl Microbiol Biotechnol 66 726-736
Lim LH Harrison RM amp Harrad S 1999 The contribution of traffic to atmospheric
concentration of polycyclic aromatic hydrocarbons Environ Sci Technol 33 3538-
3542
Liu Y Zhu L amp Shen X 2001 Polycyclic aromatic hydrocarbons in indoor and outdoor air of
Hangzhou China Environ Sci Technol 35 840-844
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Maliszewska-Kordybach B 1996 Polycyclic aromatic hydrocarbons in agricultural soils in
Poland preliminary proposals for criteria to evaluate the level of soil contamination
Appl Geochem 11 212-127
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts
Extremophiles 7451ndash458
Martiacuten Guirao L 2007 Aproximacioacuten ecotoxicoloacutegica a la contaminacioacuten por metales
pesados en la laguna costera del Mar Menor Tesis doctoral Universidad de Murcia
Murcia
Menn F-M Applegate BM amp Sayler GS 1993 NAH-plasmid mediated catabolisms of
anthracene and phenanthrene to naphtoic acids Appl Environ Microbiol 59 1938-
1942
Meulenberg R Rijnaarts HHM Doddema HJ amp Field A 1997 Partially oxidized polycyclic
aromatic hydrocarbons show an increased bioavailability and biodegradability FEMS
Microbiol 152 45-49
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Referencias bibliograacuteficas
192
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mueller JG Chapman PJ Blattman BO amp Pritchard PH 1990 Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis Appl
Environ Microbiol 56 1079-1086
Mueller JG Devereux R Santavy DL Lantz SE Willis SG amp Pritchard PH 1997
Phylogenetic and Physiological comparisions of PAH-degrading bacteria from
geographically diverse soils A van Leeuw J Microb 71 329-343
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions European J Soil Sci 54 655-670
Okpokwasili GC Somerville CC Grimes DJ amp Colwell RR 1986 Plasmid-associated
phenanthrene degradation by Chesapeake Bay sediment bacteria A Colloq Inst
Fran Rech Exploit Mer 3 601ndash610
Pelz O Tesar M Wittich RM Moore ERB Timmis KN Abraham WR 1999 Towards
elucidation of microbial community metabolic pathways unrevealing the network of
carbon sharing in a pollutant-degrading bacterial consortium by immunocapture and
isotopic ratio mass spectrometry Environ Microbiol 1167ndash174
Portaels F amp Pattyn SR 1982 Growth of mycobacteria in relation to the pH of the medium
Ann Microbiol 133 213-221
Puntus IF Filonov AE Akhmetov LI Karpov AV amp Boronin AM 2008 Phenanthrene
degradation by bacteria of the genera Pseudomonas and Burkholderia in model soil
systems Microbiology 77 7-15
Rastogi G Muppidi GL Gurram RN Adhikari A Bischoff KM Hughes SR Apel WA
Bang SS Dixon DJ amp Sani RK 2009 Isolation and characterization of cellulose-
degrading bacteria from the deep subsurface of the Homestake gold mine Lead
South Dakota USA J Ind Microbiol Biotechnol 36 585-598
Readman J W Fillmann G Tolosa I Bartocci J Villeneuve J -P Catinni C amp Mee L D
2002 Petroleum and PAH contamination of the Black Sea Marine Pollut Bull 44
48-62
Rolling Willfred FM Milner MG Jones DM Lee K Danniel F Swanell Richard JP amp
Head IM 2002 Robust hydrocarbons degradation and dynamics of bacterial
communities during nutrients-enhanced oil spill bioremediation Appl Environ
Microbiol 68 5537-5548
Rosenberg E amp Ron EZ 1999 High ndash and low- molecular mass microbial surfactant Appl
Microiol Biotechnol 52 154-162
Referencias bibliograacuteficas
193
Santos E C Jacques R J S Bento F M Peralba M-C R Selbach PA Saacute E L S
Camargo FAO 2008 Anthracene biodegradation and surface activity by an iron-
stimulated Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Shuttleworth KL amp Cerniglia E 1995 Environmental aspect of PAH biodegradation Appl
Biochem Biotechnol 54 291-302
Soberon-Chavez G Lepine F amp Deziel E 2005 Production of rhamnolipids by
Pseudomonas aeruginosa Appl Microbiol Biotechnol 68 718-725
Soriano JA Vintildeas MA Franco JJ Gonzaacutelez JM amp Albaigeacutes J 2006 Spatial and
temporal trends of petroleum hydrocarbons in wild mussels from the Galician coast
(NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquat Microb Ecol 47 1-10
Tian L Ma P amp Zhong J-J 2003 Impact of presence of salicylate or glucose on enzyme
activity and phenanthrene degradation by Pseudomonas mendocina Process
Biochem 38 1125-1132
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull56 1184-1191
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons
removal capacities Syst Appl Microbiol 29 244-252
Torres LG Rojas N Bautista G amp Iturbe R 2005 Effect of temperature and surfactantacutes
HLB and dose over the TPH-diesel biodegradation process in aged soils Process
Biochem 40 3296-3302
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated Soil App Environ Microbiol 71 7008-7018
Wagrowski DM amp Hites RA 1997 Polycyclic aromatic hydrocarbons accumulation in urban
suburban and rural vegetation Environ Sci Technol 31 279-282
Referencias bibliograacuteficas
194
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacilus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Pollut 139 1-13
Wu SC amp Gschwend PM 1986 Sorption kinetics of hydrophobic organic compounds to
natural sediments and soil Environ Sci Technol 20 717-725
Ye B Siddigi MA Maccubbin AE Kumar S amp Sikka HC 1996 Degradation of
polynuclear aromatic hydrocarbons by Sphyngomonas paucimobilis Environ Sci
Technol 30136-142
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005 Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
Zender M 1983 Physical and chemical properties of polycyclic aromatic hydrocarbons p 1-
26 In ABjorseth (ed) Handbook of polycyclic aromatic hydrocarbons Marcel
Dekker Inc New York NY
Zhang XX Cheng SP Zhu CJ amp Sun SL 2006 Microbial PAH-degradation in soil
degradation pathways and contributing factors Pedosphere 16 555-565
Zhang Z Gai L Hou Z Yang C Ma C Wang Z Sun B He X Tang H amp Xu P 2010
Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils Bioresource Technol 101 8452ndash8456
Agradecimientos
197
Agradecimientos
Todaviacutea recuerdo el primer diacutea que entre en el departamento en el laboratorio
aquello me parecioacute todo un mundo en el cual sin quererlo y sin estar convencida de
ello acabeacute metida de lleno Poco a poco fueron pasando los meses los antildeos
presenteacute el Practicum y me diacute cuenta de que queriacutea seguir adelante Unos cuantos
antildeos despueacutes he llegado a la meta lo cual no hubiera sido posible sin mucha gente
que me ha apoyado ayudado y empujado en los momentos en los que yo no podiacutea
maacutes A todos ellos gracias por hacer que esto haya sido posible
El primero de mis agradecimientos va dirigido a Natalia Fernando y Mari
Carmen Os tengo que dar las gracias por brindarme la oportunidad de formar parte
del grupo y por tantas cosas que con cada uno de vosotros he aprendido Despueacutes
de estos antildeos creo que hemos conseguido cosas maravillosas aunque hayamos
tenido imprevistos de todo tipo porque como ya sabemos si ponemos un circo nos
crecen los enanoshellippero aquiacute estamos Somos un grupo muy equilibrado
profesionalmente tenemos un poco de todo y por otro lado no es mal balance tres
histeacutericas frente a uno que pone la calma no se como no hemos acabado contigo
Fernando Natalia gracias por hacerme controlar el miura que llevo dentro y tener
tanta paciencia Carmen gracias por estar siempre ahiacute ya sea desde Espantildea desde
el otro lado del charco o nada mas ser mamaacute En todo momento a nivel personal y
profesional me he sentido arropada por vosotros gracias por vuestro apoyo y ganas
de seguir adelante Vosotros habeis sido los responsables de que quiera investigar
Si una persona en concreto se merece especial agradecimiento es mi Yoli
Aunque al principio de todo no nos conociacuteamos no hay mas que vernos ahora Por
un lado ha sido imprescindible la ayuda que me has dado trabajando cuando maacutes
perdida estaba Por todo tu apoyo ten presnete que me has ayudado a escribir cada
una de las liacuteneas que has leiacutedo Has sabido ser mi amiga y estar conmigo cuando
maacutes lo he necesitado y hacer que me olvidara de todo ya sea haciendo toriijas
pizzas viendo una peli tomando una copichuela o con nuestros preciados pinchitos
sobre todo estos uacuteltimos meses estresantes en los que no seacute como no te he vuelto
loca Gracias tambieacuten por hacerme reir hasta llorar por preocuparte cada diacutea de
198
estas uacuteltimas semanas de coacutemo voy por conocerte todas y cada una de las cosas
en las que estoy trabajando y un largo etc Te conoces mejor yo el estado de cada
uno de mis artiacuteculos las correcciones que tengo y las que me faltan Eres estupenda
y espero no dejar de descubrir nunca cosas sobre ti Mil gracias
Son muchas las personas que han pasado por el despacho Pepe aunque
estas muy muy lejos agardezco tu ayuda continua sobre todo en el Maacutester la mitad
de las cosas se me hubieran olvidado si no hubiera sido por ti que cabeza la miacutea
Tambieacuten tengo que recordar a Raquel Felipe y Cris el antiguo equipo Ecotox
pasamos muy buenos ratos que se echan de menos A mis actuales compantildeeros
Alfredo Pesca Julia Silvia y Carlos que aunque no estas en el despacho como si lo
estuvieras Gracias por amenizar las horas de laboratorio y los madrugones Silvia
especialmente a ti gracias por sacar siempre un rato para charlar y escucharnos
mutuamente aunque nos separen un porroacuten de cajas y un poto gigante ahiacute estas
siempre Espero seguir aquiacute mucho tiempo para apoyarte igual que tuacute lo has hecho
conmigo Cris no me olvido de ti que desde el principio y hasta ahora te has
preocupado de saber que tal me iba estabas al tanto de todo y me has animado a
seguir adelante Te deseo que las cosas te vayan genial porque te lo mereces
asique aacutenimo que no es por presionar pero en breve te toca a tiacute Me faltan palabras
para contar todo lo que Moacutenica y Andrea me han ayudado y ensentildeado desde un
primer momento Igualmente agredezco el apoyo que Patri y Ester me han dado al
igual que los buenos ratos cotilleando imprescindibles Tambieacuten tengo que
agradecer a Jose Luis Sanz de la Universidad Autoacutenoma de Madrid que me abriera
las puertas de su laboratorio para aprender la maravillosa teacutecnica del DGGE y unas
cuantas cosas maacutes Ine a tiacute si que te agradezco un montoacuten las horas que has
perdido de tu trabajo para ensentildearme Desde un primer momento simpre con la
sonrisa puesta auacuten sin concocerme de nada Han sido muchos los viajes que he
hecho y el tiempo empleado en ello pero ha merecido la pena Asique igualmente
formas parte de esta tesis porque cada uno de los artiacuteculos no hubieran estado
completos sin tu ayuda
Son muchas las personas que sin formar parte del gremio han estado siempre
presentes Mis padres y mi hermano ya sabeis que no podriacutea hacer nada sin
vosotros a mi lado Durante estos antildeos no habeis dejado de preocuparos por mi y de
apoyarme ni un solo instante maacutes auacuten cuando las cosas han sido tan complicadas
199
para miacute Nada hubiera salido bien sin vosotros una vez maacutes os doy las gracias por
ser tan maravillosos y por teneros Por otro lado mis amigos ellos si que andan
agenos al tema y sin embargo siempre han sabido cuando preguntar y que palabras
usar cuando mas lo he necesitado Tengo que hacer una mencioacuten especial al sentildeor
Jimmy (responsable graacutefico y de disentildeo de la tesis) a ti si que te ha caiacutedo una
buena desde aquella llamada en la que te dije ldquoha llegado el momentordquo A
parte del gran trabajo que has hecho vistiendo la tesis tuacute una de las personas maacutes
sosegadas que conozco has podido aguantar el histerismo de los diacuteas previos a
depositar la tesis Gracias Jimmy eres un sol pero que sepas que auacuten me queda la
defensa oacutesea presentacioacuten en power pointhellipyo no digo nada Tambieacuten
agaradezco al ldquogrupo parkeeerdquo las horas que pasamos en las cuales a parte de
mucho friacuteo tambieacuten pasamos muy buenos ratos Especialmente a Lauri gracias por
acercarte un buen diacutea y preguntarme iquesttodo bien Desde entonces tus achuchones
tus canciones y tu ldquoflower powerrdquo han hecho que me despeje cada tarde Gracias
tambieacuten por interesarte tanto por mi trabajo dentro de poco te lo podreacute presentar
Las uacuteltimas palabras van dirigidas a Javi A ti que has estado conmigo desde el
principio gracias por no dejar que me desquicie y darme siempre tranquilidad Son
muchas las horas que he dedicado a esto y siempre has estado recordaacutendome
cuando era el momeno de parar Gracias por saber comprender lo que hago aunque
a veces me queje tanto y por ayudarme a echarle un par de narices cuando maacutes
desanimada estaba Gracias por hacer que este mundo roto no estropee mi sonrisa
Todo el tiempo que no te he dedicado lo recuperaremos juntos en nuestra casa
A todos y cada uno de vosotros gracias
Raquel
A mi familia a Javi y amigos todos ellos forman parte de esta tesis como si de un capiacutetulo se tratase
A todos gracias por formar parte de los capiacutetulos de mi vida
Iacutendice
I Resumen Antecedentes 13 Objetivos 25 Listado de manuscritos 27 Siacutentesis de capiacutetulos 29 Metodologiacutea general 33
Capiacutetulo 1a Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium 47
b Evaluation of the influence of multiple environmental factors on the biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal experimental design 67
Capiacutetulo 2 Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process 85
Capiacutetulo 3 High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures 113
Capiacutetulo 4 Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil change in bacterial community 143
II Discusioacuten general 171
III Conclusiones generales 181
IV Referencias bibliograacuteficas 185
V Agradecimientos 195
Resumen
AntecedentesObjetivos
Listado de manuscritosSiacutentesis de capiacutetulosMetodologiacutea general
I
Resumen Antecedentes
13
Antecedentes
Tal y como su propio nombre indica biorremediacioacuten significa ldquodar remediordquo mediante
teacutecnicas bioloacutegicas por lo que una definicioacuten acertada de biorremediacioacuten seriacutea el conjunto
de teacutecnicas que permiten resolver problemas de contaminacioacuten mediante el uso de
microorganismos (bacterias algas unicelulares etc) hongos plantas o enzimas derivadas
de ellos En el contexto de esta tesis la biorremediacioacuten se aplica a suelos u otros sistemas
contaminados con hidrocarburos aromaacuteticos policiacuteclicos (HAP o PAH siglas en ingleacutes
polyciclic aromatic hydrocarbons) Los HAP son compuestos que se generan por la
combustioacuten incompleta de combustibles foacutesiles por causas naturales y en mayor medida
antroacutepicas Si tenemos en cuenta que el sustento del sistema energeacutetico mundial son los
combustibles foacutesiles podemos hacernos una idea de la relevancia y elevada presencia de
estos compuestos en la vida cotidiana Considerando sus complejas propiedades y su
caraacutecter perjudicial para el ser humano y los ecosistemas (Internacional Agency for
Research on Cancer 1972-1990) los HAP suscitaron una creciente preocupacioacuten a partir
del pasado siglo siendo los primeros carcinoacutegenos ambientales reconocidos (Haritash amp
Kaushik 2009) Eacutesto dio lugar a numerosos estudios cientiacuteficos con el objetivo de
determinar sus efectos en el medio y el ser humano asiacute como a la buacutesqueda de soluciones
para su eliminacioacuten Frente a muchas otras teacutecnicas de eliminacioacuten de contaminantes
(teacutecnicas fiacutesicas yo quiacutemicas) la biorremediacioacuten presenta una caracteriacutestica clave que la
hace destacar sobre las otras teacutecnicas y es que se basa en procesos que respetan el medio
perturbado y permiten en la medida de lo posible su recuperacioacuten
Los hidrocarburos aromaacuteticos policiacuteclicos (HAP) Legislacioacuten espantildeola sobre medios
contaminados
La presente tesis se centra en el estudio de la biodegradacioacuten de los hidrocarburos
aromaacuteticos policiacuteclicos y por ello es esencial conocer a fondo queacute son cuaacuteles son sus
caracteriacutesticas y porqueacute suscitan este intereacutes Los HAP son compuestos quiacutemicos formados
por la fusioacuten de un determinado nuacutemero de anillos de su principal componente aromaacutetico el
benceno La estructura quiacutemica de alguno de los compuestos que han sido utilizados
durante el desarrollo de esta tesis aparecen en la Figura 1
Resumen Antecedentes
14
Figura 1 Hidrocarburos aromaacuteticos poliacuteciacuteclicos de bajo (naftaleno fenantreno y antraceno) y alto peso
molecular (pireno y perileno)
Los HAP se pueden clasificar en funcioacuten del nuacutemero de anillos benceacutenicos en HAP de
bajo (menos de tres anillos) y de alto peso molecular Tan soacutelo el naftaleno fenantreno y
antraceno (dos y tres anillos respectivamente) seriacutean considerados HAP de bajo peso
molecular (Cerniglia 1984 1992) La propiedades quiacutemicas de los HAP y por tanto su
destino en el medioambiente depende del nuacutemero de anillos aromaacuteticos que lo componen y
de su tipologiacutea molecular (Kanaly amp Harayama 2000) Por ejemplo el fenantreno y
antraceno son compuestos isoacutemeros (Figura 1) con el mismo peso molecular porque tienen
el mismo nuacutemero de anillos benceacutenicos pero en distinta disposicioacuten lo que les confiere
distintas caracteriacutesticas quiacutemicas En general a medida que aumenta su tamantildeo peso
molecular y angularidad aumenta su hidrofobicidad y estabilidad electroquiacutemica (Zander
1983) Tal y como algunos trabajos han demostrado eacutestos son dos factores primarios que
contribuyen a la persistencia de los HAP en el medio Por ejemplo de acuerdo con
Shuttleworth amp Cerniglia (1995) la vida media en suelos y sedimentos de un HAP de tres
anillos como el fenantreno podriacutea oscilar en un rango de entre 6 a 126 diacuteas mientras que
para moleacuteculas de cuatro a cinco anillos el tiempo aumentariacutea de 229 a maacutes de 1400 diacuteas
Ademaacutes debido a su naturaleza lipofiacutelica tiene un elevado potencial de bioacumulacioacuten en la
cadena troacutefica fenoacutemeno conocido como biomagnificacioacuten (Clements et al 1994) Se sabe
que los HAP ejercen un acusado efecto toacutexico y poseen propiedades mutageacutenicas
teratogeacutenicas y en algunos casos carcinogeacutenicas (Internacional Agency for Research on
Cancer 1972-1990) De hecho dieciseacuteis HAP han sido clasificados como contaminantes
prioritarios por la US Environmental Protection Agency (Agencia de proteccioacuten ambiental
Resumen Antecedentes
15
de Estados Unidos) y por la Comisioacuten Europea de Medio Ambiente (Maliszewska-Kordybach
1996)
Los HAP estaacuten presentes como constituyentes naturales de los combustibles foacutesiles y
se forman durante la combustioacuten incompleta de la materia orgaacutenica Las fuentes naturales
de produccioacuten de HAP son los incendios forestales y de pastizales yacimientos de petroacuteleo
o erupciones volcaacutenicas (Haritash amp Kaushik 2009) Sin embargo las fuentes antroacutepicas
son las que maacutes contribuyen a su formacioacuten mediante la quema de combustibles foacutesiles con
fines energeacuteticos en el tratamiento de la madera con creosota mediante el uso de
lubricantes y en el refino del petroacuteleo y actividades de transporte (Lee et al 1981) Aunque
los vertidos se produzcan en una zona determinada es posible que la carga contaminante
se extienda si alcanza un efluente o mediante su filtracioacuten a traveacutes del suelo pudiendo
alcanzar acuiacuteferos Otras cargas contaminantes se generan por descarga directa
procedentes de efluentes industriales en grandes superficies de suelos o mares o por la
liberacioacuten accidental de materia prima (Kanaly amp Harayama 2000) Se han detectado HAP
en el aire procedente fundamentalmente de la quema industrial de combustibles foacutesiles y el
traacutefico (Koeber et al 1999 Lim et al 1999) en suelos y en la parte superficial y profunda
de la columna de agua y sedimentos (Readman et al 2002 Johnsen et al 2005 2006) En
alimentos vegetales y plantas aparecen como consecuencia de la difusioacuten y posterior
sedimentacioacuten de los HAP atmosfeacutericos sobre la vegetacioacuten (Wagrowski amp Hites 1997) y
por la adsorcioacuten de HAP acumulados en el agua del suelo
El suelo constituye uno de los medios receptores de la contaminacioacuten maacutes sensibles y
vulnerables Sin embargo y auacuten dada la gravedad y extensioacuten creciente de la contaminacioacuten
con HAP no fue hasta la Conferencia de Naciones Unidas sobre el Medio Ambiente y el
Desarrollo celebrada en Riacuteo de Janeiro en 1992 cuando se reconocioacute y planteoacute de forma
trascendente la importancia de la proteccioacuten de los suelos y la definicioacuten de sus usos
potenciales La Agencia Europea de Medio Ambiente (AEMA) estimoacute en 1999 que el
nuacutemero de zonas o aacutereas contaminadas en Europa Occidental estaba entre 300000 y
1500000
Hasta la promulgacioacuten de la Ley 101998 de 21 Abril de Residuos Espantildea careciacutea de
cualquier instrumento normativo para legislar controlar y proteger lo referente a suelos
contaminados Con esta Ley las Comunidades Autoacutenomas son las encargadas de declarar
delimitar e inventariar los suelos contaminados de sus territorios ademaacutes de establecer las
bases para una determinada actuacioacuten Con el Real decreto 92005 del 14 de Enero se da
cumplimiento a lo dispuesto en la 101998 de Residuos y en eacutel se establece la relacioacuten de
actividades potencialmente contaminantes del suelo y los criterios y estaacutendares para la
Resumen Antecedentes
16
declaracioacuten de un suelo bajo la categoriacutea de ldquocontaminadordquo Uno de los aspectos maacutes
importantes desde el punto de vista de la biorremediacioacuten se recoge en el Artiacuteculo 7 del
Real Decreto 92005 por el cual ldquola declaracioacuten de un suelo como contaminado obligaraacute a la
realizacioacuten de las actuaciones necesarias para proceder a su recuperacioacuten ambientalrdquo
Ademaacutes antildeade que las teacutecnicas deben ser las maacutes apropiadas en cada caso garantizando
soluciones de caraacutecter permanente y prioriza las teacutecnicas de tratamiento in situ que eviten la
generacioacuten traslado y eliminacioacuten de residuos
Lo dispuesto en esta ley sin duda supone un enorme impulso a las teacutecnicas de
biorremediacioacuten ya que a traveacutes de ellas se favorece el tratamiento in situ y la recuperacioacuten
del ecosistema a su estadio original sin generacioacuten de residuos y con el menor impacto
ambiental posible
Factores que condicionan la biodegradacioacuten
Aunque la biodegradacioacuten bacteriana es una de las teacutecnicas maacutes eficaces en la
descontaminacioacuten in situ de medios contaminados con HAP la eficacia y tasas de
biodegradacioacuten dependen en gran medida del nuacutemero y tipo de microorganismo
degradador presente en el medio y de la naturaleza y estructura quiacutemica del contaminante a
degradar (Haritash amp Kaushik 2009) Ademaacutes a la hora de disentildear un sistema de
biorremediacioacuten debemos tener en cuenta que existen muacuteltiples factores ambientales que
van a condicionar la eficacia y la rapidez del proceso con el agravante de que durante la
aplicacioacuten in situ es difiacutecil y en algunos casos imposible poder controlar o modificar alguno
de estos factores La biorremediacioacuten es una teacutecnica eficaz y econoacutemica pero cuenta con la
desventaja del tiempo ya que en algunos casos la descontaminacioacuten del medio y su
recuperacioacuten pueden durar antildeos
Por tanto los estudios de optimizacioacuten en los que se combinen todos los factores
posibles considerando los efectos sineacutergicos y antagoacutenicos son esenciales en
biorremediacioacuten Entre los factores ambientales maacutes estudiados en la literatura destacamos
temperatura pH tipo y concentracioacuten de nutrientes inorgaacutenicos y fuentes de carbono
Temperatura y pH
La temperatura es una de las variables maacutes influyentes en el proceso de biodegradacioacuten
bacteriana ya que afecta tanto a las propiedades fisicoquiacutemicas de los HAP como al
Resumen Antecedentes
17
metabolismo microbiano La temperatura guarda una relacioacuten proporcional con los rangos
de difusioacuten y solubilidad de los HAP e inversamente proporcional con el coeficiente de
particioacuten suelo-agua (Wu amp Gschwend 1986) Mientras que el coeficiente de particioacuten de los
HAP decrece entre un 20-30 por cada incremento de 10ordmC en temperaturas comprendidas
entre los 5 ordmC - 45 ordmC el coeficiente de difusioacuten en agua aumenta entre 4-5 veces con un
incremento de la temperatura de 20 a 120 ordmC Esto se traduce en que cuanto menor es la
temperatura menor es la solubilidad de los HAP en la fase acuosa y consecuentemente
menor es su biodisponibilidad para ser mineralizados por los microorganismos (Haritash amp
Kaushik 2009)
Por otro lado las bajas temperaturas afectan negativamente al metabolismo
microbiano ralentizaacutendolo y aumentando la duracioacuten de la fase de latencia en la que hay
inactividad (Atlas amp Bartha 1972 Eriksson et al 2001) Tal y como se ha demostrado en
estudios previos (Leahy amp Colwell 1990) la velocidad de metabolizacioacuten normalmente se
duplica por cada aumento de 10 ordmC en temperaturas comprendidas entre los 10 y 40 ordmC Sin
embargo y a pesar de las desventajas que las bajas temperaturas presentan para la
biodegradacioacuten existe degradacioacuten de hidrocarburos en ambientes friacuteos cuyas temperaturas
oscilan entre los 0 ordmC ndash 10 ordmC (Margesin et al 2002) Algunos trabajos se han centrado en el
estudio de la biodegradacioacuten en zonas de agua marina y suelos bajo temperaturas
extremadamente bajas (Colwell et al 1978 Mohn amp Stewart 2000 Ericksson et al 2001
Delille amp Pelletiere 2002) obteniendo resultados positivos Sin embargo la mayoriacutea de los
estudios de biodegradacioacuten se han llevado a cabo en condiciones de laboratorio en un rango
de temperaturas comprendido entre los 20 ndash 35 ordmC sin observar a penas diferencias en las
tasas de biodegradacioacuten (Chen et al 2008) Por debajo de estas temperaturas la
degradacioacuten es maacutes complicada porque el metabolismo de los microorganismos se ralentiza
y la solubilizacioacuten de los HAP disminuye Aun asiacute hay bacterias adaptadas a estas
condiciones que hacen posible la degradacioacuten en ambientes con temperaturas extremas
Varias especies de Pseudomonas y Sphingomonas se han identificado como bacterias
degradadoras de HAP en la Antaacutertida (Aislabie et al 2000) Eacutestas y otras especies estaacuten
adaptadas a las temperaturas locales y a otras condiciones de estreacutes ya que durante el
deshielo sobreviven en suelos friacuteos y secos pobres en nutrientes y a menudo alcalinos Sin
embargo la capacidad de estas bacterias para crecer en suelos con condiciones climaacuteticas
suaves y la utilizacioacuten de HAP para su crecimiento implica que estas bacterias son
psicrotolerantes (Aislabie et al 2000) cuya temperatura oacuteptima es superior a los 20 ordmC pero
son capaces de sobrevivir cerca o por debajo de los 0 ordmC Ademaacutes existen algunas especies
cuyo crecimiento se desarrolla en ambientes que permanentemente esteacuten por debajo de los
5 ordmC este grupo de bacterias son psicroacutefilas La temperatura es un factor que difiacutecilmente se
puede controlar o manipular en proyectos de aplicacioacuten in situ por lo que es importante
Resumen Antecedentes
18
elaborar un estudio previo bajo las condiciones del ecosistema afectado Esto es
fundamental sobre todo en ambientes con temperaturas bajas en los que se puede estudiar
queacute otros factores modificar para suplir las desventajas de la temperatura como puede ser
inocular cepas bacterianas adaptadas a las bajas temperaturas aumentar el oxiacutegeno o
adicionar nutrientes En estas condiciones no toda la comunidad tiene por queacute ser eficaz en
la degradacioacuten de un contaminante aunque se ha propuesto que las bacterias y no los
hongos son las mayores colonizadoras y degradadoras (Kerry 1990) La identificacioacuten de
las especies de la poblacioacuten autoacutectona asiacute como la refrenciacioacuten de sus capacidades
metaboacutelicas son muy importantes en la biorremediacioacuten de suelos de ambientes friacuteos Esta
cuestioacuten es especialmente importante en la Antaacutertida ya que el Sistema del Tratado
Antaacutertico prohiacutebe la introduccioacuten de organismos aloacutectonos
Por otro lado el pH es un factor abioacutetico que de forma similar a la temperatura puede
afectar significativamente tanto a la actividad y diversidad microbiana como a la
mineralizacioacuten de los HAP Los rangos de pH oacuteptimos para el proceso de metabolizacioacuten
pueden ser muy variables ya que depende de las caracteriacutesticas del medio contaminado y
de la poblacioacuten microbiana que alberga (Dibble amp Bartha 1979) Las micobacterias son
bacterias neutroacutefilas cuyo pH oacuteptimo es superior 6 (Portaels amp Pattyn 1982) Sin embargo
a paritr de este pH se ha observado que la degradacioacuten de HAP por Mycobacterium es maacutes
eficaz cuando el pH tiende ligeramente a aacutecido (65) porque la membrana de aacutecidos
micoacutelicos es maacutes permeable a compuestos hidrofoacutebicos (Kim et al 2005) Otros autores
han mostrado que para otro tipo de bacterias comuacutenmente descritas en procesos de
biodegradacioacuten como Pseudomonas sp el rango oacuteptimo de pH oscila entre 55 y 78
notablemente mejor cuanto maacutes neutro (Dibble amp Bartha 1979) El uso de ciertos
surfactantes puede causar la basificacioacuten del medio (Bautista et al 2009) por lo que este
aspecto debe ser considerado a la hora de disentildear un proceso de biorremediacioacuten Tambieacuten
se pueden generar variaciones de pH durante el proceso como consecuencia de los
metabolitos intermedios derivados de los HAP Por ejemplo al comienzo de la degradacioacuten
se generan metabolitos con grupos hydroxiacutelicos que producen un aumento del pH (Habe amp
Omori 2003 Puntus et al 2008)
Nutrientes inorgaacutenicos
Ante una perturbacioacuten por un contaminante el requerimiento de nutrientes de las bacterias
degradadoras del ecosistema aumenta para poder metabolizar el aporte extra de carbono
que supone el contaminante Por este motivo en biorremediacioacuten es importante encontrar
una relacioacuten oacuteptima de carbononitroacutegenofoacutesforo (CNP) que tradicionalmente se han fijado
Resumen Antecedentes
19
en 100101 (ej Bouchez et al 1995) Sin embargo este aspecto es objeto de controversia
ya que otros autores (Leys et al 2005) han demostrado que la relacioacuten anteriormente
propuesta como oacuteptima puede ser insuficiente limitando el crecimiento bacteriano y por
tanto ralentizando la biodegradacioacuten La bioestimulacioacuten es una teacutecnica de biorremediacioacuten
que consiste en la adicioacuten de nutrientes inorgaacutenicos a los substratos contaminados La
disponibilidad de nutrientes es un aspecto muy importante en la eficacia de la
biodegradacioacuten Nutrientes como el nitroacutegeno el foacutesforo o el hierro son esenciales para el
metabolismo bacteriano en general y mucho maacutes en el caso de biorremediacioacuten de medios
contaminados por HAP Aunque la mayoriacutea de los trabajos indican que la adicioacuten de
nutrientes mejora el proceso algunos autores (Yu et al 2005) obtuvieron resultados
opuestos La diferencia entre unos resultados y otros radican en que la necesidad de
nutrientes depende del tipo de bacteria tipo de hidrocarburo y de las condiciones del medio
(Leys et al 2005) El hierro es un nutriente esencial necesario en el proceso de
biodegradacioacuten ya que por un lado es cofactor de las enzimas que catalizan la oxidacioacuten de
los HAP y por otro se ha relacionado con la produccioacuten de biosurfactantes para potenciar la
solubilidad de los HAP (Wei et al 2003) Sin embargo determinar la proporcioacuten oacuteptima de
este nutriente es fundamental pues altas concentraciones pueden ser toacutexicas (Santos et al
2008) Es tambieacuten una cuestioacuten a considerar la forma en la que se adicionan o se
encuentran los nutrientes en el medio ya que condiciona su biodisponibilidad Asiacute algunos
autores (Schlessinger 1991) proponen que las formas oxidadas como nitratos son maacutes
solubles que las formas reducidas como amonio que ademaacutes tiene propiedades
adsorbentes Establecer si un determinado problema medioambiental requiere un aporte
exoacutegeno de nutrientes es por tanto una cuestioacuten a discutir que probablemente dependa de
otras variables bioacuteticas y abioacuteticas
Fuentes de carbono laacutebiles
La adicioacuten a un medio contaminado de otras fuentes de carbono faacutecilmente biodegradables
se considera una alternativa que puede favorecer la biodegradacioacuten porque aumenta la
biomasa de la poblacioacuten microbiana y por tanto de la poblacioacuten degradadora Realmente se
puede entender como una forma de bioestimulacioacuten enfocada a aumentar y estimular el
crecimiento bacteriano o su actividad y por consiguiente la degradacioacuten Algunas de las
sustancias tratadas con este fin son el piruvato que estimula el crecimiento de ciertas cepas
bacterianas o el salicilato que induce la activacioacuten de enzimas degradadoras En el caso de
la glucosa su raacutepida asimilacioacuten y aumento de biomasa asociado se podriacutea traducir en un
aumento de la biodegradacioacuten (Ye et al 1996) Lee et al (2003) propusieron y
comprobaron que el piruvato potenciaba el crecimiento de la cepa degradadora
Resumen Antecedentes
20
Pseudomonas putida lo que se tradujo en un aumento de la tasa de biodegradacioacuten de
naftaleno Chen amp Aitken (1999) han comprobado que el salicilato induce la siacutentesis de
enzimas cataboacutelicas y por tanto su adicioacuten favorece la metabolizacioacuten de HAP siempre
que su concentracioacuten en el medio no supere una concentracioacuten liacutemite inhibitoria Wong et al
(2000) observoacute que la adicioacuten de glucosa favoreciacutea el crecimiento total de la poblacioacuten pero
las tasas de biodegradacioacuten fueron significativamente menores Estos resultados se deben
a que la cepa o consorcio degradador es capaz de mineralizar un HAP como uacutenica fuente de
carbono y la asimilacioacuten de glucosa inhibe la siacutentesis de enzimas implicadas en la
degradacioacuten del contaminante Es necesario valorar en cada caso de estudio coacutemo afecta la
adicioacuten de una nueva fuente de carbono ya que en el caso de bacterias no pre-adaptadas a
degradar HAP es posible que sus efectos sean positivos (Wong et al 2000) pero en
poblaciones microbianas histoacutericamente adaptadas a substratos contaminados la adicioacuten de
glucosa puede favorecer el crecimiento de microorganismos heteroacutetrofos no degradadores
Importancia y efecto de los surfactantes en la biodegradacioacuten de HAP
La baja solubilidad de los HAP y de la mayoriacutea de los compuestos del petroacuteleo limita la
capacidad de los microorganismos para acceder y degradar los compuestos contaminantes
Los surfactantes son tensioactivos que actuacutean disminuyendo la tensioacuten superficial del agua
para facilitar la disolucioacuten de los HAP en la fase acuosa En algunos estudios (Bautista et al
2009) se ha demostrado que el uso de surfactantes en procesos de biodegradacioacuten es
necesario para solubilizar los HAP Muchas bacterias degradadoras de HAP han
desarrollado la capacidad de generar biosurfactantes (surfactantes de origen microbiano)
como parte de su superficie celular o como moleacuteculas liberadas extracelularmente (Fiechter
1992) Algunas de estas especies pertenecen a los geacuteneros Pseudomonas (P aeruginosa
P fluorescens) Rhodococcus Mycobacterium Lactobacillus Acinetobacter o
Sphingomonas Los biosurfactantes se clasifican en funcioacuten de su masa molecular en
biosurfactantes de bajo peso molecular como glicoliacutepidos o lipopeacuteptidos y de alto peso
molecular que incluyen moleacuteculas maacutes complejas como polisacaacuteridos anfipaacuteticos proteiacutenas
lipopolisacaacuteridos y lipoproteiacutenas Se han observado resultados muy contradictorios en
cuanto a sus efectos sobre las tasas de biodegradacioacuten por un lado positivos (Jing et al
2007) pero tambieacuten inhibitorios (Laha amp Luthy 1991) Los biosurfactantes de alto peso
molecular son eficaces en la estabilizacioacuten de emulsiones de aceite en agua mientras que
los de bajo peso molecular son maacutes eficaces en la disminucioacuten de la tensioacuten interficial y
superficial (Rosenberg amp Ron 1999) En el caso de los surfactantes sinteacuteticos su eficacia
estaacute determinada por sus propiedades de carga (no ioacutenicos anioacutenicos o catioacutenicos) su
balance hidrofiacutelico-lipofiacutelico y su concentracioacuten micelar criacutetica (CMC) concentracioacuten a la cual
Resumen Antecedentes
21
la tensioacuten superficial es miacutenima y los monoacutemeros de surfactante se agregan formando
micelas Sin embargo algunos surfactantes pueden inhibir la mineralizacioacuten de los HAP por
cuestiones como la toxicidad del medio derivada de una elevada concentracioacuten de
surfactantes la cual resulta toacutexica para los microorganismos (ej Tergitol NP-10) o porque
al solubilizarse los HAP por accioacuten del surfactante aumenta toxicidad del medio (Liu et al
2001) En algunos casos ademaacutes los surfactantes no son biodegradables (Bautista et al
2009) De hecho Bautista et al (2009) comprobaron que el surfactante no ioacutenico Tergitol
NP-10 es un surfactante no biodegradable y toacutexico para los microorganismos en
comparacioacuten con el Tween-80 Dada la amplia variabilidad de resultados referentes a los
surfactantes es importante la eleccioacuten correcta en cada proceso considerando el tipo de
contaminante a eliminar y los microorganismos presentes en el medio
Biodegradacioacuten bacteriana cepas y consorcios microbianos degradadores de HAP
Son muchas las especies bacterianas descritas con capacidad degradadora de HAP la
mayoriacutea de ellas aisladas de aguas sedimentos y suelos previamente contaminados con
hidrocarburos La biodegradacioacuten de HAP de bajo peso molecular como el naftaleno
fenantreno y antraceno ha sido ampliamente estudiada Sin embargo son escasos los
estudios realizados sobre la biodegradacioacuten de HAP de alto peso molecular como el pireno
perileno acenafteno o fluoreno (Kanaly amp Harayama 2000) De acuerdo con Chauhan et al
(2008) especies de Pseudomonas y Ralstonia se relacionan en mayor medida con la
degradacioacuten de naftaleno y fenantreno Burkolderia y Stenotrophomonas con naftaleno
fenantreno y antraceno y otras especies pertenecientes a los geacuteneros Rhodococcus
Sphingomonas y Mycobacterium con HAP de mayor peso molecular como fluoranteno
benzo[a]pireno pireno benzo[b]fluoranteno Las especies bacterianas degradadoras
pertenecen a grupos filogeneacuteticos muy diversos y en muchos casos taxonoacutemicamente
alejados Trabajos previos (Vintildeas et al 2005 Molina et al 2009 Gonzaacutelez et al 2011)
muestran una gran parte de las bacterias degradadoras pertenecen al phylum
Proteobacteria en mayor proporcioacuten a las clases α- Proteobacteria (Sphingomonas
Bradyrizobium Nitrobacteria Balneimonas) y γ- (Pseudomonas Stenotrhophomonas
Enterobacter Pantoea Acinetobacter o Psychrobacter) Tambieacuten se han aislado especies
pertenecientes a la clase β- Proteobacterias (Ralstonia) y a los phylum Actinobacteria
(Microbacterium sp Rhodococcus sp) Firmicutes (Bacillus subtillis) y Bacteroidetes
(Flexibacter) aunque eacutestas en menor frecuencia Muchos de los trabajos de degradacioacuten
bacteriana se han realizado con cepas individuales (Grimberg et al 1996 Das amp Mukherjee
2006) extraiacutedas de suelos contaminados o bien con consorcios artificiales formados por
varias cepas degradadoras (Ghazali et al 2004) siendo muy pocos aquellos en los que se
Resumen Antecedentes
22
ha utilizado un consorcio bacteriano natural extraiacutedo directamente de un suelo Bautista et al
(2009) sentildeala que la capacidad de degradacioacuten de un consorcio artificial es mayor que la de
las cepas individuales Seguacuten algunos autores (Fritsche 1985 Mueller et al 1997) la mejor
eficiencia de degradacioacuten de un consorcio es debido a que la diversidad de especies permite
que cada una tenga un papel en el proceso de biodegradacioacuten facilitando la degradacioacuten de
HAP gracias al cometabolismo establecido entre las especies implicadas
Existe una importante controversia referente a la capacidad degradadora que
presentan los consorcios naturales ya que se ha observado que ciertos consorcios
extraiacutedos de zonas no contaminadas con HAP son capaces de metabolizar dichos
compuestos (Tian et al 2008 Couling et al 2010) Seguacuten estos autores es una
caracteriacutestica general presente en algunas comunidades microbianas que se expresa ante
una determinada perturbacioacuten Sin embargo Barkay amp Pritchart (1988) exponen que es una
caracteriacutestica que soacutelo estaacute presente en comunidades previamente expuestas y por lo tanto
preadaptadas como consecuencia de presiones selectivas Algunos autores (Jhonsen et al
2005) subrayan que la capacidad cataboacutelica se propaga faacutecilmente entre bacterias de un
mismo suelo contaminado como resultado de la transferencia horizontal de genes (ej
conjugacioacuten y transformacioacuten) Esto facilitariacutea auacuten maacutes que una comunidad no preadaptada
pueda hacer frente a una perturbacioacuten
Teacutecnicas de biorremediacioacuten
El objetivo uacuteltimo de la biorremediacioacuten es que el proceso de biodegradacioacuten se desarrolle
de la forma maacutes eficaz posible y por eso muchos trabajos se centran en la optimizacioacuten del
proceso mediante el desarrollo de teacutecnicas que aumenten la eficacia del mismo Teacutecnicas
como la bioestimulacioacuten anteriormente mencionada se centran en aumentar la capacidad
degradadora de la comunidad autoacutectona bacteriana mediante la adicioacuten de nutrientes
(nitroacutegeno foacutesforo potasio) de forma que la falta de nutrientes no suponga una limitacioacuten
para el metabolismo microbiano y por consiguiente para la biorecuperacioacuten de la zona
perturbada Otras teacutecnicas se basan en el aumento de la poblacioacuten degradadora mediante la
adicioacuten de cepas o consorcios con capacidad reconocida para metabolizar un determinado
compuesto es lo que se conoce como bioaumento En algunos trabajos los resultados
derivados de la bioestimulacioacuten y el bioaumento han sido positivos (Mills et al 2004
Atagana 2006) pero en trabajos como Chen et al (2008) o Yu et al (2005) los efectos de
ambas teacutecnicas en el proceso fueron negativos o simplemente no tuvieron efecto Se tiene
que tener en cuenta que ambas teacutecnicas generan cambios en las comunidades autoacutectonas
que afectan y modifican las relaciones de competencia Estos cambios pueden ser auacuten maacutes
Resumen Antecedentes
23
acusados en el caso del bioaumento pues la introduccioacuten de una comunidad foraacutenea puede
tener resultados difiacuteciles de predecir La atenuacioacuten natural es otra teacutecnica basada en la
mera actuacioacuten de la comunidad autoacutectona sin ninguacuten tipo de modificacioacuten de la comunidad
yo adicioacuten de sustancias Dowty et al (2001) entre otros defiende que cuando se trata de
restablecer el medio a las condiciones originales preservando la biodiversidad la
atenuacioacuten microbiana puede ser la mejor opcioacuten siempre que las poblaciones autoacutectonas
presenten capacidad degradadora
Resumen Objetivos
25
Objetivos
El objetivo general de la tesis es el conocimiento profundo de la biodegradacioacuten bacteriana
de hidrocarburos aromaacuteticos policiacuteclicos para la biorremediacioacuten y recuperacioacuten de medios
contaminados con estos compuestos toacutexicos El proyecto se ha centrado en la identificacioacuten
y conocimiento de la poblacioacuten bacteriana de consorcios procedentes de ambientes
(contaminados o no) y de su dinaacutemica ante determinadas condiciones durante el proceso de
biodegradacioacuten Para alcanzar este objetivo principal se fijaron objetivos especiacuteficos
desarrollados en cuatro capiacutetulos
1 Estudiar los factores abioacuteticos a fin de optimizar las condiciones de desarrollo en el
proceso de biodegradacioacuten de HAP en cultivos liacutequidos (capiacutetulo 1a) En un segundo
proyecto de optimizacioacuten el objetivo fue asemejar el proceso en laboratorio lo maacutes
posible a las condiciones naturales considerando los efectos derivados de la
interaccioacuten muacuteltiple de factores ambientales y bioloacutegicos (capiacutetulo 1b)
2 Analizar el efecto de la aplicacioacuten de distintos tipos de surfactantes (no ioacutenicos
biodegradables y no biodegradables) en la eficacia de degradacioacuten de HAP de un
consorcio bacteriano previamente adaptado (C2PL05) Asiacute mismo se quiso estudiar el
efecto del tipo de surfactante en la sucesioacuten y dinaacutemica del consorcio identificando los
microorganismos implicados a lo largo del proceso (capiacutetulo 2)
3 Estimar la capacidad degradadora de microcosmos inoculados con consorcios
procedentes de suelos con distinta historia de contaminacioacuten suelo croacutenicamente
contaminado (C2PL05) frente a un suelo procedente de un ambiente libre de
contaminacioacuten (BOS08) bajo condiciones climaacuteticas suaves y extremas Describir y
comparar las comunidades bacterianas que componen ambos consorcios (capiacutetulo 3)
4 Evaluar la eficacia de diversas teacutecnicas de biorremediacioacuten (atenuacioacuten natural
bioestimulacioacuten yo bioaumento) tanto en la eliminacioacuten del contaminante y la
toxicidad como en la capacidad de recuperacioacuten del ecosistema (capiacutetulo 4) Para el
desarrollo de este objetivo se llevoacute a cabo una simulacioacuten a pequentildea escala
(microcosmos) de un proceso de biorremediacioacuten in situ de suelos naturales
contaminados con creosota
Resumen Listado de manuscritos
27
Listado de manuscritos
Los capiacutetulos que integran este proyecto doctoral han sido redactados en ingleacutes para su
publicacioacuten en revistas cientiacuteficas de aacutembito internacional Por ello se presentan los
manuscritos originales de dichos artiacuteculos A continuacioacuten se detalla la traduccioacuten del tiacutetulo
los nombres de los coautores y el estado de publicacioacuten de los manuscritos
Capiacutetulo 1a Simarro R Gonzaacutelez N Bautista LF Sanz R y Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium
Water Air and Soil Pollution (2011) 217 365-374
Capiacutetulo 1b Simarro R Gonzaacutelez N Bautista LF y Molina MC
Evaluation of the influence of multiple environmental factors on the
biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial
consortium using an orthogonal experimental design
Water Air and Soil Pollution (Aceptado febrero 2012)
Capiacutetulo 2 Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L y Villa
JA
Effect of surfactants on PAH biodegradation by a bacterial consortium and
on the dynamics of the bacterial community during the process
Bioresource Technology (2011) 102 9438-9446
Capiacutetulo 3 - Simarro R Gonzaacutelez N Bautista LF y Molina MC
High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures
FEMS Microbiology Ecology (Subscrito Diciembre 2011 En revisioacuten)
Resumen Listado de manuscritos
28
Capiacutetulo 4 - Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez L y Peacuterez
M
Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil
change in bacterial community
Manuscrito ineacutedito
Resumen Siacutentesis de capiacutetulos
29
Siacutentesis de capiacutetulos
La presente tesis doctoral se desarrolla dentro de un proyecto de investigacioacuten basado en la
biorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicos y
sustancias contaminantes que los contengan Este proyecto se esta llevando a cabo desde
hace seis antildeos por el grupo de Biorremediacioacuten del Departamento de Biologiacutea y Geologiacutea de
la Universidad Rey Juan Carlos Los artiacuteculos citados anteriormente componen los cuatro
capiacutetulos que se desarrollan en el cuerpo de la tesis
Anteriormente al desarrollo de los experimentos que componen los capiacutetuos de la
presente tesis se realizoacute un trabajo (Molina et al 2009) en el que se estudioacute la capacidad
de degradacioacuten de un consorcio bacteriano extraiacutedo de un suelo croacutenicamente contaminado
y se describioacute su poblacioacuten bacteriana mediante teacutecnicas dependientes e independientes de
cultivo El consorcio fue capaz de degradar los HAP (naftaleno fenantreno y antraceno) en
maacutes de un 98 en un periodo de 18 diacuteas y ademaacutes eliminoacute completamente la toxicidad del
medio en 41 diacuteas La identificacioacuten molecular permitioacute aislar e identificar 5 cepas bacteriana
(DIC-1 a DIC-6 DIC Degrading isolated Culture) todas γ-Proteobacterias pertenecientes a
los geacuteneros Enterobacter Pseudomonas y Stenotrophomonas (maacutes detalles en Molina et al
2009) Ademaacutes el anaacutelisis de la poblacioacuten mediante electroforesis en un gel con gradiente
desnaturalizante (DGGE Denaturing Gradient Gel Electrophoresis) confirmoacute que estos tres
geacuteneros eran dominantes La alta eficacia en la degradacioacuten de los HAP y la escasa
biodiversidad tiacutepica de suelos sometidos a elevadas concentraciones de contaminantes
durante largos peridos de tiempo indican que el consorcio C2PL05 estaacute totalmente
adaptado a la degradacioacuten de HAP
En el capiacutetulo 1 se optimizoacute el proceso de biodegradacioacuten a traveacutes de dos disentildeos
experimentales diferentes que se recogen en los subcapiacutetulos 1a y 1b En el capiacutetulo 1a
se evaluacutea y mejora la influencia de varios factores ambientales como la relacioacuten molar de
CNP la fuente de nitroacutegeno fuente y concentracioacuten de hierro pH y fuente de carbono El
anaacutelisis estadiacutestico de las tasas de degradacioacuten (Kb) y los incrementos de la densidad celular
indicoacute que todos los factores fueron significativamente influyentes en la Kb Esto permitioacute
establecer un valor oacuteptimo de estos factores y descartar en los siguientes ensayos aquellos
paraacutemetros como el pH cuyo valor oacuteptimo (pH 7) seguacuten nuestros resultados coincidiacutea con
otros estudios y estaba claramente definido en la bibliografiacutea A partir de los resultados de
esta primera parte se realizoacute un segundo ensayo de optimizacioacuten ortogonal multifactorial
(capiacutetulo 1b) que permitioacute la optimizacioacuten de 8 factores de forma conjunta La concentracioacuten
de surfactante y de inoacuteculo bacteriano son dos factores que no fueron incluiacutedos en el
anterior anaacutelisis pero a traveacutes de la bibliografiacutea se consideraron factores importantes en la
Resumen Siacutentesis de capiacutetulos
30
biodegradacioacuten de HAP Los resultados confirmaron que la temperatura la fuente de
carbono y la concentracioacuten de inoacuteculo fueron factores significativos en el incremento de la
densidad celular pero soacutelo la fuente de carbono influyoacute significativamente el porcentaje total
de degrad acioacuten Estos resultados (capiacutetulo 1) permitieron conocer cuaacuteles son las
condiciones oacuteptimas del cultivo para una degradacioacuten maacutes eficaz de HAP con el consorcio
bacteriano C2PL05
El uso de surfactantes en la biodegradacioacuten de HAP puede optimizar la eficacia del
proceso y en algunos casos su uso es imprescindible Sin embargo su utilizacioacuten implica
un elevado coste y en ocasiones pueden tener efectos negativos dependiendo de la
concentracioacuten y tipo de surfactante En el capiacutetulo 2 se evaluacutea el efecto de dos
surfactantes no ioacutenicos Tergitol NP-10 (no biodegradable) y Tween-80 (biodegradable) en
la capacidad degradadora del consorcio microbiano C2PL05 teniendo en cuenta la
velocidad de degradacioacuten de los HAP y la dinaacutemica de la poblacioacuten microbiana durante el
proceso (teacutecnicas cultivo-dependientes e independientes) La degradacioacuten bacteriana de
los HAP y la reduccioacuten de la toxicidad del medio fue significativamente mejor con el
surfactante no ioacutenico y biodegradable Tween-80 Ademaacutes el tipo de surfactante utilizado
para optimizar la biodegradacioacuten de HAP afectoacute significativamente a la dinaacutemica de la
comunidad bacteriana del consorcio siendo especies pertenecientes a los geacuteneros
Pseudomonas Sphingomonas Sphingobium y Agromonas responsables de estas
diferencias Teoacutericamente la uacutenica funcioacuten del surfactante en el proceso de
biodegradacioacuten es aumentar la solubilidad de los HAP pero sin embargo en este capiacutetulo
se ha puesto de manifiesto que modifican notablemente las poblaciones bacterianas y la
sucesioacuten de especies pudiendo afectar a la eficacia del proceso Un estudio previo que
desemboque en la eleccioacuten del surfactante maacutes adecuado asiacute como su concentracioacuten
favorece la efiacacia de la biorremediacioacuten
El capiacutetulo 3 se centra en el estudio de la capacidad degradadora de los
microorganismos El principal objetivo es comprobar si la capacidad de degradacioacuten se
adquiere necesariamente tras un periodo de exposicioacuten a un contaminante o si bien es una
caracteriacutestica intriacutensecamente presente en algunas bacterias Se considera que la
temperatura es uno de los factores maacutes influyentes en el proceso de biodegradacioacuten de
manera que a temperaturas friacuteas (lt15 ordmC) o extremas (lt5 ordmC) se dificulta el proceso porque
afecta a la solubilidad de los HAP y al metabolismo microbiano Sin embargo existen
especies que toleran o estaacuten adaptadas a las bajas temperaturas y que ademaacutes pueden
degradar HAP En este capiacutetulo se avaluoacute la capacidad degradadora de un consorcio
preadaptado a HAP (C2PL05) frente a un consorcio extraiacutedo de una zona priacutestina rica en
madera en descomposicioacuten (BOS08) Al mismo tiempo se simularon dos ambientes de
Resumen Siacutentesis de capiacutetulos
31
biodegradacioacuten uno a temperaturas suaves comprendidas entre los 15 ordmC-25 ordmC y otro maacutes
extremo con temperaturas entre los 5 ordmC-15 ordmC todo ello en un sustrato soacutelido (suelo) con
objeto de ajustarnos a las condiciones naturales Sin duda el resultado maacutes significativo fue
que el consorcio BOS08 no adaptado a la degradacioacuten de HAP fue capaz de degradar
eficazmente e incluso mejor que el consorcio C2PL05 cuando las temperaturas fueron bajas
Ademaacutes se observoacute que aunque hubo geacuteneros exclusivos de cada consorcio (Ralstonia
Bacillus) otros fueron comunes en ambos (Microbacterium Acinetobacter Pseudomonas)
Los resultados obtenidos confirman la hipoacutetesis de que la capacidad de degradacioacuten estaacute
presente de forma intriacutenseca en algunas especies y no depende de una pre-exposicioacuten al
contaminante
En la biorremediacioacuten de un suelo contaminado con HAP es muy importante tener en
cuenta la respuesta de la poblacioacuten bacteriana autoacutectona del suelo frente a un episodio de
contaminacioacuten En el capiacutetulo 4 se estudioacute el comportamiento de la comunidad bacteriana
de un suelo previamente no contaminado cuando es perturbado con creosota La
biorremediacioacuten in situ es un proceso maacutes complejo que cuando se estudia bajo condiciones
controladas de laboratorio ya que hay factores como la escasez de nutrientes o las bajas
temperaturas que dificultan el proceso (capiacutetulos 1 y 3) Sin embargo la aplicacioacuten de
tratamientos in situ como la bioestimulacioacuten o el bioaumento pueden mejorar la eficacia de la
biorremediacioacuten En este capiacutetulo se determinoacute la respuesta de la comunidad bacteriana
frente a la bioestimulacioacuten el bioaumento o a la atenuacioacuten natural evaluando el porcentaje
de degradacioacuten de creosota y los HAP que la componen la reduccioacuten de la toxicidad y al
mismo tiempo estudiando los cambios poblacionales El criterio para la eleccioacuten de la
teacutecnica maacutes eficaz se determinoacute en funcioacuten de la eficacia en la degradacioacuten y en la
reduccioacuten de la toxicidad Los resultados mostraron que aunque la creosota se redujo
considerablemente y sin diferencias significativas entre tratamientos la toxicidad del medio
permanecioacute alta durante todo el proceso La ausencia de diferencias significativas entre
tratamientos en cuanto a la eliminacioacuten de creosta se refiere indica que la comunidad
autoacutectona del suelo tiene mcroorgasnimos con capacidad degradadora aunque previamente
no hayan estado expuestos a HAP Las bajas temperaturas a las que se desarrolloacute el
experimento fue la causa de que la toxicidad del medio no se redujera Cabe destacar la
importancia de las identificaciones mediante teacutecnicas no cultivables de especies
pertenecientes a los geacuteneros Balneimonas y Pantoea previamente no descritas en procesos
de biodegradacioacuten de creosota o HAP
Resumen Metodologiacutea general
33
Metodologiacutea general
Todos los materiales y meacutetodos estaacuten descritos y con sus respectivas refrencias en cada
uno de los capiacutetulos que se indican a continuacioacuten Sin embargo en algunos casos y dado
que la publicacioacuten de los datos en muchos casos obliga a ajustarse a los formatos de cada
revista especializada algunos meacutetodos no se han explicado en detalle en los capiacutetulos Este
apartado ldquoMetodologiacutea generalrdquo tiene como objetivo profundizar en el fundamento de
algunos de los meacutetodos utilizados durante el desarrollo de este proyecto
Preparacioacuten de consorcios bacterianos
El consorcio bacteriano C2PL05 fue utilizado en los experimentos de los capiacutetulos que
componen esta tesis como consorcio degradador de HAP Este consorcio fue extraiacutedo de un
suelo croacutenicamente contaminado con HAP (Figura 2A) de una refineriacutea de petroacuteleo situada
en Puertollano Ciudad Real (Espantildea) Su capacidad degradadora se verificoacute en un cultivo
semicontinuo en matraces Erlenmeyer de 100 ml que conteniacutean 50 ml BHB con Tween-80
(1 vv) y naftaleno fenantreno (05 gmiddotlminus1) y antraceno (005 gmiddotlminus1) realizando refrescos del
medio cada 15 diacuteas
Cuando se indique (capiacutetulo 3) se preparoacute un consorcio de un suelo procedente de un
bosque (43ordm 4175acuteN 8ordm 0683acuteO Frgas do Eume Galicia Espantildea Figura 2B) totalmente
libre de contaminacioacuten por HAP al que se denominoacute BOS08 El suelo se obtuvo de la parte
maacutes superficial por lo que teniacutea un alto contenido en materia orgaacutenica y restos de madera
muerta
Figura 2 Suelo contaminado procedente de la refineriacutea (A) y suelo
procedente de bosque (B) de los cuales se extrajeron los consorcios
C2PL05 y BOS08 respectivamente
A B
Resumen Metodologiacutea general
34
Para la extraccioacuten de ambos consorcios bacterianos 1 g de suelo se resuspendioacute en
10 ml de solucioacuten salina PBS (pH 70) y se mantuvo en agitacioacuten constante a 150 rpm en
oscuridad y a 25ordmC durante 24 horas Posteriormente se formoacute un cultivo madre de cada
consorcio en 50 ml de BHB con la mezcla de HAP que se fuera a utilizar en el experimento
tween-80 (1 vv) como surfactante y 15 ml del extracto de cada consorcio Los cultivos se
incubaron en un agitador orbital a 150 rpm y 25ordmC hasta que alcanzara la fase exponencial
En este momento se inoculaba la cantidad de cultivo madre necesario en los microcosmos
de los experimentos en funcioacuten de la concentracioacuten de inoacuteculo deseada en los mismos
Disentildeos experimentales
En este apartado se explica el disentildeo y la composicioacuten de los experimentos que conforman
los capiacutetulos de esta tesis para facilitar su comprensioacuten Generalizando los capiacutetulos 1 (1a y
1b) y 2 tratan de optimizar el medio nutritivo suministrado al consorcio C2PL05 el tipo y
concentracioacuten de surfactante y otros factores ambientales para lo cual los microcosmos
eran cultivos liacutequidos incubados en Erlenmeyers en un agitador orbital Los capiacutetulos 3 y 4
se centran en el estudio de la biodegradacioacuten de HAP en sustrato soacutelido (arena de riacuteo y
suelo natural respectivamente) para reproducir en la medida de los posible las condiciones
naturales
En el capiacutetulo 1a se optimizaron 6 factores (3 posibles valores cada factor) de forma
individual y consecutiva En total se desarrollaron 18 tratamientos en cultivos liacutequidos (3
reacuteplicas) incubados en un agitador orbital a 150 rpm 25 ordmC y oscuridad (Figura 3) durante
168 horas En el capiacutetulo 1b el disentildeo ortogonal L18 (37) (21) permitioacute mediante el desarrollo
de 18 tratamientos (3 reacuteplicas cada uno) la optimizacioacuten de 8 factores 7 de ellos con 3
posibles valores (37) y un factor con dos valores (21) Un total de 54 cultivos se incubaron
durante 159 horas en las mismas condiciones que en el capitulo 1a variando la temperatura
seguacuten las necesidades del tratamiento En la Figura 4 y 5 se muestran los disentildeos
experimentales correspondientes a los capiacutetulos 1a y 1b respectivamente
Resumen Metodologiacutea general
35
Figura 3 Cultivos liacutequidos incubados en un agitador orbital
Optimizacioacuten
CNP
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
100101
1002116
100505
Optimizacioacuten
fuente de N
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
NaNO3
NH4NO3
(NH4)2SO3
Optimizacioacuten
fuente de Fe
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
FeCl3
Fe(NO3)3
Fe2(SO4)3
Optimizacioacuten
[Fe]
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
005 mM
01 mM
02 mM
Optimizacioacuten
pH
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
50
70
80
Optimizacioacuten
fuente de C
BHB tween-80
C2PL05
Naftaleno fenantreno
antraceno y glucosa (20 80 100)
X 3
HAP
HAPglucosa (5050)
Glucosa
2ordm 3ordm
4ordm 5ordm 6ordm
Figure 4 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 1a
Resumen Metodologiacutea general
36
Tordf
Optimizacioacuten CNP
OptimizacioacutenFuente N
OptimizacioacutenFuente Fe
Optimizacioacuten[Fe]
Optimizacioacuten[Tween-80]
Optimizacioacutendilucioacuten inoacuteculo
Optimizacioacutenfuente de C
20ordmC25ordmC30ordmC
1001011002116100505
NaNO3
NH4NO3
(NH4)2SO3
FeCl3Fe(NO3)3
Fe2(SO4)3
005 mM01 mM02 mM
CMC20 CMC
10-1
10-2
10-3
0100505020100
18 tratamientos
X 3
C2PL05Antraceno dibenzofurano pireno
BHB (modificado seguacuten tratamiento)
Figura 5 Disentildeo experimental correspondiente a al experimento que conforma el capiacutetulo 1b
En el capiacutetulo 2 se estudioacute la capacidad de degradacioacuten y la evolucioacuten del consorcio
C2PL05 en dos tratamientos (cada uno en triplicado) uno adicionado con Tween-80 y otro
con Tergitol NP-10 (1 vv) como surfactantes En total 6 cultivos liacutequidos se incubaron a
150 rpm 25 ordmC y oscuridad durante 45 diacuteas como se muestra en la Figura 3 El disentildeo
experimental de este capiacutetulo se resume graacuteficamente en la Figura 6
Tratamiento 1con Tween-80
Tratamiento 2con Tergitol NP-10
C2PL05BHB-Tergitol NP-10 (1)Naftaleno fenantreno antraceno
X 3
X 3
C2PL05BHB-Tween-80 (1)Naftaleno fenantreno antraceno
Figura 6 Disentildeo experimental correspondiente al experimento que conforma
el capiacutetulo 2
Resumen Metodologiacutea general
37
El capiacutetulo 3 se desarrolloacute en microcosmos con 90 g de arena de riacuteo esterilizada
(Figura 7) e incinerada en una mufla a 300 ordmC para eliminar cualquier tipo de
microorganismos o materia orgaacutenica que pudiera contener Se realizaron 4 tratamientos
distintos en funcioacuten de la temperatura de incubacioacuten (5-15 ordmC o 15-25 ordmC) y del consorcio
inoculado (C2PL05 o BOS08) cada tratamiento con tres reacuteplicas para cada uno de los 5
tiempos de muestreo lo que supuso un total de 60 microcosmos (Figura 8) Los nutrientes
se suministraron antildeadiendo 18 ml de medio BHB que proporcionaba una humedad relativa
del 60 y que ademaacutes conteniacutea Tween-80 (1 vv) Los microcosmos se inocularon con
35 ml de un cultivo madre del consorcio C2PL05 oacute BOS08 y se incubaron en caacutemaras bajo
condiciones controladas de temperatura (seguacuten tratamiento) humedad (60 constante) y
luz (16 horas de luz8 horas oscuridad)
Figura 7 Microcosmos del experimento para el capiacutetulo 3 en caacutemara de crecimiento
Resumen Metodologiacutea general
38
Tratamiento 1
Tratamiento 2
Tratamiento 3
Tratamiento 4
C2PL0515-25ordmCBHB oacuteptimoNaftaleno fenantreno antracenopireno y perileno
C2PL055-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS0815-25ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS085-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
X 3
X 3
X 3
X 3
X 5 tiempos
X 5 tiempos
X 5 tiempos
X 5 tiempos
TOTAL = 60 MICROCOSMOS
Figura 8 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 3
El experimento que compone el capiacutetulo 4 de biorremediacioacuten in situ se desarrolloacute
bajo condiciones ambientales externas en una zona del campus preparada para ello Como
sustrato se utilizoacute suelo natural extraiacutedo de los primeros 20 cm y tamizado con una maya lt
2 mm El sustrato se depositoacute en bandejas de plaacutestico para evitar que el agente
contaminante se filtrara al suelo y se protegioacute de la lluvia tal y como se observa en la Figura
9 Cada uno de los cinco tratamientos (control atenuacioacuten natural bioestimulacioacuten
bioaumento y bioestimulacioacuten junto con bioaumento) se hizo en duplicado para cada uno de
los 4 muestreos realizados durante los 8 meses de experimentacioacuten (octubre-junio) Cada
microcosmos (bandeja) conteniacutea 550 g de suelo humedecidos (40) con agua o BHB como
fuente de nutrientes en el caso de los tratamientos con bioestimulacioacuten Los tratamientos
bioaumentados se enriquecieron con 5 ml de un cultivo madre del consorcio C2PL05 Como
agente contaminante se utilizoacute creosota antildeadiendo 25 ml de una disolucioacuten de creosota en
Resumen Metodologiacutea general
39
n-hexano (25 g creosota por bandeja) a todos los tratamientos excepto al control Resumen
del disentildeo en la Figura 10
Figura 9 Experimento para el capiacutetulo 4 bajo condiciones ambientales
externas en el Campus de la Universidad Rey Juan Carlos Moacutestoles
Tratamiento 1 Control
Tratamiento 2 Atenuacioacuten
natural
Tratamiento 3 Bioestimulacioacuten
Tratamiento 4 Bioaumento
Tratamiento 5 Bioestimulacioacuten
y Bioaumento
Suelo sin contaminar X 4 tiempos
CreosotaH2O-Tween-80 X 4 tiempos
CreosotaBHB oacuteptimo-Tween-80 X 4 tiempos
CreosotaH20 ndash Tween-80 X 4 tiemposC2PL05
CreosotaBHB oacuteptimo-Tween-80 X 4 tiemposC2PL05
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
TOTAL = 40 MICROCOSMOS
Figura 10 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 4
Resumen Metodologiacutea general
40
Anaacutelisis fiacutesico-quiacutemicos
La caracterizacioacuten del suelo contaminado del cual se extrajo el consorcio C2PL05 asiacute como
la explicacioacuten de las teacutecnicas y metodologiacuteas empleadas se detallan en Molina et al (2009)
No obstante en la Tabla 1 se presentan las propiedades fiacutesico-quiacutemicas de dicho suelo
contaminado
Tabla 1 Propiedades fisico-quiacutemicas y bioloacutegicas del suelo contaminado con HAP
Propiedades Unidades Media plusmn ES
Tamantildeo medio de partiacutecula μm3 291 plusmn 6 Composicioacuten (arenaslimosarcillas) v 291009000 plusmn 03603600
pH - 77 plusmn 01
Conductividad μSmiddotcm-1 74 plusmn 22
WHCa v 33 plusmn 7
(NO3)- μgmiddotKg-1 40 plusmn 37
(NO2)- μgmiddotKg-1 117 plusmn 01
(NH4)+ μgmiddotKg-1 155 plusmn 125
(PO4)3- μgmiddotKg-1 47 plusmn 6
Carbono total v 96 plusmn 21
TOCb (tratamiento aacutecido) v 51 plusmn 04
MPNc (heteroacutetrofos) x104 ceacutelulasmiddotg-1 97 plusmn 12
MPNc (degradador de HAP) x103 ceacutelulasmiddotg-1 93 plusmn 19
Toxicity EC50d gmiddot100ml-1 144 plusmn 80
Hidrocarburos extraiacutedos w 92 plusmn 18
a Capacidad de campo del agua (WHC Water holding capacity) maacutexima cantidad de agua que
puede contener un suelo b Carbono orgaacutenico total (TOC total organic carbon) c Nuacutemero maacutes
probable (MPN most probably number) teacutecnica cultivo-dependiente que estima el nuacutemero de
ceacutelulas capaces de crecer con una determinada fuente de carbono (ver apartado Anaacutelisis
bioloacutegicos) d EC50 es una medida de la eficacia de una determinada sustancia o de su toxicidad
y representa la cantidad de un compuesto necesaria para disminuir al 50 una funcioacuten En
nuestro caso indica la toxicidad del medio que disminuye a la mitad la actividad microbiana del
consorcio
La metodologiacutea utilizada para la extraccioacuten de HAP (capiacutetulos 1 2 y 3) y creosota
(capiacutetulo 4) se detalla en el apartado de material y meacutetodos de los capiacutetulos
correspondientes La cromatografiacutea liacutequida de alto rendimiento (HPLC high-performance
liquid chromatography) fue la teacutecnica utilizada para el anaacutelisis de los HAP en los capiacutetulos 1
y 2 siguiendo el protocolo descrito por Bautista et al (2009) El equipo de anaacutelisis HPLC
(Prestar 230 Varian Palo Alto CA USA) esta compuesto por una columna C18 en fase
reversa Luna C18 (2) (75 cm longitud x 46 mm diaacutemetro interno y 3 μm tamantildeo de partiacutecula
Phenomenex Torrance CA USA) y conectado a una matriz de fotodiodos de UVVis
Resumen Metodologiacutea general
41
(ultravioletavisible) y un detector de fluorescencia La fase moacutevil utilizada se compone de un
gradiente acetonitriloagua programado como se detalla a continuacioacuten gradiente isocraacutetico
6040 (0-2 min) gradiente de 7525 (2-14 min) gradiente isocraacutetico 7525 (14-15 min)
gradiente de 1000 (15-16 min) El volumen de inyeccioacuten de muestra es de 10 μl y el flujo de
elusioacuten en la columna de 08 mlmiddotmin-1 La deteccioacuten de los HAP se realiza a 254 nm El
posterior tratamiento de los datos se detalla en los respectivos capiacutetulos
El meacutetodo para la deteccioacuten de HAP en el capiacutetulo 3 y de creosota en el capitulo 4 fue
la cromatografiacutea de gases (GC Gas Chromatography) utilizando un cromatoacutegrafo de gases
(system Varian 3900 Palo Alto CA USA) con un detector con ionizador de llama (FID
Flame Ionization Detector) La metodologiacutea protocolo y posterior tratamiento de los datos se
detallan en el material y meacutetodos de los respectivos capiacutetulos
Anaacutelisis bioloacutegicos
La densidad celular es una teacutecnica utilizada en todos los ensayos que componen esta tesis y
por tanto la metodologiacutea y el posterior tratamiento de los datos estaacuten detalladamente
descritos en todos los manuscritos que conforman los capiacutetulos de la tesis
Las teacutecnicas cultivo dependientes desarrolladas en los ensayos han sido el NMP
descrito en los capiacutetulos 2 3 y 4 y el aislamiento de colonias aplicando la metodologiacutea
empleada por Molina et al (2009) y descrita en los capiacutetulos 2 y 3
Teacutecnicas moleculares
Extraccioacuten y amplificacioacuten de ADN
La extraccioacuten de ADN de muestras de cultivos liacutequidos y muestras de biomasa de una
colonia aislada (capiacutetulos 2 y 3) se realizoacute usando el kit de extraccioacuten fiacutesico-quiacutemico de ADN
bacteriano Microbial DNA isolation Kit (Laboratorios MoBio Solano Beach CA USA) Para
la extraccioacuten de ADN total de muestras de suelo (capiacutetulos 3 y 4) se usoacute el kit de extraccioacuten
fiacutesico-quiacutemico Power Soil DNA kit (Laboratorios MoBio Solano Beach CA USA) siguiendo
en ambos casos el protocolo recomendado por el fabricante
Resumen Metodologiacutea general
42
Para la amplificacioacuten de las secuencias de ADN se utilizaron varias parejas de
cebadores en funcioacuten de la teacutecnica posterior de anaacutelisis del producto de PCR La
amplificacioacuten del ADN se realizoacute con el fin de identificar las secuencias de las cepas
aisladas o para un posterior anaacutelisis del ADN total de una muestra mediante electroforesis
en gel con gradiente desnaturalizante (DGGE denaturing gradient gel electrophoresis)
Cuando fue necesario reamplificar material geneacutetico procedente de una banda de DGGE la
pareja de primers utilizada no presentaba cola de GC (guanina-citosina) En la Tabla 2 se
describen las caracteriacutesticas de los cebadores y en la Figura 11 se detallan las condiciones
del programa correspondiente a cada pareja de cebadores
Tabla 2 Caracteriacutesticas de los cebadores utilizados para la amplificacioacuten de ADN por PCR
Cebador Secuencia 5acute--3acute Nordm de bases
Tordf hibridacioacuten
(ordmC)
Programa de PCR (Figura
Teacutecnica de anaacutelisis del producto de
16F27 AGAGTTTGATCMTGGCTCAG 20 55 I Purificacioacuten Secuenciacioacuten16R1488 CGGTTACCTTGTTACGACTTCAGG 24 55 I
16F341 CCTACGGGAGGCAGCAG 17 54 II DGGE Clonacioacuten Ecoli 16R907 CCGTCAATTCCTTTRAGTTT 20 54 II
16F338 CTCCTACGGGAGGCAGCAG 19 55 II DGGE Clonacioacuten Ecoli 16R518 CGTATTACCGCGGCTGCTGG 20 55 II
ITS1F CTTGGTCATTTAGAGGAAGTAA 20 54 III Presencia material geneacutetico ITS4 TCCTCCGCTTATTGATATGC 20 54 III
Primer con posibilidad de antildeadir una secuencia de 40 bases (5acute-CGC CCG CCG CGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) rica en guanina (G) y citosina(C) unida al extremo 5acute- del
cebador necesaria para electroforesis en gel con gradiente desnaturalizantede
Resumen Metodologiacutea general
43
Figura 11 Condiciones de los programas de PCR I II y III a) Paso en el cual se procede a la
activacioacuten del principio activo de la polimerasa ExTaq-HS a una Tordf de activacioacuten de 94ordmC b) Tordf de
desnaturalizacioacuten c) Tordf de hibridacioacuten d) Tordf de polimerizacioacuten e) Tordf de extensioacuten f) Tordf final y de
conservacioacuten del producto de PCR
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 5 min
95 ordmC 1 min
54 ordmC 05 min
72 ordmC 15 min
72 ordmC 10 min
30 CICLOS
PROGRAMA PCR III
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR II
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
94 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR I
Resumen Metodologiacutea general
44
Electroforesis en gel con gradiente de desnaturalizacioacuten (DGGE) y clonacioacuten en
Escherichia coli
El estudio de la comunidad bacteriana se realizoacute mediante la teacutecnica DGGE ampliamente
descrita en los capiacutetulos 2 3 y 4 Las bandas maacutes predominantes fueron extraiacutedas del gel
eluiacutedas en de agua esterilizada y almacenadas a -20 ordmC para su posterior reamplificacioacuten y
clonacioacuten Las imaacutegenes de DGGE se analizaron graacutefica y estadiacutesticamente para diferenciar
entre las comunidades objeto de estudio y la influencia de los tratamientos en los cambios
de una comunidad El anaacutelisis graacutefico mediante el programa UN-Scan-It (v 60 Silk Scientific
US) permitioacute identificar el porcentaje de abundancia de cada banda con respecto de una
comunidad
La clonacioacuten en Ecoli se empleoacute debido a la imposiblidad de reamplificar el ADN
contenido en una banda cortada del gel de DGGE La metodologiacutea empleada para el
desarrollo de esta teacutecnica en los capiacutetulos 2 3 y 4 es la recomendada por el fabricante del
kit utilizado pGEM-T Easy Vector System II (Pomega)
Alineamiento de secuencias y anaacutelisis filogeneacuteticos
Las secuencias fueron editadas utilizando el programa Chromas Pro v142 que permite
ademaacutes visualizar y modificar posibles ambiguumledades en los nucleoacutetidos Las secuencias
fueron descargadas en las bases de datos disponibles (Genbank
(httpwwwncbinlmnihgovgenbank) y Ribosomal Sequence Data
(httprdpcmemsueduseqmatchseqmatch_introjsp)) a traveacutes de la opcioacuten BLAST con el
fin de aproximarnos a la identificacioacuten molecular de los organismos La secuencias fueron
alineadas utilizando el programa Bioedit v709 y posteriormente se elaboroacute una matriz de
datos a partir de la cual se establecieron las posibles relaciones filogeneacuteticos entre las
secuencias problema y aquellas descargadas de las bases de datos El programa utilizado a
tal efecto fue PAUP 40B10 (Swofford 2003)
Se utilizaron dos tipos de anaacutelisis para estimar las relaciones filogeneacuteticas y la
fiabilidad de las topologiacuteas obtenidas Por un lado se utilizoacute la Maacutexima Parsimonia estaacutendar
(Maxima Parsimonia de Fitch MP) un meacutetodo que elige el aacuterbol que requiere el menor
nuacutemero de cambios evolutivos para explicar las relaciones entre taxones a partir de la
informacioacuten generada por los sitios informativos el valor relativo de los diferentes caracteres
y de sus transformaciones Para evaluar la fiabilidad de las relaciones establecidas por
parsimonia se selecciono el meacutetodo Bootstraping (Felsenstein 1985) donde los caracteres
Resumen Metodologiacutea general
45
de las matrices se combinan al azar con las repeticiones necesarias considerando los
paraacutemetros establecidos en el anaacutelisis de parsimonia Asiacute el porcentanje con que aparece
un determinado grupo es una medida de la bondad de dicho grupo o rama Por otro lado la
diferencia entre secuencias (distancia geneacutetica) se computoacute en teacuterminos de nuacutemero de
nucleoacutetidos diferentes por sitio entre secuencias realizando un anaacutelisis de neighbour-joining
de acuerdo al algoritmo de Jukes amp Cantor (1969) Ambos tipos de anaacutelisis se llevaron a
cabo usando el software PAUP 40B10 (Swofford 2003)
Anaacutelisis estadiacutesiticos
Todos los capiacutetulos se disentildearon de forma que tras la finalizacioacuten del experimento los datos
pudieran ser tratados estadiacutesticamente El tratamiento estadiacutestico y los anaacutelisis realizados
con los datos de los ensayos estaacuten descritos en el apartado correspondiente de los
manuscritos que componen los artiacuteculos de la presente tesis Es necesario explicar
detalladamente el experimento que compone el capiacutetulo 1b disentildeado con un experimento
ortogonal del tipo L18 (37) (21) seleccionado del modulo de Statistica (Version 60) Este tipo
de disentildeo permitioacute hacer una combinacioacuten de muacuteltiples factores de forma reducida Es decir
un total de 18 experimentos representan todas las combinaciones posibles que se pueden
dar entre 8 factores siete de los cuales pueden tomar tres valores (37) diferentes (ej factor
Tordf valores 30ordmC 25ordmC y 20ordmC) y uno de ellos con dos valores (21) (ej factor concentracioacuten
de surfactante valores CMC y +20 CMC)
Para visualizar cambios en las comunidades microbianas (patrones univariantes) en
cada combinacioacuten de factores (ej tiempo tipo de consorcio temperatura) se realizoacute una
ordenacioacuten multivariante mediante un escalamiento multidimensional no-meacutetrico (MDS non-
parametric Multidimensional Scaling) usando el programa PRIMER (Clarke 1993) Este tipo
de anaacutelisis se realizoacute en los capiacutetulos 3 y 4 La ordenacioacuten se hizo sobre la base de la matriz
de dismilaridad de Bray-Curtis construida a partir de la transformacioacuten de los datos de
abundancia por la raiacutez cuarta para minimizar la influencia de los valores maacutes extremos
(Clarke 1993 Martiacuten Guirao 2007) Se usoacute el procedimiento SIMPER (Clarke 1993) para
identificar el porcentaje de contribucioacuten de cada banda a la disimilitud entre tratamientos
establecida en la matriz de Bray-Curtis Las bandas se consideraron influyentes cuando su
contribucioacuten se encontraba dentro de los primeros 70 (capiacutetulo 2) 60 (capiacutetulo 3) o 50
(capiacutetulo 4 Viejo 2009) del porcentaje medio de similaridaddisimilaridad acumulado entre y
dentro de la combinacioacuten de factores El criterio aplicado para escoger el porcentaje de
contribucioacuten limite se hizo en funcioacuten de la riqueza de bandas de forma que cuanto menor
fuera este paraacutemetro mayor el porcentaje liacutemite
Capiacutetulo
Publicado en Water Air amp Soil Pollution (2011) 217 365-374
Simarro R Gonzaacutelez N Bautista LF Sanz R amp Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene and
anthracene) biodegradation process by a bacterial consortium
Optimizacioacuten de los principales factores abioacuteticos de un proceso de biodegradacioacuten
de HAP (naftaleno fenantreno y antraceno) por un consorcio bacteriano
1a
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
49
Abstract
The aim of this work is to determine the optimum values for the biodegradation process of six
abiotic factors considered very influential in this process The optimization of a polycyclic
aromatic hydrocarbons (naphthalene phenanthrene and anthracene) biodegradation
process was carried out with a degrading bacterial consortium C2PL05 The optimized
factors were the molar ratio of carbonnitrogenphosphorus (CNP) the nitrogen source the
iron source the iron concentration the pH and the carbon source Each factor was optimized
applying three different treatments during 168 h analyzing cell density by spectrophotometric
absorbance at 600 nm and PAH depletion by HPLC To determine the optimum values of the
factors an analysis of variance (ANOVA) was performed using the cell density increments
and biotic degradation constants calculated for each treatment The most effective values of
each factor were a CNP molar ratio of 1002116 NaNO3 as nitrogen source Fe2(SO4)3 as
iron source using a concentration of 01 mmolmiddotl-1 a pH of 70 and a mixture of glucose and
PAH as carbon source Therefore high concentration of nutrients and soluble forms of
nitrogen and iron at neutral pH favour the biodegradation Also the addition of glucose to
PAH as carbon source increased the number of total microorganism and enhanced the PAH
biodegradation due to augmentation of PAH degrader microorganisms It is also important to
underline that the statistical treatment of data and the combined study of the increments of
the cell density and the biotic biodegradation constant has facilitated the accurate
interpretation of the optimization results For an optimum bioremediation process is very
important to perform these previous bioassays to decrease the process development time
and so the costs
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
51
Introduction
Polycyclic aromatic hydrocarbons (PAH) are persistent organic compounds with two or more
aromatic rings They are formed by incomplete combustion of fossil fuels and pyrolysis of
organic matter derived from human activities and as a result of natural events like forest fires
The toxic mutagenic and carcinogenic properties of PAH have concerned the Unites States
Environmental Protection Agency (US-EPA) proposing some of them as priority pollutants
(including naphthalene phenanthrene and anthracene) In addition the PAH solubility is very
low in aqueous medium (Luning Prak amp Pritchard 2002) affecting their degradation and
biomagnification within the ecosystems The microbial bioremediation removes or
immobilizes the pollutants reducing toxicity with a very low environmental impact Generally
microbial communities present in PAH contaminated soils are enriched by microorganisms
able to use them as only carbon source (Heitkamp amp Cerniglia 1988 Gallego et al 2007)
However this process can be affected by a few key environmental factors (Roling-Wilfred et
al 2002) that may be optimized to achieve a more efficient process The molar ratio of
carbon nitrogen and phosphorus (CNP) is very important for the metabolism of the
microorganisms and so for PAH degradation (Bossert amp Bartha 1984 Alexander 1994
Kwok amp Loh 2003) The molar ratio 100101 is frequently considered optimal for
contaminated soils (Bossert amp Bartha 1984 Alexander 1994) while other author have
reported negative or non-effects (Chaicircneau et al 2005) According to Leys et al (2005)
these contradictory results are due to the nutrients ratio required by PAH degrading bacteria
depends on environmental conditions type of bacteria and type of hydrocarbon In addition
the chemical form of those nutrients is also important being the soluble forms (ie iron or
nitrogen in form of phosphate nitrate and ammonium) the most frequent and efficient due to
their higher availability for microorganisms Depending on the microbial community and their
abundance another factor that may improve the PAH degradation is the addition of readily
assimilated such as glucose carbon sources (Zaidi amp Imam 1999)
Moreover the pH is an important factor that affects the solubility of both PAH and
many chemical species in the cultivation broth as well as the metabolism of the
microorganisms showing an optimal range for bacterial degradation between 55 and 78
(Bossert amp Bartha 1984 Wong et al 2001)
In general bioremediation process optimization may be flawed by the lack of studies
showing the simultaneous effect of different environmental factors Hence our main goal was
to set up the optimum values of six abiotic factors CNP molar ratio nitrogen source iron
source iron concentration pH and carbon source for the biodegradation of three PAH
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
52
(naphthalene phenanthrene and anthracene) at 25 ordmC In order to achieve the main objective
we analyzed the effects of the above factors on the microbial growth and the biotic
degradation rate
Materials and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all gt99 purity) were purchased from Sigma-
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) The consortium C2PL05
was not able to degrade PAH significantly without the addition of surfactants (data not
shown) Therefore surfactant Tween-80 (Sigma-Aldrich Steinheim Germany) was selected
as the most efficient biodegradable and non-toxic surfactant (Bautista et al 2009) for the
consortium C2PL05 Bushnell Haas Broth medium (BHB) was purchased from Panreac
(Barcelona Spain) and its composition is 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-
1 KHPO4 1 gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 This base composition was
modified in each experiment as required
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1g of soil (lt 2 mm) was resuspended in 10 ml
of phosphate buffer saline (PBS) and incubated during 12 h in an orbital shaker (Innova 40
New Brunswick Scientific Edison NJ USA) at 150 rpm and 25ordmC under dark conditions
After that 15 ml of the supernatant was inoculated in 50 ml of BHB broth (pH 70) 1 wt
Tween-80 as surfactant and naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1)
as carbon source The culture was incubated at 150 rpm and 25ordmC under dark conditions
until the exponential phase was completed This was confirmed by monitoring the cell density
by absorbance at 600 nm in a spectrophotometer (Spectronic GenesysTM UK) Then the
consortium was stored at 4 ordmC to stop its growth At the beginning of each experiment 500 μl
of the stored consortium was inoculated into the fermentation flasks To identify the microbial
consortium C2PL05 colonies from aliquots of the soil extract were isolated in BHB agar
plates with PAH as only carbon source to confirm that these colonies were PAH degraders
Eight colonies were isolated and transferred onto LB-glucose agar plates in order to increase
microbial biomass for DNA extraction Total DNA of the colonies was extracted using
Microbial DNA isolation kit (MoBio Laboratories) Amplification of the 16S rRNA coding
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
53
region of the DNA was performed as described by Vintildeas et al (2005) using the primers
16F27 and 16R1488 Sequences were edited and assembled using BioEdit 487 software
(Hall 1999) All isolated strains of the consortium C2PL05 were γ-proteobacteria and the
genera present were Enterobacter Pseudomonas and Stenotrophomonas In addition non
culture-dependent molecular techniques as denaturant gradient gel electrophoresis (DGGE)
was performed to know the total biodiversity of the microbial consortium C2PL05 16S rRNA
gen was amplified using the primers 341F-GC and 907R (GC clamp 5acute-CGC CCG CCG
CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995) About 6 of
polyacrylamide (3751 acrylamidebisacrylamide) gels with a 30-60 urea-formamide
denaturant gradient and 075 mm were used in 1xTAE buffer at 200V for 4h at 60 ordmC The
bands were excised and reamplificated to identify the DNA The two genera identified
coincided with genera Pseudomonas and Stenotrophomonas identified by culture-dependent
techniques (more details in Molina et al 2009)
Experimental design
A total of 6 abiotic factors were evaluated To obtain an optimum value three treatments
each in triplicate were performed for each factor The replicates were carried out in 100 ml
Erlenmeyer flasks with 50 ml of BHB medium (pH 70) Tween-80 (1wt) naphthalene
phenanthrene and anthracene (each at 500 mgmiddotl-1) and 500 microl of the C2PL05 consortium
The concentration of the inoculum was 315x106 cells ml-1 of the heterotrophic microorganism
and 695x105 cells ml-1 of the PAH degrading microorganism The number of the
microorganisms capable to degrade any carbon source present in the medium (heterotrophic
microorganisms) and microorganisms capable to degrade PAH as sole carbon source (PAH-
degrading bacteria) were measured by the most probably number (MPN) method (Wrenn amp
Venosa 1996) LB-glucose broth and BHB medium were used to determine heterotrophic
microorganism and PAH degrading microorganism respectively To maintain the same initial
number of cells in each experiment the absorbance of the inoculum was measured and
diluted if necessary before inoculation to reach an optical density of 16 AU The replicates
were incubated in an orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA)
at 150 rpm and 25 ordmC under dark conditions Previous to inoculate the consortium the
Erlenmeyer flasks were shacked overnight to solubilize most of the PAH Samples were
withdrawn at 0 15 24 39 48 64 72 159 and 168 h to monitor the PAH depletion and cell
growth
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
54
Treatment conditions
Composition of BHB base was 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-1 KHPO4 1
gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 The compounds MgSO4 and CaCl2 and their
concentration were constant for all treatments and KHPO4 and K2HPO4 were modified only in
concentration The other components were modified both the concentration and compounds
according to the requirements of the optimized factors PAH at 1500 mgmiddotl-1 (500 mgmiddotl-1 of
naphthalene phenathrene and anthracene) was used as carbon source for all treatments
except for those in which the carbon source was optimized and PAH were mixed with
glucose in a proportion of 50 PAH-glucose or only glucose was added In all cases an
overall carbon concentration of 01176 mmoll-1 was used Once a factor was optimized its
optimum value was kept for the subsequent factor optimization
The levels of each factor studied were selected as described below For the CNP
molar ratio the values employed were 100101 frequently described as optimal (Bossert
and Bartha 1984) 100505 and 1002116 To optimize the nitrogen source NaNO3
NH4(NO3) and (NH4)2SO3 were used The optimal iron source was selected amongst FeCl3
Fe(NO3)3 and Fe2(SO4)3 The concentration levels of the optimal iron form were 005 01 and
02 mmoll-1 and three different pH values were also tested 50 70 and 80 The effect of the
carbon source was determined by adding PAH as only carbon source PAH and glucose
(50 of carbon atoms from each source) or glucose as only carbon source
Bacterial growth
Bacterial growth during the PAH degradation process was monitored at 0 15 24 39 48 64
72 159 and 168 h by spectrophotometric absorbance of the culture media at 600 nm in a
UV-Vis spectrophotometer (Spectronic GenesysTM UK) From the above optical density data
the average of the cell density increments (CDI) was calculated by applying the following
equation
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
55
Kinetic degradation
Naphthalene phenanthrene and anthracene concentrations in the culture media were
analysed using a ProStar 230 HPLC system (Varian Palo Alto CA USA) with a reverse
phase C18 column following the method described in Bautista et al (2009) The
concentration of each PAH was calculated from a standard curve based on peak area using
the absorbance at 254 nm Depletion rate of each PAH (-ri) during the experiments was fitted
to a first order kinetic model (Equation 2)
iBiiAii
i CkCkdt
dCr Eq 2
where C is the concentration of the corresponding PAH kA is the apparent first-order
kinetic constant due to abiotic processes kB is the apparent first-order kinetic constant
due to biological processes t is the time elapsed and the subscript i corresponds to
each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1 wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40 New Brunswick Scientific Edison
NJ USA) at 150 rpm and 25 ordmC under dark conditions PAH concentration in the control
experiment were analysed using the HPLC system described previously The values of kA for
each PAH was calculated by applying eq 2 considering kB asymp 0 since no bacterial consortium
was inoculated
Statistical analysis
In order to evaluate the effects of the treatments on the kinetic biodegradation constant (kB)
and cell density increments (CDI) bifactorials analysis of variance (ANOVA) were used The
variances were checked for homogeneity by applying the Cochranacutes test When indicated
data were transformed to homogenize variances Student-Newman-Keuls (SNK) test was
used to discriminate among different treatments after significant F-test All tests were
performed with the software Statistica 60 for Windows
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
56
Results
Control experiments (Figure 1) show that phenathrene and anthracene concentration was
not affected by any abiotic process since no depletion was observed along the experiment
so that kA asymp 0 h-1 However in the case of naphthalene some degree of abiotic depletion was
measured during the controls yielding an apparent first-order abiotic rate constant of 27x10-
3 plusmn 7x10-5 h1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the optimisation experiments
0 100 200 300 400 500 600 700
20
40
60
80
100
Rem
aini
ng P
AH
(
)
Time (hour)
Figure 1 Naphthalene ( ) phenathrene ( ) and anthracene ( )
depletion due to abiotic processes in control experiments
Table 1 Analysis of variance (ANOVA) summary for the cell density increments (CDI) and the
biotic degradation constant (kB) MS is the means of squares and df degrees of freedom
CDI kB
Factor df MS F-value p-value df MS F-value p-value
CNP ratio 2 27middot10-1 238 4 57middot10-2 566 Error 6 11middot10-2 18 10middot10-3
N source 2 21middot10-1 234 4 90middot10-6 113
Error 6 10middot10-2 18 70middot10-7
Fe source 2 18middot10-2 51 4 30middot10-6 43
Error 6 36middot10-3 18 70middot10-8
Fe Concentration 2 45middot10-1 348 006 4 30middot10-6 38
Error 6 95middot10-2 18 10middot10-7
pH 2 30middot10-2 1103 4 15middot10-4 5
Error 6 27middot10-3 18 33middot10-5
GlucosePAHs 2 54middot10-1 45401 2 66middot10-4 7
Error 6 12middot10-3 12 93middot10-5
a Logarithmically transformed data to achieve homogeneity of variance
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
57
Cell density increments of the consortium for three different treatments of CNP molar
ratio are showed in Figure 2A According to statistical analysis of CDI there was significant
differences between CNP molar ratio (F26 = 238 p lt 001 Table 1) and SNK showed that
treatments with molar ratios of 100101 and 1002116 reached larger increases With
regard to the kinetic biodegradation constant (kB) the interaction between kB of the
treatments with each hydrocarbon was significant (F418 = 57 p lt 0001 Table 1) The SNK
test (Figure 2B) showed that the treatment 1002116 with naphthalene yielded the highest
value whereas the lowest were achieved with 100505 and 100101 for anthracene and
phenanthrene In addition within each PAH group the highest values were observed with
1002116 molar ratio Therefore although there are no differences for CDI between ratios
100101 and 1002116 1002116 molar ratio is the most effective for the PAH degradation
so that this ratio was considered as the optimal
171819202122232425
100101 1002116100505
bb
a
A
CNP molar ratio
CD
I
Naphthalene Phenanthrene Anthracene-35
-30
-25
-20
-15
-10
-05
00B
d
g
e
bc
f
ab
f
Log
k B (
h-1)
Figure 2 (A) Cell density increments of the consortium C2PL05 with the treatments 100505
100101 and 1002116 Error bars show the standard error (B) Differences between treatments
(100101 100505 and 1002116 ) and PAHs in the biodegradation kinetic constant (kB)
The letters show differences between groups (p lt 005 SNK) and the error bars the standard
deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
58
Figure 3A shows that the three different nitrogen sources added had significant effects
on CDI (F26 = 234 p lt 001 Table 1) The SNK test shows that the addition of NaNO3
significantly improved CDI The interaction between PAH and the nitrogen sources were
significant (F418 = 113 p lt 0001 Table 1) and the highest kB values were achieved with
NaNO3 for naphthalene phenanthrene and anthracene (Figure 3B) According to these
results NaNO3 is considered as the best form to supply the nitrogen source for both PAH
degradation and growth of the C2PL05 consortium
19
20
21
22
23
24
25
(NH4)
2SO
4NH4NO
3NaNO
3
a
b
a
A
Nitrogen source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
Bf
ba
e
bcb
dbc
a
kB (
h-1)
Figure 3 (A) Cell density increments of the consortium C2PL05 with the treatments NaNO3 NH4NO3
and (NH4)2SO4 Error bars show the standard error (B) Differences between treatments (NaNO3
NH4NO3 and (NH4)2SO4 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
59
CDI of the treatments performed with three different iron sources (Figure 4A) were
significantly different (F26 = 51 p lt 005 Table 1) Although no significant differences
between adding Fe2(SO4)3 or Fe(NO3)3 were observed the addition of Fe2(SO4)3 contributes
more to CDI than FeCl3 The kB (Figure 4B) showed significant differences in the interaction
between PAH and the different iron sources (F418 = 43 p lt 0001 Table 1) The highest kB
values were observed with Fe2(SO4)3 for the degradation of phenanthrene followed by FeCl3
degrading naphthalene and phenanthrene The lowest values of kB were observed with
Fe(NO3)3 degrading naphthalene and anthracene Nevertheless the most recalcitrant PAH
(phenanthrene and anthracene) showed the highest kB values with Fe2(SO4)3 in agreement
with the highest CDI values also obtained with Fe2(SO4)3
168
172
176
180
184
188
192
196
Fe(NO3)
3 Fe2(SO
4)
3FeCl
3
ab
b
a
A
Iron source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
B
c
a
b
c
b
d
b
a a
k B
(h-1
)
Figure 4 (A) Cell density increments of the consortium C2PL05 with the treatments FeCl3 Fe(NO3)3
and Fe2(SO4)3 Error bars show the standard error (B) Differences between treatments (FeCl3
Fe(NO3)3 and Fe2(SO4) ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
60
Concerning the effect of the iron concentration (Figure 5) supplied in the form of the
optimal Fe2(SO4)3 no significant differences in CDI were found for all three concentration
used (F26 = 348 p = 006 Table 1 Figure 5A) However the interaction between iron
concentration and kB of three PAH was significant (F418 = 38 p lt 0001 Table 1) reaching
the highest values for kB by using an iron concentration of 01 mmoll-1 degrading
naphthalene and phenanthrene (Figure 5B) The lowest values of kB were observed with 005
mmoll-1 and 02 mmoll-1 degrading phenanthrene and anthracene (Figure 4B) Since each
PAH showed the highest kB with 01 mmoll-1 this iron concentration was considered as the
most efficient for the PAH biodegradation process
005 01 02
38
40
42
44
46
48
50
a
a
a
A
Iron concentration (mmol l-1)
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
B
c
f
d
b
e
d
cb
a
k B (
h-1)
Figure 5 (A) Cell density increments of the consortium C2PL05 with the treatments 005 mmolmiddotl-1 01
mmolmiddotl-1 and 02 mmolmiddotl-1 Error bars show the standard error (B) Differences between treatments
(005 mmolmiddotl-1 01 mmolmiddotl-1 and 02 mmolmiddotl-1 ) and PAHs in the biodegradation kinetic
constant (kB) The letters show differences between groups (p lt 005 SNK) and the error bars the
standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
61
With reference to pH Figure 6A and statistical analysis (F26 = 1103 p lt 001 Table 1)
clearly show that the neutral pH of the medium favour the CDI of the consortium The kB of
the three different treatments (Figure 6B) also showed significant differences in the
interaction (F49 = 5 p lt 005 Table 1) The highest value of kB was observed for anthracene
degradation at neutral pH (Figure 6B) The other two PAH naphthalene and phenanthrene
did not show significantly differences between any treatments Therefore given that the
highest values of both parameters (CDI and kB) were observed at pH 7 this value will be
considered as the most efficient for the PAH biodegradation process
5 7 8
215
220
225
230
235
240
245
a
b
a
A
pH
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
25x10-2
30x10-2
B
b
a
ab ab
a
ab
c
ab ab
kB
(h-1
)
Figure 6 (A) Cell density increments of the consortium C2PL05 with the treatments pH 50 pH 70
and pH 80 Error bars show the standard error (B) Differences between treatments (pH 50 pH
70 and pH 80 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
62
The last factor analyzed was the addition of an easily assimilated carbon source
(Figure 7) Regarding to CDI values (Figure 7A) there were significant differences between
treatments (F26 = 45401 p lt 0001 Table 1) The addition of glucose as only carbon source
significantly improved CDI Figure 7B only show the kB of the treatments with PAH (100 or
50 of PAH) therefore the treatment with glucose as only carbon source was not included in
the ANOVA analysis The interaction between PAH and type of carbon source was
significant (F212 = 7 p lt 005 Table 1) The kB for the treatment with PAH and glucose
(5050) was significantly higher for phenanthrene and naphthalene (Figure 6B) although
there were no differences with the treatment for anthracene where PAH were the only carbon
source
PAHs (100)
PAHsGlucose (50)Glucose (100)
18
20
22
24
26
28
Carbon source
b
c
a
A
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-2
4x10-2
6x10-2
8x10-2
1x10-1
B
c
bb
b
b
a
k B (h
-1)
Figure 7 (A) Cell density increments of the consortium C2PL05 with the treatments PAHs (100)
PAHsglucose (5050) and glucose (100) Error bars show the standard error (B) Differences
between treatments (PAHs (100) and PAHs glucose (5050) ) and PAHs in the
biodegradation kinetic constant (kB) The letters show differences between groups (p lt 005 SNK)
and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
63
Discussion
It is important to highlight that the increments of the cell density is a parameter that brings
together all the microbial community whereas the biotic degradation constant is specific for
the PAH degrading microorganisms For that reason when the effect of the factors studied
on CDI and kB yielded opposite results the latter always prevailed since PAH degradation
efficiency is the main goal of the present optimisation study
With regard to the CNP molar ratio some authors consider that low ratios might limit
the bacterial growth (Leys et al 2005) although others show that high molar ratios such as
100101 are optimum for hydrocarbon polluted soils (Flathman et al 1994 Bouchez et al
1995 Eweis et al 1998) However in agreement with Leys et al (2005) our results
confirmed that the most effective molar ratio was the highest (1002116) This result
suggests that the supply of the inorganic nutrients during the PAH biodegradation process
may be needed by the microbial metabolism In addition the form used to supply these
nutrients can affect the metabolism of the microorganism (Carmichael amp Pfaender 1997) and
limit the amount of carbon that bacteria can assimilate limiting in turn the biodegradation
extent Our results showed that nitrate (sodium nitrate) as nitrogen source improved PAH
biodegradation as compared to ammonium This is likely due to the fact that nitrate is more
soluble and available for microorganisms than ammonium which has adsorbent properties
(Schlessinger 1991) The iron is other essential compound to stimulate the microbial activity
on PAH degradation (Dinkla amp Janssen 2003 Santos et al 2008)
On one hand iron acts as a cofactor of enzymes catalysing PAH oxidation (Dinkla amp
Janssen 2003) but it is also related with the production of biosurfactants (Santos et al
2008) These compounds are naturally produced by genera such as Pseudomonas and
Bacillus (Wei et al 2003) increasing the PAH solubility and therefore their bioavailability In
agreement with previous works (Dinkla amp Janssen 2003 Santos et al 2008) our results
confirmed that the addition of iron in a concentration of 01 mmoll-1 makes the
biodegradation more effective Santos et al (2008) stated that there is a limit concentration
above which the growth is inhibited due to toxic effects According to these authors our
results showed lower degradation and growth with the concentration 02 mmoll-1 since this
concentration may be saturating for these microorganisms However opposite to previous
works (Dinkla amp Janssen 2003 Santos et al 2008) the most effective iron form was
Fe2(SO4)3 for the PAH biodegradation likely due to the higher solubility which makes it more
available for the microorganism
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
64
The addition of easy assimilated carbon forms such as glucose for the PAH
degrading process can result in an increment in the total number of bacteria (Wong et al
2001) because PAH degrader population can use multiple carbon sources simultaneously
(Herwijnen et al 2006) However this increment in the microbial biomass was previously
considered (Wong et al 2001) because the utilization of the new carbon source may
increase the lag phase delaying the bacterial growth (Maier et al 2000) Our results
confirmed that PAH degradation was more efficient with the addition of an easy assimilated
carbon source probably because the augmentation of the total heterotrophic population also
enhanced the PAH degrading community Our consortium showed a longer lag phase during
the treatment with glucose than that observed during the treatment with PAH as only carbon
source (data not shown) These results are consistent with a consortium completely adapted
to PAH biodegradation and its enzymatic system requires some adaptation time to start
assimilating the new carbon source (Maier et al 2000)
Depending on the type of soil and the type of PAH to degrade the optimum pH range
can be very variable (Dibble amp Bartha 1979) Some acid resistant gram-positive bacteria
such as Mycobacterium sp show better PAH degradation capabilities under acid condition
because and low pH seems to render the mycobacterial more permeable to hydrophobic
substrates (Kim et al 2005) However other microorganisms belonging to Pseudomonas
genus prefer neutral pH conditions In agreement with previous works (ie Dibble amp Bartha
1979) our results confirmed that neutral pH is optimum for the biodegradation PAH
In summary the current work has shown that the optimization of environmental
parameters may significantly improve the PAH biodegradation process It is also important to
underline that the statistical analysis of data and the combined study of the bacterial growth
and the kinetics of the degradation process provide an accurate interpretation of the
optimisation results Concluding for an optimum bioremediation process is very important to
perform these previous bioassays to decrease the process development time and so the
associated costs
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Master en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
65
References
Alexander M 1994 Biodegradation and Biorremediation Academic Press New York
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse bacteria Int Biodeter
Biodegr 63 913-922
Bossert I amp Bartha R 1984 The fate of petroleum in soil ecosystems In Atlas RM (ed)
Petroleum microbiology Macmillan New York pp441-4473
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Carmichael LM amp Pfaender KF 1997 The effects of inorganic and organic supplements on
the microbial degradation of phenanthrene and pyrene in soils Biodegradation 8 1-
13
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge Appl Environ Microbiol 37 729-739
Dinkla EJT amp Janssen DB 2003 Simultaneous growth on citrate reduces the effects of
iron limitation during toluene degradation in Pseudomonas Microb Ecol 45 97-107
Eweis JB Ergas SJ Chang PY amp Schroeder ED 1998 Bioremediation Principles
McGraw-Hill Boston pp 136-236
Flathman PE Jerger DE amp Exner JH1994 Biorremediation-Field Experiences Lewis
Publishers Boca Raton pp 81-106 383-490
Gallego JL Garciacutea MJ Llamas JF Belloch C Pelaez AI amp Sanchez J 2007
Biodegradation of oil tank botton sludge using microbial consortia Biodegradation 18
269-281
Hall TA 1999 Bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 41 95-98
Heitkamp MA amp Cerniglia CE 1988 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from sediment below an Oil Field Appl Environ Microbiol 54
1612-1614
Kim YH Freeman JP Moody JD Engesse KH amp Cerniglia CE 2005 Effects of pH on
the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1
Appl Environ Microbiol 67 275-285
Kwok Chen-Ko amp Loh Kai-Che 2003 Effects of Singapore soil type on bioavalability of
nutrients in soil bioremediation Adv Environ Res 7 889-900
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
66
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Luning Prak DJ amp Pritchard PH 2002 Solubilization of polycyclic aromatic hydrocarbon
mixtures in micelar non-ionic surfactant solution Water Res 36 3463-3472
Maier MR Pepper LI amp Gerba PC 2000 Enviromental Microbiology Academic Press
Elsevier
Molina MC Gonzalez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz L 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Denaturing gradient gel
electrophoresis of PCR-amplified 16S Rdna a new molecular approach to analyse the
genetic diversity of mixed microbial communities In Akkermans ADL van Elsas JD
de Bruijn FJ (eds) Molecular microbial ecology manual Kluwer Academic Publishers
Dordrecht pp 1-23
Rolling-Wilfred FM Milner M Jones DM Lee K Daniel F Swanell-Richard JP amp Head
IM 2002 Robust hydrocarbon degradation and dynamic of bacterial communities
during nutrients-enhanced oil spillbiorremediation Appl Environ Microbiol 68 5537-
5548
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation an surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Vintildeas M Sabateacute J Guasp C Lalucat J y Solanas AM 2005 Culture-dependent and
independent aproaches establish the complexity of a PAH degrading microbial
consortium Can J Microbiol 51 897-909
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacillus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK Ma KK amp Fang M 2001 Isolation and optimization of
PAH-degradative bacteria from contaminated soil for PAH bioremediation Water Air
Soil Poll 13 1-13
Zaidi BR amp ImamSH 1999 Factors affecting microbial degradation of polycyclic aromatic
hydrocarbon phenanthrene in caribbean coastal water Mar Pollut Bull 38 738-749
Capiacutetulo
Aceptado en Water Air amp Soil Pollution (Febrero 2012)
Simarro R Gonzaacutelez N Bautista LF Molina MC amp Schiavi E
Evaluation of the influence of multiple environmental factors on the biodegradation
of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal
experimental design
Evaluacioacuten de la influencia de muacuteltiples factores ambientales en la biodegradacioacuten de dibenzofurano
fenantreno y pireno por un consorcio bacteriano usando un disentildeo experimental ortogonal
1b
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
69
Abstract
For a bioremediation process to be effective we suggest to perform preliminary studies in
laboratory to describe and characterize physicochemical and biological parameters (type and
concentration of nutrients type and number of microorganisms temperature) of the
environment concerned We consider that these studies should be done by taking into
account the simultaneous interaction between different factors By knowing the response
capacity to pollutants it is possible to select and modify the right experimental conditions to
enhance bioremediation
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
71
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic compounds composed of two
or more aromatics rings High molecular weight PAH (HMW-PAH) with four (ie pyrene) or
more aromatics rings and other heterocyclic aromatic compounds as dibenzofuran both with
high molecular mass are often more difficult to biodegrade that other low molecular weight
PAH (LMW-PAH) due to their lower solubility and biodegradability Many of them have toxic
mutagenic and carcinogenic properties and the effects of PAH as naphthalene or
phenanthrene in animals and humans their toxicity and carcinogenic activity has been
reported and well documented (Sudip et al 2002) In addition PAH are bioaccumulated in
the environment and trophic chains properties that increase with the numbers of rings There
is a natural degradation carried out by microorganism able to use PAH as carbon source
which represents a considerable portion of the bacterial communities present in polluted soils
(Heitkamp amp Cerniglia 1998) However this natural biodegradation may be affected by
environmental factors which optimization allows us to achieve a more efficient process
Temperature is a key factor in the physicochemical properties of PAH as well as in the
metabolism of the microorganisms Although it has been shown that biodegradation of PAH
is possible even at temperatures lower than 5 ordmC (Eriksson et al 2001) it is usually more
efficient at mild temperatures (15-25 ordmC) (Mohn amp Stewart 2000) The carbon nitrogen and
phosphorus (CNP) molar ratio is another important factor in biodegradation process
because affect the dynamics of the bacterial metabolisms changing the PAH conversion
rates and growth of PAH-degrading species (Leys et al 2004) The form in which these
essential nutrients are supplied affects the bioavailability for the microorganism being more
soluble and efficient the oxidated forms (such as nitrates) than reduced forms (such as
ammonium) (Schlessinger 1991)
Surfactants are compounds used to increase the PAH solubility although both
positive (Boochan et al 1998 Jin et al 2007) and negative effects (Boochan et al 1998
Laha amp Luthy 1992) on the biodegradation process has been reported The nature of the
effect depends on several factors such as the type and concentration of surfactant due to
the toxic properties of some of them (Jin et al 2007) and the increasing of toxicity of PAH
produced by increasing their solubility (Thibault et al 1996) Another factor considered is the
inoculum size related to the diversity and effectiveness of the biodegradation because in a
diluted inoculum the minority microorganisms which likely have an important role in the
biodegradation process can be removed (Szaboacute et al 2007) Moreover it has been
reported (Szaboacute et al 2007) that the addition of a readily metabolized carbon source (ie
glucose) improves the PAH degradation possibly due to the increased biomass although in
72
others cases (Wong et al 2000) this better bacterial growth reduced significantly PAH
degradation
We consider that the study of the individual effect of abiotic factors on the
biodegradation capacity of the microbial consortium is incomplete because the effect of one
factor can be influenced by other factors In this work the combination between factors was
optimized by an orthogonal experimental design fraction of the full factorial combination of
the selected environmental factors
Hence our two mains goals are to determine the optimal conditions for the
biodegradation of low (phenanthrene and dibenzophurane) and high (pyrene) molecular
weight PAH by a bacterial degrading consortium (C2PL05) and the study of the influence of
the factors (temperature CNP molar ratio type of nitrogen and iron source iron source
concentration carbon source surfactant concentration and inoculums dilution) in the
biodegradation In order to achieve these objectives we realized an orthogonal experimental
design to take into account all combination between eight factors temperature CNP molar
ratio nitrogen and iron source iron concentration addition of glucose surfactant
concentration and inoculum dilution at three and two levels
Material and methods
Chemicals and media
Dibenzofuran phenanthrene and pyrene (gt99 purity) were purchased from Sigma-Aldrich
Steinheim Germany) Stock mix of the three PAH was prepared by dissolving the necessary
amount in n-hexane (Fluka Steinheim Germany) In previously work (Bautista et al 2009)
we tested that the optimal surfactant for the consortium was the biodegradable and non
toxicTween-80 (Sigma-Aldrich Steinheim Germany) Bushnell-Haas Broth medium (BHB)
was purchased from Panreac (Barcelona Spain) and its original composition (02 g l-1
MgSO4middot7H2O 002 g l-1 CaCl2 2H2O 1 g l-1 KHPO4 1 g l-1 K2HPO4 1 g l-1 NH4NO3 005 g l-1
FeCl3) was modified according to the treatment (see Table 1)
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
73
Table 1 Experimental design
Treatment T
(ordmC) CNP (molar)
N source
Fe
source
Iron source concentration
(mM)
Glucose PAH ()
Surfactant concentration
Inoculum dilution
1 30 100505 (NH4)2SO3 Fe2(SO4)3 02 0100 CMC 10-3
2 20 1002116 (NH4)2SO3 FeNO3 005 0100 + 20CMC 10-2
3 25 100101 NaNO3 FeNO3 02 0100 + 20CMC 10-1
4 20 100505 NaNO3 Fe2(SO4)3 02 5050 + 20CMC 10-2
5 25 100505 NH4NO3 FeNO3 01 5050 CMC 10-2
6 30 100101 NH4NO3 Fe2(SO4)3 005 8020 + 20CMC 10-2
7 30 100101 NaNO3 FeCl3 01 0100 CMC 10-2
8 20 100505 NaNO3 FeCl3 005 8020 CMC 10-1
9 25 1002116 (NH4)2SO3 FeCl3 02 8020 CMC 10-2
10 20 1002116 NH4NO3 Fe2(SO4)3 01 0100 CMC 10-1
11 20 100101 NH4NO3 FeNO3 02 8020 CMC 10-3
12 25 100101 (NH4)2SO3 Fe2(SO4)3 005 5050 CMC 10-1
13 25 1002116 NaNO3 Fe2(SO4)3 01 8020 + 20CMC 10-3
14 30 1002116 NH4NO3 FeCl3 02 5050 + 20CMC 10-1
15 25 100505 NH4NO3 FeCl3 005 0100 + 20CMC 10-3
16 30 1002116 NaNO3 FeNO3 005 5050 CMC 10-3
17 30 100505 (NH4)2SO3 FeNO3 01 8020 + 20CMC 10-1
18 20 100101 (NH4)2SO3 FeCl3 01 5050 + 20CMC 10-3
Bacterial consortium
PAH-degrading consortium C2PL05 was isolated from a soil in a petrochemical complex in
Puertollano (Spain) and was identified and described in Molina et al (2009) All strains of
the consortium C2PL05 isolated by culture-dependent techniques were γ-Proteobacteria
and the strains presents belong to the genera Enterobacter Pseudomonas and
Stenotrophomonas (Molina et al 2009) In addition the diversity of the enriched microbial
consortium was characterised by a non culture-dependent molecular technique such as
denaturing gradient gel electrophoresis (DGGE) following the procedure described
elsewhere (Molina et al 2009) using the primers 341F-GC and 907R (GC clamp 5acute-CGC
CCG CCG CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995)
Experimental design
An orthogonal design form of L18 (37) (21) selected from the module of Statistica (Version 60)
was used to do the multi-factor combination A total of 18 experiments each in triplicate
were carried out in 100 ml Erlenmeyers flask with a total volume of 50 ml of Bushnell-Haas
Broth medium (BHB) (Panreac Barcelona Spain) with an original composition modified
74
according to the treatments requirements (see Table 1) The replicates were incubated in an
orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA) at 150 rpm under dark
conditions but prior to inoculate the consortium the flasks were shaken overnight to
equilibrate and solubilize most of the PAH In Table 1 shows a summary of environmental
conditions and incubation of each treatment Tween-80 concentration was 0012 mM the
critical micellar concentration (CMC) 100 of PAH was equivalent to 03 g l-1 (01 g l-1 of
each PAH) The initial cell concentration of the inoculum consortium was determined by the
most probably number (MPN) method (Wrenn amp Venosa 1983) The number of heterotrophic
microorganisms (315x106 cell ml-1) was measured with Luria Base broth (LB Panreac
Barcelona Spain) with glucose as carbon source and the PAH degrading microorganisms of
the consortium (695x105 cell ml-1) with BHB with PAH mix as carbon source
Cell density
Bacterial density during the PAH degrading process was monitored at 0 15 24 39 48 63
72 87 95 and 159 h by the increase in absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) Throughout the cell growth curve we
calculated the average of the cell densities increments (CDI) applying the equation 1
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and i
corresponds to each sample or sampling time The increments were normalized by
the initial absorbance measurements to correct the effect of the inoculum dilution
PAH extraction and analysis
At the end of each experiment (159 hours) PAH were extracted with dichloromethane and
the residue precipitated was dissolved in 1 ml of acetonitrile for high performance liquid
chromatography (HPLC) analysis using a ProStar 230 HPLC system (Varian Palo Alto CA
USA) with a reversed phase C18 column following the method previously described (Bautista
et al 2009) The residual concentration of each PAH was calculated from a standard curve
based on peak area at a wavelength of 254 nm The average percentage of phenanthrene
pyrene and dibenzofuran and average percentage of total PAH degradation (PD) for each
treatment are shown in Table 2
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
75
Statistical analyses
The effect of the individual parameters on the CDI and on the PD were analysed by a
parametric one-way analysis of variance (ANOVA) The variances were checked for
homogeneity by the Cochranacutes test Students-Newman-Keuls (SNK) test was used to
discriminate among different variables after significant F-test When data were not strictly
parametric Kruskal-Wallis test and Tukey-type multiple comparison test were used
The orthogonal design to determine the optimal conditions for PAH biodegradation is
an alternative to the full factorial test which is impractical when many factors are considered
simultaneously (Chen et al 2008) However the orthogonal test allows a much lower
combination of factors and levels to test the effect of interacting factors
Results and discussion
The consortium C2PL05 degrade phenanthrene pyrene and dibenfuran efficiently in 159 h
(Table 2) and also other PAH as naphthalene and anthracene (Molina et al 2009) The
study of the influence of each factor in the total PD (Figure 1) showed that only the carbon
source influenced in this parameter significantly (Table 3) Results concerning to carbon
source showed that PD were higher when PAH were added as only carbon source (100 of
PAH) The reason why the PD did not show statistical significance between treatments
except for the relative concentration of PAH-glucose may be due to significant changes
produced in PD at earlier times when PAH were still present in the cultivation media
However the carbon source incubation temperature and inoculum dilution were factors that
significantly influenced CDI (Table 3 Figure 2)
76
Table 2 Final percentage degradation of
phenanthrene (Phe) pyrene (pyr) and dibenzofuran
(Dib) and total percentage degradation (total PD) for
each treatment
percentage degradation Treatment Phe Pyr Dib Total PD
1 965 883 864 904 2 969 950 833 917 3 966 895 845 902 4 972 915 921 872 5 969 904 950 882 6 982 935 995 852 7 964 883 859 902 8 977 953 964 823 9 976 936 984 825 10 970 910 895 925 11 979 968 986 888 12 966 889 920 850 13 978 930 993 835 14 966 897 943 871 15 963 881 898 914 16 963 886 951 867 17 977 954 986 861 18 976 930 967 915
The conditions corresponding to listed treatments
are presented in Table 1
100
50
5
100
101
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
82
84
86
88
90
92 T (ordmC)
aa
a
aa
aa
aa
a
Tot
al P
D (
)
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
(SO
4)3
a
a
0acute05 0acute1
0acute2
Fe source
a
a
a
0 -
100
50 -
50
80 -
20
C Fe (mM)
a
b
c
CM
C
+ 2
0 C
MC
Gluc-PAHs
aa
10^-
1
10^-
2
10^-
3DilutionCMC
aa
a
Figure 1 Graphical analysis of average values of total percentage degradation (PD) under
different treatments and levels of the factors () represent the average of the total PD of the
treatments of each level Letters (a b and c) show differences between groups
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
77
Table 3 Analysis of variance (ANOVA) summary for the increments of cell density (CDI) and the total
percentage degradation (PD) of each factor MS is the mean of squares and df degrees of freedom
ANOVA of CDI ANOVA of total PD
Factor df MS F-value p-value df MS F-value p-value
T (ordmC) Error
2 056 1889 2 22 183 ns
51 002 51 12
Molar ratio CNP Error
2 003 069 ns 2 22 183 ns
51 005 51 12
N source Error
2 001 007 ns 2 214 177 ns 51 005 51 121
Fe source Error
2 003 066 ns 2 89 071 ns
51 005 51 126
Fe concentration Error
2 007 146 ns 2 118 095 ns 51 005 51 124
Glucose-PAH Error
2 024 584 2 1802
3085 51 004 51 395
8
CMC Error
1 001 027 ns 1 89 071 ns
52 005 52 125
Inoculum Dilutionb Error
2 331 a 2 113 091 ns 54 6614 51 125
a H-value obtained of Kruskal-Wallis test used for non parametric data Chi-square = 28 Overall
median = 044
p-value lt 001
p-value lt 0001
100
50
5
100
100
1
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
16
17
18
19
20
21
a
a
aa
a
aa
a
c
bCD
I
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
SO
4
Fe source
a
a
0acute05 0acute1
0acute2
C Fe (mM)
a
a
a
0-10
0
50-5
0
80-2
0
Gluc-PAH
a
b
c
CM
C
+ 2
0 C
MC
CMC
aa
10^-
1
10^-
2
10^-
3
00
05
10
15
20
25
30
35C
DI n
orm
aliz
ed
DilutionT (ordmC)
b
a
a
Figure 2 Graphical analysis of average values of cell density increments (CDI) and normalized cell
density increments (CDI normalized) of different treatments and levels of the factors () represent the
average of the CDI or CDI normalized of the treatments of each level Letters (a b and c) show
differences between groups
78
The temperature range considered in the present study might not affect the
biodegradation process since it is considered narrow by some authors (Wong et al 2000)
Nevertheless we observed significant differences in the process at different temperatures
showing an optimum at 25 ordmC for our microbial consortium growth (Figure 2) whereas when
consortium was incubated at 20 ordmC and 30 ordmC microorganisms remained in lag phase These
results were in agreement with the fact that respiration increases exponentially with
temperature (Q10 relationship) (Lloyd amp Taylor 1994) but increasing or decreasing
temperature beyond the optimal value will cause a reduction in microbial respiration We
suggest that moderate fluctuation of temperatures affect microbial growth rate but not
degradation rates because degrading population is able to degrade PAH efficiently in a
temperature range between 20-30 ordmC (Sartoros et al 2005)
The nutrient requirements for microorganisms increase during the biodegradation
process so a low CNP molar ratio can result in a reduced of the metabolic activity of the
degrader microorganisms and thus reduce their potential degrader (Leys et al 2004)
According to this author CNP ratios above 100101 provide enough nutrients to metabolize
the pollutants However our results showed that the CNP ratios supplied to the cultures
even the ratio 100505 did not affect the CDI and total PD This results indicate that the
consortium C2PL05 is able to degrade PAH even under low nutrients conditions due to its
high adaptation to the hard conditions of a chronically contaminated soil The results
concerning the addition of different nitrogen and iron sources did not show significant
difference in CDI and total PD Other works (Schelessinger 1991 Santos et al 2008) have
suggested that the addition of nitrogen in form of nitrates (Schelessinger 1991) and the iron
in form of sulphates or chlorides (Santos et al 2008) is more effective due to their high
solubility
The addition of readily biodegradable carbon source as glucose to a polluted
environment is considered an alternative to promote biodegradation The easy assimilation of
this compound result in an increase in total biomass (heterotrophic and PAH degrader
microorganisms) of the microbial population thereby increasing the degradation capacity of
the community Piruvate are a carbon source that promote the growth of certain degrading
strains as Pseudomonas putida (Lee et al 2003) whereas salicylate induces the synthesis
and activation of degradative enzymes (Chen amp Aitken 1999) Similarly to previous results
observed by Wong et al (2000) in the present study the addition of glucose to the cultures
had significant effects in total PD and CDI (Figure 1 Figure 2) Although the consortium
C2PL05 showed a significantly better growth with 80 of glucose the difference between
treatments (0100 5050 8020 of glucosePAH) showed that PD was higher when PAH
were added as only carbon source Previously it has been described that after a change in
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
79
the type of carbon source supplied to PAH-degrader microorganisms an adaptation period
for the enzymatic system was required reducing the mineralization rate of pollutants (Wong
et al 2000 Maier 2009 Simarro et al 2010) As glucose was added as additional carbon
source our results show an increase in CDI although the PD values decrease significantly
This indicated that glucose enhance the overall growth of consortium but decrease the
biodegradation rate of PAH-degrader population due to the adaptation of the corresponding
enzymatic system So in this case the addition of a readily carbon source retards the
biodegradation process The addition of surfactant to the culture media at concentration
above their CMC is essential to increase PAH degradation rate (Pantsyrnaya et al 2011)
However Yuan et al (2000) reported negative effects when the surfactant was added at
concentration above the CMC because the excess of micelles around PAH reduces their
bioavailability (Mulligan et al 2001) However our results showed that PD and CDI were not
affected by concentrations largely beyond the CMC Some non biodegradable surfactants
can be toxic to bacteria and therefore do not improve the biodegradation process (Bautista et
al 2009) Tween-80 was the optimal surfactant for the strains of the consortium C2PL05
(Bautista et al 2009) However the optimal type of surfactant is determined by the type of
degrading strains involved in the process (Bautista et al 2009) In addition it is important to
consider the possible use of surfactant as a carbon source by the strains preferentially to
PAHs which would reduce the rates of biodegradation (Kim amp Weber 2003)
Further dilution of the inoculum represents the elimination of minority species which
could result in a decrease in the degradation ability of the consortium if the eliminated
species represented an important role in the biodegradation process (Szaboacute et al 2007)
Our results concerning the inoculum concentration showed that this factor significantly
influenced in CDI but had no effect on total PD indicating that the degrading ability of the
consortium has not been altered by the dilution of the same In Gonzalez et al (2011) the
evolution and bacterial succession of the consortium C2PL05 by culture-dependent
techniques are described All of these identified strains were efficient in degradation of PAH
(Bautista et al 2009) but Enterobacter sp was dominant at the beginning of the degradation
process whereas Stenotrophomonas sp and Pseudomonas sp were less abundant In
addition DGGE fingerprint pattern studied and described in Molina et al (2009) showed a
low microbial diversity of the consortium C2PL05 typical of an enriched consortium from
chronically contaminated soil (Vintildeas et al 2005) The results present in this work suggest
that in cultures inoculated with the highest dilution of the consortium (10-3) the less abundant
microorganisms were eliminated reducing the competition for the dominant species which
can grow vigorously
80
The influence of some environmental factors on the biodegradation of PAH can
undermine the effectiveness of the process In this study the combination of all factors
simultaneously by an orthogonal design has allowed to establish considering the interactions
between them the most influential parameters in biodegradation process Finally we
conclude that the only determining factor in biodegradation by consortium C2PL05 is the
carbon source Although cell growth is affected by temperature carbon source and inoculum
dilution these factors not condition the effectiveness of degradation Therefore the optimal
condition for a more efficient degradation by consortium C2PL05 is that the carbon source is
only PAH
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Maacutester en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
81
References
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Boochan S Britz ML amp Stanley GA 1998 Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophila
Biotechnol Bioeng 59 482-494
Chen S-H amp Aitken MD 1999 Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
EnvironSci Technol 33 435ndash439
Chen J Wong MH Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAHs) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in Artic Tundra soil Appl EnvironMicrobiol 67 5107-
5112
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438-9446
Heitkamp MA amp Cerniglia CE 1998 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from Sediment below an oil field Appl EnvironMicrobiol 54
1612-1614
Jin D Jiang X Jing X amp Ou Z 2007 Effects of concenrtration head group and structure of
surfactants on the biodegradation of phenanthrene J Hazard Mater 144 215-221
Kim HS amp Weber WJ 2003 Preferential surfactant utilization by a PAH-degrading strain
effects on micellar solubilization phenomena Environ Sci Technol 37 3574-3580
Laha S amp Luthy RG 1992 Effect of non-ionic surfactants on the solubilization and
mineralization of phenanthrene in soil-water systems Biotechnol Bioeng 40 1367-
1380
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegradation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Leys MN Bastiaens L Verstraete W amp Springael D 2004 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Lloyd J amp Taylor JA 1994 On the temperature dependence of soil respiration Funct Ecol
8 315-323
82
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mulligan CN Young RN amp Gibbs BF 2001 Surfactant enhanced remediation of
contaminated soil a review Eng Geol 60 371-380
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Molecular microbial ecology manual
(Eds Akkermans ADL van Elsas JD Bruijn FJ) Kluwer Academic Publishers
Dordrecht pp 1-23
Pantsyrnaya T Blanchard F Delaunay S Georgen JL Geacuteudon E Guseva E amp Boudrant
J 2011 Effect of surfactants dispersion and temperature on solubility and
biodegradation of phenanthrene in aqueous media Chemosphere 83 29-33
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation and surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Sartoros C Yerushalmi L Beroacuten L amp Guiot S 2005 Effects of surfactant and temperature
on biotransformation kinetics of anthracene and pyrene Chemistry 61 1042-1050
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Sudipt KS Om VS amp Rakesh KJ 2002 Polycyclic aromatic hydrocarbons environmental
pollution and bioremediation Trends Biotechnol 20 243ndash248
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquatic Microbl Ecol 47 1-10
Thibault SL Anderson M amp Frankenberger WTJr 1996 Influence of surfactant on pyrene
desorption and degradation in soils Appl Environ Microbiol 62 283-287
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Poll 139 1-13
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
83
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon degrading bacteria by most-probably-number (MPN) Can J Microbiol
4 252-258
Yuan SY Wei SH amp Chang BV 2000 Biodegradation of polycyclic aromatic
hydrocarbons by a mixed culture Chemosphere 41 1463-1468
Capiacutetulo
Publicado en Bioresource Technology (2011) 102 9438-9446
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA
Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process
Efecto de los surfactantes en la biodegradacioacuten de HAP por un consorcio bacteriano y dinaacutemica de la comunidad
bacteriana durante el proceso
2
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
87
Abstract
The aim of this work was to evaluate the effect of a non-biodegradable (Tergitol NP-10) and
a biodegradable (Tween-80) surfactant on growth degradation rate and microbial dynamics
of a polycyclic aromatic hydrocarbon (PAHs) degrading consortium (C2PL05) from a
petroleum polluted soil applying cultivable and non cultivable techniques Growth and
degradation rate were significantly lower with Tergitol NP-10 than that with Tween-80
Toxicity did not show any significant reduction with Tergitol NP-10 whereas with Tween-80
toxicity was almost depleted (30) after 40 days Regarding to the cultured bacteria
Pseudomonas and Stenotrophomonas groups were dominant during PAH degradation with
Tergitol NP-10 whereas Enterobacter and Stenotrophomonas were dominant with Tween-80
DGGE analyses (PRIMER and MDS) showed that bacteria composition was more similar
between treatments when PAHs were consumed than when PAHs concentration was still
high Community changes between treatments were a consequence of Pseudomonas sp
Sphingomonas sp Sphingobium sp and Agromonas sp
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
89
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic pollutants composed of two
or more fused aromatic rings produced by natural and anthropogenic sources Besides
being toxic carcinogenic and mutagenic compounds the semi-volatile properties of some
PAH make them highly mobile throughout the environment (air soil and water) In addition
PAH have a high trophic transfer and biomagnification within the ecosystems due to the
lipophilic nature and the low water solubility that decreases with molecular weight (Clements
et al 1994) The importance of preventing PAH contamination and the need to remove PAH
from the environment has been recognized institutionally by the Unites States Environmental
Protection Agency (US-EPA) which has proposed 16 PAH as priority pollutants including
naphthalene phenanthrene and anthracene Currently governmental agencies scientist and
engineers have focused their efforts to identify the best methods to remove transform or
isolate these pollutants through a variety of physical chemical and biological processes
Most of these techniques involve expensive manipulation of the pollutant transferring the
problem from one site or phase to another (ie to the atmosphere in the case of cremation)
(Haritash amp Kausshik 2009) However microbial degradation is one of the most important
processes that PAH may undergo compared to others such as photolysis and volatilization
Therefore bioremediation can be an important alternative to transform PAH to less or not
hazardous forms with less input of chemicals energy and time (Haritash amp Kaushik 2009)
Most of the contaminated sites are characterized by the presence of complex mixtures
of pollutants Microorganisms are very sensitive to low concentrations of contaminants and
respond rapidly to environment perturbations (Andreoni et al 2004) Therefore microbial
communities chronically exposed to PAH tend to be dominated by those organisms capable
of use PAH as carbon and energy source (Gallego et al 2007) Even in areas previously
unpolluted there is a proportion of microbial community composed by PAH degrading
bacteria able to degrade PAH (Surridge et al 2009) These microbial communities subjected
to a polluted stress tend to be less diverse depending on the complexity of the composition
and the time of exposure (MacNaughton et al 1999) The biodegradation of hazardous
compounds by bacteria fungi and algae has been widely studied and the success of the
process will be due in part to the ability of the microbes to degrade all the complex pollutant
mixture However most of the PAH degradation studies reported in the literature have used
versatile single strains or have constructed an artificial microbial consortium showing ability
to grow with PAH as only carbon source by mixing together several known strains (Ghazali et
al 2004) Nevertheless pure cultures and synthetic microbial consortia do not represent the
natural behaviour of microbes in the environment since the cooperation among the new
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
90
species is altered In addition changes in microbial communities during pollutant
biotransformation processes are still not deeply studied Microbial diversity in soil
ecosystems can reach values up to 10 billion microorganisms per gram and possibly
thousands of different species although less than 10 can be culturables (Torsvik amp Ovreas
2002) Therefore additional information on biodiversity ecology dynamics and richness of
the degrading microbial community can be obtained by non-culturable techniques such as
DGGE In addition small bacteria cells are not culturable whereas large cells are supposed
to account 80 of the total bacterial volume (Nannipieri et al 2003) Therefore despite their
low proportion culturable bacteria can provide essential information about the structure and
functioning of the microbial communities With the view focused on the final bioremediation
culture-dependent techniques are necessary to obtain microorganisms with the desired
catabolic traits for bioaugmentation processes in polluted soils The PAH degradation is
limited by their low aqueous solubility but surfactants which are amphypatic molecules
enhance the solubility of hydrophobic compounds (Kolomytseva et al 2009) Previous works
(Bautista et al 2009) have shown that efficiency of a consortium named C2PL05 composed
by PAH degrading bacteria was significantly higher using surfactants
One of the main goals of the current work was to understand if culturable and non
culturable techniques are complementary to cover the full richness of a soil microbial
consortium A second purpose of the study was to describe the effect of different surfactants
(biodegradable and non-biodegradable) on growth rate PAH degradation rate and toxicity
reduction of a bacterial consortium (C2PL05) The microbial consortium C2PL05 was
isolated from a soil chronically exposed to petroleum products collected from a
petrochemical complex Finally the work is also aimed to describe the microbial dynamics
along the biodegradation process as a function of the surfactant used to increase the
bioavailability of the PAH
Material and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all 99 purity) were purchased from Sigmandash
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) Reagent grade
dichloromethane and n-hexane were supplied by Scharlau Chemie (Barcelona Spain)
Surfactants (Tween-80 and Tergitol NP-10) used were supplied by Sigma-Aldrich (Steinheim
Alemania) Bushnell-Haas Broth medium (BHB) was purchased from Panreac (Barcelona
Spain) and its composition is 02 g l-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 10 gmiddotl-1 KHPO4
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
91
10 gmiddotl-1 K2HPO4 10 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 Luria-Bertani media (LB) glucose and
phosphate buffer saline (PBS) were purchased from Panreac (Barcelona Spain)
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1 g of sieved soil (lt2 mm) was resuspended in
10 ml of PBS and incubated during 12 h in an orbital shaker (Innova 40 New Brunswick
Scientific Edison NJ USA) at 150 rpm and 25 ordmC under dark conditions After that 15 ml of
the supernatant was inoculated in 50 ml of BHB broth (pH 70) containing 1 wt Tween-80
as surfactant and naphthalene phenanthrene and anthracene (each at 250 mg l-1) as carbon
source Then the culture was incubated at 150 rpm and 25 ordmC under dark conditions until the
exponential phase was completed This was confirmed by monitoring the cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK) Then the consortium was stored at 4 ordmC to
stop growth At the beginning of each experiment 500 μl of the stored consortium (asymp 16 AU)
was inoculated in Erlenmeyer flasks
Experimental design and treatments conditions
To evaluate the influence of Tween-80 and Tergitol NP-10 (biodegradable and non-
biodegradable surfactant respectively) on the degrading capacity of the consortium C2PL05
as well as the evolution of its microbial community two different treatments each in triplicate
were carried out The replicates were performed in 100 ml Erlenmeyer flasks with 50 ml of
BHB medium (pH 70) Tween-80 or Tergitol NP-10 as surfactants (1 vv) a mixture of
naphthalene phenanthrene and anthracene in n-hexane (final concentration 500 mgmiddotl-1) and
500 microl of the C2PL05 consortium (88middot108 heterotrophic cellsmiddotml-1 and 44middot107 PAH degrading
cellsmiddotml-1 for the treatments with Tween-80 73middot105 heterotrophic cellsmiddotml-1 and 24middot103 PAH
degrading cellsmiddotml-1 for treatment with Tergitol NP-10) The replicates were incubated in an
orbital shaker (Innova 40) at 150 rpm and 25 ordmC under dark conditions during 45 days
Previously to inoculate the consortium the Erlenmeyer flasks were shaked overnight to
reach the solubility equilibrium of PAH and to allow the complete evaporation of n-hexane
Samples vigorously shaking to ensure homogeneity were withdrawn twice a day for 45 days
except for the initial 24 hours where the sampling frequency was higher Cell growth PAH
(soluble and precipitated) toxicity and number of heterotrophic and PAH degrading cells
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
92
were measures in all samples To study the dynamic of the microbial consortium through
cultivable and non-cultivable methods samples were withdrawn at 0 15 and 30 days
Bacterial growth MPN and toxicity assays
Bacterial growth was monitored by changes in the absorbance of the culture media at 600
nm using a Spectronic Genesys spectrophotometer According to the Monod equation
(Equation 1) the specific growth rate micro is essentially equal to micromax when substrate limitation
is avoided
SK
S
S
max
(Equation 1)
Therefore from the above optical density data the maximum specific growth rate (micromax)
was estimated as the logarithmized slope of the exponential phase applying the following
equation (Equation 2)
Xdt
dX (Equation 2)
where micromax is the maximum specific growth rate Ks is the half-saturation constant S
is the substrate concentration X is the cell density t is time and micro is the specific
growth rate In order to evaluate the ability of the consortium to growth with
surfactants as only carbon source two parallel treatments were carried out at the
same conditions than the two treatments above described but in absence of PAH
Heterotrophic and PAH-degrading population from the consortium C2PL05 were
enumerated during the PAH degrading process comparing the effect of Tergitol NP-10 and
Tween-80 as surfactants The estimation was performed by using a miniaturized MPN
technique in 96-well microtiter plates with eight replicate wells per dilution Total
heterotrophic microbial population was enumerated in 180 μl of Luria Bertani (LB) medium
with glucose (15 gmiddotl-1) and 20 microl of the microbial consortium PHA-degrading population were
counted in BHB medium (180 microl including the surfactant) 20 microl of a mixture of phenanthrene
anthracene and naphthalene in hexane (each at a final concentration of 500 mgmiddotl-1) and 20 microl
of the microbial consortium in each well The MPN scores were transformed into density
estimates accounting for their corresponding dilution factors
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
93
The toxicity was monitored during PAH degradation and estimations were carried out
using the Microtox assay with the bioluminescent bacterium Vibrio fischeri Three controls
considered as 0 inhibition were prepared with the photobacterium and 2 NaCl (vv) and
three blanks as 100 inhibition containing only 2 NaCl (vv) Samples were salted with
NaCl (2 vv final concentration) and the toxicity was expressed as the percentage of the V
fischeri inhibition after 15 min of incubation at 15 ordmC To study the toxicity of the medium
caused by PAH when the surfactants were not added toxicity evolution was measured from
a treatment with PAH as carbon source and degrading consortia but without surfactant under
same conditions previously described
PAH monitoring
In order to compare the effect of the surfactant on the PAH depletion rate naphthalene
phenanthrene and anthracene concentrations in the culture media were analysed using a
reversed-phase C18 column (Luna C18(2) 75 cm length x 46 mm ID 3 microm particle size
Phenomenex Torrance CA USA) following the method described elsewhere (Bautista et
al 2009) The concentration of each PAH was calculated from a standard curve based on
peak area at 254 nm The apparent first-order kinetic constant (kB) due to biotic processes
was calculated by applying Equation 3
iBiiAii
i CkCkdt
dCr (Equation 3)
where C is the PAH concentration kA is the apparent first-order kinetic constant due to
abiotic processes kB is the apparent first-order kinetic constant due to biological
processes t is the time elapsed and the subscript i corresponds to each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40) at 150 rpm and 25ordmC under dark
conditions PAH concentration in the control experiments were analyzed using the HPLC
system described previously The values of kA for each PAH were calculated by applying Eq
2 considering kB asymp 0 since no bacterial consortium was inoculated The amount of
precipitated and bioadsorbed PAH was measured after centrifugation of the samples Then
dichloromethane was added to the pellet and this extraction was repeated three times and
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
94
the fractions pooled The solvent was evaporated using a nitrogen flow and the extract was
dissolved into a known volume of acetonitrile for HPLC analysis
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
Samples from cultures of the bacterial consortium C2PL05 during the PAH degrading
process were collected to identify the effect of the surfactants (Tergitol NP-10 and Tween-80)
To get about 20-30 colonies isolated at each collecting time samples of each treatment were
streaked onto Petri plates with BHB medium and purified agar and were sprayed with a
mixture of naphthalene phenanthrene and anthracene in n-hexane (final concentration 500
mgl-1) as carbon source The Petri plates were incubated at 25 ordmC under dark conditions
The isolated colonies were transferred onto LB agar-glucose plates in order to increase
microbial biomass for DNA extraction and stored in 50 glycerol (vv) at -80 ordmC In total 91
degrading colonies from the treatment with Tween-80 and 83 degrading colonies from the
treatment with Tergitol NP-10 were isolated
Total DNA was extracted using Microbial DNA isolation kit (MoBio Laboratories
Solano Beach CA USA) to perform the molecular identification of the PAH-degrader
isolated cultured (DIC) Amplification of the 16S rRNA coding region of the DNA was
performed as described by Vintildeas et al (2005) using the primers 16F27 (5rsquo-
AGAGTTTGATCMTGGCTCAG-3rsquo) and 16R1488 (5rsquo-TTACCTTGTTACGACTTCAGG-3rsquo) and
sequenced using the same primers Sequences were edited and assembled using
ChromasPro software version 142 (Technelysium Pty Ltd Tewantin Australia)
All of the 16S rRNA gene sequences were edited and assembled by using BioEdit
software version 487 BLAST search (Madden et al 1996) was used to find nearly identical
sequences for the 16S rRNA sequences determined Sequences were aligned using the Q-
INS-i algorithm (Katoh amp Toh 2008) of the multiple sequence alignment software MAFFT
version 6611 aligning sequences in a single step Sequence data obtained and 34
sequences downloaded from GenBank were used to perform the phylogenetic trees
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates by using PAUP
version 40B10 Maximum parsimony (MP) was also analyzed using PAUP 40B10 as is
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
95
described in Molina et al (2009) Sequences of Aquifex piruphilus were used as out-group
according to previous phylogenetic affiliations (Vintildeas et al 2005)
Denaturing gradient gel electrophoresis from microbial consortium during PAH degrading
process
Non culture dependent molecular techniques such as denaturing gradient gel
electrophoresis (DGGE) were performed to know the effect of the surfactant on the total
biodiversity of the microbial consortium C2PL05 during the PAH degradation process and
compared with the initial composition of the consortium The V3 to V5 variable regions of the
16S rRNA gene were amplified using the primers set 16S 518F and 16S 338R-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primers 338R-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded onto a 10
(wtvol) polyacrilamide gels that was 075 mm tick with a denaturing gradient of 35-65
(100 denaturant contained 7 M urea and 40 formamide) DGGE was performed in 1xTAE
buffer (20 M Tris-acetate 100 mM Na2EDTA pH 74) using a DGGE 2401 system (CBS
Scientific Co Del Mar CA USA) at 80 V and 60 ordmC for 16 h Gels were stained for 45 min in
1xTAE buffer containing Syber-Gold (500 μlmiddotl-1) and viewed under UV light Predominant
bands in DGGE gel were excised with a sterile razor blade and diluted in 50 μl of deionized
water overnight at 4ordmC Due to impossibility of reamplified bands DNA of the bands was
cloned in the pGEM-T Easy Vector (Promega Madison WI) Sequence of this PAH-degrader
uncultured bacterium (DUB) were edited and assembled as described above and included in
the matrix to perform the phylogenetic tree as described previously using the identification
code DUB
Statistical analyses
The maximum specific growth rate (micromax) and the kinetic constant of PAH biodegradation (kB)
were evaluated by both one and two-way analysis of variance (ANOVA) using Statistica 60
software (Statsoft Inc Tulsa OK USA) to determine differences between PAH (naphthalene
phenanthrene and anthracene) and surfactants (Tween-80 and Tergitol NP-10) Prior to
analyses Cochranrsquos C-test was used to check the assumption of homogeneity of variances
Student-Newman-Keuls test (SNK) was used to discriminate among different treatments after
significant F-test Differences in microbial assemblages were graphically evaluated for each
factor combination (surfactant and time) with non-metric multidimensional scaling (MDS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
96
using PRIMER software SIMPER method was used to identify the percent contribution of
each band to the dissimilarity or similarity in microbial assemblages between and within
combination of factors Based on Viejo (2009) bands were considered ldquohighly influentialrdquo if
they contributed to the first 70 of cumulative percentage of average dissimilaritysimilarity
betweenwithin combination of factors
Results and discussion
Bacterial growth and toxicity media during biodegradation of PAH
Since some surfactants can be used as carbon sources cell growth of the consortium was
measured with surfactant and PAH and only with surfactant without PAH to test the ability of
consortium to degrade and grow with both surfactants (Figure 1A) The microbial consortium
C2PL05 growth was significantly lower with Tergitol NP-10 than that reached with Tween-80
which showed the best cell growth with a maximum density (Figure 1A) In addition the
growth curve with PAH and Tergitol NP-10 showed a longer latent phase (36 hours) than
with PAH and Tween-80 (lt 12 hours) The specific growth rate (micromax) of the consortium
C2PL05 was significantly higher (Table 1A) with Tween-80 than that with Tergitol NP-10 The
results showed that Tween-80 was biodegradable for consortium C2PL05 since that
surfactant was used as the only carbon source (Figure 1A) Finally when using Tergitol NP-
10 as the only carbon source growth was not observed so that this surfactant was not
considered biodegradable for the consortium
Toxicity test (bioluminescence inhibition in Vibrio fischeri) indicates that high values
observed during the PAH degrading process with Tergitol NP-10 is caused at the initial time
by both PAH and surfactant (Figure 1B) However when PAH are totally consumed (40-45
days) toxicity still remained high and constant which means that toxicity is only due to the
Tergitol NP-10 (Figure 1B) The toxicity of PAH + biodegradable surfactant (Tween-80)
treatment decreased as the PAH and the surfactant were consumed and was almost
depleted (30) after 40 days of cultivation The toxicity showed a slight increment at the
beginning of the degradation process (Figure 1B) as a consequence of the potential
accumulation of intermediate PAH degradation products (Molina et al 2009)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
97
00
02
04
06
08
10
12
14
16
18
0 5 10 15 20 25 30 35 40 45
30
40
50
60
70
80
90
100
Tox
icity
(
)
Time (day)
B
A
Abs
orba
nce 60
0 nm
(A
U)
Figure 1 (A) Cell density of the consortium C2PL05 with PAH and Tween-80 () with
Tween-80 () with PAH and Tergitol NP-10() and with Tergitol NP-10 () (B)
Toxicity of the cultivation media during degradation of PAH by the consortium C2PL05
grown with Tween-80 () Tergitol NP-10 () and of the control experiment PAHs
without surfactants ()
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
98
The residual total concentration of three PAH of the treatments with surfactants and
the treatments without any surfactants added is shown in Figure 2 The consortium was not
able to consume the PAH when surfactants were not added PAH biodegradation by the
consortium C2PL05 was higher and faster (15 days) with Tween-80 than with Tergitol NP-10
(40 days) In all cases when surfactant was used no significant amount of PAH were
detected in precipitated or bioadsorbed form at the end of each experiment which means
that all final residual PAHs were soluble
0 5 10 15 20 25 30 35 40 45
0
10
20
30
40
50
60
70
80
90
100
Res
idua
l con
cent
ratio
n of
PA
Hs
()
Time (days)
Figure 2 Residual total PAH concentration (wt) in the treatment with Tween-80
() Tergitol NP-10 () and without surfactant ()
According to previous works (Bautista et al 2009 Molina et al 2009) these results
confirm that this consortium is adapted to grow with PAH as only carbon source and can
degrade PAH efficiently when surfactant is added According to control experiments (PAH
without consortium C2PL05) phenathrene and anthracene concentration was not affected by
any abiotic process (kA asymp 0 h-1) in the case of naphthalene some degree of abiotic depletion
was measured during the controls yielding an apparent first-order abiotic rate constant of
27middot10-3 plusmn 7middot10-5 h-1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the treatments so this not influence in the high
biodegradation rate of naphthalene for Tween-80 treatments The biotic depletion rate (kB) of
the three PAH was significantly higher for Tween-80 than that calculated for Tergitol NP-10
(Table 1B) There were no significant differences between PAH for Tergitol NP-10 (2 x 10-3 plusmn
4 x 10-4) whereas in the case of Tween-80 the value of kB for naphthalene (3 x 10-2 plusmn 6 x 10-4)
was higher than that for phenanthrene and anthracene (1 x 10-2 plusmn 4 x 10-4)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
99
Table 1 Analysis of variance (ANOVA) for the effects of surfactants on the specific
growth rate micromax (A) and for the effects of the surfactants and PAH on the biotic
degradation rate kB (B) of the C2PL05 consortium SS is the sum of squares and df
the degrees of freedom
Effect (A) SS df F-value p-value
Surfactant 16 1 782 0001
Error 0021 2
Effect (B) SS df F-value p-value
PAH 15middot10-4 2 779 0001
Surfactant 82middot10-4 1 4042 0001
PAH x Surfactant 12middot10-4 2 624 0001
Error 203middot10-7 12
Molecular characterization of the cultured bacteria of the consortium C2PL05 and dynamics
during the PAH degradation
The identification of cultured microorganisms and their phylogenetic relationships are keys to
understand the biodegradation and ecological processes in the microbial consortia From the
consortium C2PL05 grown with Tween-80 91 strains were isolated and sequenced From
them 7 different genotypes of PAH-degrading cultures (DIC-1 JA DIC-2 JA DIC-5 JA DIC-6
JA DIC-7 JA DIC-8JA and DIC-9JA) were identified by 16S rRNA For the treatment with
Tergitol NP-10 83 strains were isolated and sequenced and 6 different genotypes were
identified (DIC-1 RS DIC-2 RS DIC-3 RS DIC-4 RS DIC-5 RS and DIC-6 JA) One of the
isolated cultures from Tergitol NP-10 showed an identical sequence to one of the strains
grown with Tween-80 therefore the previous code (DIC-6JA) was kept Table 2 show a
summary of the PAH-degrader cultures identification The aligned matrix contained 1576
unambiguous nucleotide position characters with 424 parsimony-informative Parsimony
analysis of the data matrix yielded 10 parsimonious trees with CI = 0609 and RI = 0873 In
the parsimonic consensus tree 758 of the clades were strongly supported by boostrap
values higher or equal to 70 (Figure 3) All cultivable strains identified were γ-
proteobacteria (gram-negative) and were located in three clades Pseudomonas clade
Enterobacter clade and Stenotrophomonas clade These results are consistent with those of
Vintildeas et al (2005) who observed a strong dominance of gram negative bacteria in PAH
contaminated soil during the bioremediation process In Pseudomonas clade (Figure 3) DIC
are located in three clearly groups So DIC-2RS and DIC-3RS were grouped with P
frederiksbergensis which has been previously described in polluted soils (ie Holtze et al
2006) showing ability to reduce the oxidative stress generated during the PAH degrading
process DIC-1JA DIC-2JA (Tween-80) and DIC-1RS (Tergitol NP-10) were nested in very
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
100
solid group characterized by the presence of the type strain P koreensis previously studied
as an agricultural soil species (Kwon et al 2003) and DIC-5RS was located in P putida
group well known by their capacity to degrade high molecular weight PAH (Samantha et al
2002) to produce surfactants (Kruijt et al 2009) and to resist high temperature and salinity
(Egamberdieva amp Kucharova 2009) So several species of Pseudomonas (ie P putida P
fluorescens) have been widely studied in bioremediation (Molina et al 2009) and the present
results confirmed that it was the most representative group with the non biodegraded
surfactant treatment DIC-7JA DIC-8JA and DIC-9JA (Tween-80) which were identified as E
cloacae (Table 2) belonged to the Enterobacter clade with a strongly statistic support (Figure
3) In this clade DIC-4RS (Tergitol NP-10) is genetically related with E ludwigii which has
been recently described as relevant medical species (Hoffman et al 2005) but completely
unknown his PAH degrading capacity Enterobacter genus has been traditionally studied by
its animal gut symbiotic function but rarely recognized as a soil PAH degrading group
(Toledo et al 2006) In this phylogenetic tree E cloacae and E ludwiggi were not resolved
This result is according to Roggenkamp (2007) who consider necessary to use more
molecular markers within Enterobacter taxonomical group in order to contrast the
phylogenetic relationships In addition Enterobacter genera may not be a monophyletic
group (Kampfer et al 2005) Therefore more phylogenetic studies need to be done to clarify
the species concept within this group Finally DIC-5JA (Tween-80) and DIC-6JA isolated
from experiments using both surfactants (Tween-80 and Tergitol NP) are clearly belong to
type strain Stenotrophomonas clade genetically close to S maltophiliaT (Table 2) which has
been described as PAH-degrader (Zocca et al 2004)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
101
Figure 3 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) from the consortium C2PL05 with Tergitol NP (DIC-1JA ndash DIC-9JA)
and Tween-80 (DIC-1RS ndash DIC-5RS) and PAH-degrader uncultured bacteria (DUB) obtained from
DGGE of the consortium with both surfactant at 0 15 and 30 days of the process Boostrap values of
neighbourjoining and parsimonus higher than 50 are showed on the branch of the tree (NJMP) No
incongruence between parsimony and neighbour joining topology were detected Pseudomonas
genus has been designated as P Pantoea genus as Pa Sphingobium as S and Sphingomonas as
Sp Xantomonas as X and Xyxella as Xy T= type strain
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
102
Table 2 Bacteria identification and percentage of similarity from the GenBank data base Degrading
uncultured bacteria (DUB) form DGGE bands and degrading isolates cultured (DIC)
Colonies identified by cultivable techniques
DIC simil Mayor relationship with bacteria
of GenBank(acc No) Phylogenetic group
DIC-1RSb 980 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ)
DIC-2RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-3RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-4RS b 990 Enterobacter ludwigii (AJ853891) Enterobacter cloacae (EU733519)
Enterobacteriaceae (γ)
DIC-5RS b 990 Pseudomonas putida (EU046322) Pseudomonadaceae (γ) DIC-6JA-6RS c 1000 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-1JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-2JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-5JA a 9964 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-7JA a 9985 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-8JA a 9993 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-9JA a 100 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ)
Identification by non-cultivable techniques
DUB Band
simil Mayor relationship with bacteria
of GenBank (acc No) Phylogenetic group
DUB-1RS a 1 970 Uncultured Nitrobacteria sp (AM990004) Caulobacteraceae (α) DUB-2RS b 21 980 Bradyrhizobium sp (HQ171485) Bradyrhizobiaceae (α) DUB-3RS b 24 940 Uncultured bacterium (AY939443) -- DUB-4RS b 24 100 Uncultured Pseudomonas sp (HM561497) Pseudomonadaceae (γ) DUB-10RSb 28 980 Uncultured Sphingomonas sp (HM438638) Sphingomonadaceae(α) DUB-11RSa 28 960 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-6RS b 29 980 Pseudomonas stutzeri (HQ130335) Pseudomonadaceae (γ) DUB-8RS b 29 980 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-5RS b 29 990 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-7RS b 29 980 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-9RS b 30 970 Bacterium (AJ295668) --
a DIC or DUB belonging to treatments with Tween-80 b DIC or DUB belonging to treatments with Tergitol NP-10 c DIC or DUB belonging to treatments with Tween-80 and Tergitol NP-10
With respect to the dynamics of the microorganisms isolated from the microbial
consortium C2PL05 (Figure 4) Pseudomonas (DIC-1RS DIC-2RS and DIC-5RS Figure 4A
4B) with a percentage around 60 and Stenotrophomonas (only DIC-6JA Figure 4A and
4D) with presence of 90 were dominant groups during the PAH degrading process with
Tergitol NP-10 at 0 and 30 days in the case of Pseudomonas and at 15 days in the case of
Stenothrophomonas Enterobacter (DIC-4RS Figure 4A 4D) only was present at the end of
the process with a percentage around 40 With Tergitol NP-10 Pseudomonas sp group
was dominant coincident with the highest relative contribution of PAH degrading bacteria to
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
103
total heterotrophic bacteria at the beginning (33 of contribution) and at the end of the
degradation process (41) However Enterobacter (DIC-7JA DIC-8JA and DIC-9JA Figure
4E and 4H) with a maximum presence of 98 at 0 days and Stenotrophomonas (DIC-6JA
Figure 4E and 4G) with a maximum presence of 85 at the end of the process were
dominant with the biodegradable Tween-80 Thus Enterobacter sp seems to start the PAH
degradation process and Stenotrophomonas to finish it but at 15 days three groups coexist
within a contribution ranging 20 to 50 (Figure 4E) Therefore in agreement with other
authors (Colores et al 2000) the results of the present work confirm changes in the
bacterial (cultured and non-cultured) consortium succession during the PAH degrading
process driven by surfactant effects According to Allen et al (1999) the diversity of the
bacteria cellular walls may explain the different tolerance to grow depending on the
surfactant used Previous works (Piskonen amp Itaumlvaara 2004) have shown the capacity of
some bacteria to use both surfactants (Tergitol NP-10 and Tween-80) as carbon sources
However in agreement with recent studies (Bautista et al 2009) the present work confirms
that Tergitol NP-10 is not degradable by the consortium C2PL05 These results showed a
drastic change of the consortium composition after the addition of surfactant
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
104
0 15 30
0102030405060708090
100
102030405060708090
100
D
C
B
A
0 15 30
F DIC-1JA DIC-2JA
E
G DIC-6JA DIC-5JA
0 15 30
H
Time (day)
DIC-7JA DIC-8JA DIC-9JA
Pse
udom
onas
ribot
ypes
(
)
DIC-1RS DIC-2RS DIC-3RS DIC-5RS
102030405060708090
100
Ste
notr
opho
mon
as
ribot
ypes
(
)
DIC-6JA
0 15 30
102030405060708090
100
Ent
erob
acte
r rib
otyp
es (
)
DIC-4RS
Time (days)
Tot
al s
trai
ns (
)
Figure 4 (A) Dynamics of the microbial consortium C2PL05 during PAH degradation process with
Tergitol NP-10 and (E) with Tween-80 as surfactants Isolated and identified genus were
Pseudomonas () Stenotrophomonas () and Enterobacter () Dynamics and succession of
the (B) Pseudomonas (C) Stenotrophomonas and (D) Enterobacter ribotypes with Tergitol NP-10
as surfactant Dynamics and succession of the (F) Pseudomonas (G) Stenotrophomonas and (H)
Enterobacter ribotypes
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
105
Biodiversity and evolution of the non-cultivable bacteria of the consortium during PAH
degradation
The most influential DGGE bands to similarity 70 of contribution according to the results of
PRIMER analyses were cloned and identified allowing to know the bands and species
responsible of similarities and dissimilarities SIMPER procedure (Clarke 1993) was used to
identify the percentage contribution () that each band made to the measures of the Bray-
Curtis similarity between treatments at each surfactant (Tween-80 and Tergitol-NP) and time
(initial time after 15 and 30 days) Bands were selected as lsquoimportantrsquo to be identified if they
contributed to the first 70 of cumulative percentage of average similarity between
treatments Summary of the identification process are shown in Table 2 Phylogenetic
relationship of these degrading uncultured bacteria was included in the previous
parsymonious tree (Figure 3) In total 11 uncultured bacteria were identified DUB-4RS
DUB-6RS DUB-8RS and DUB-11RS were located in the Pseudomonas clade but these
uncultured bacteria were no grouped with a particular species of the genus DUB-5RS DUB-
7RS were identified as Sphingobium sp and DUB-10RS as Sphingomonas sp and located
in the Sphingobium and Sphingomonas clade respectivelly DUB-2RS was nested in
Bradyrhizobium clade because was identified as Bradyrhizobium sp and this clade was
supported by the type strain B japonicum In the same way DUB-1RS identified as
Uncultured Nitrobacteria was located in the Nitrobacteria clade belonged to N
hamadeniensis type strain Finally DUB-3RS and DUB-9RS were not identified with a
particular genus so they were located in a clade composed by uncultured bacteria The
phylogenetic relationship of these degrading uncultured bacteria allows expanding
knowledge about the consortium composition and process development Some of them
belong to α-proteobacteria DUB-5RS and DUB-7RS were related to Sphingobium group and
DUB-10RS with Sphingomonas clade thought this relationship should be confirmed
considering the low boostrap values Sphingomonas is a genus frequently isolated as PAH
degrader (Jing et al 2007) and important in the degradation of phenanthrene metabolites
(Tao et al 2007) Similarly Sphingobium sp has been described as PAH degrader
specifically in phenanthrene degradation process (Jing et al 2007) DUB-2RS belonged to
Bradyrhizobiaceae phylogenetic group and although Bradyrhizobium are genera barely
described as PAH degrading bacteria some studies based on PAH degradation by chemical
oxidation and biodegradation process have described that this plant-associated bacteria are
involved in the degradation of extracting agent used in PAH biodegradation techniques in
soils (Rafin et al 2009) DUB-1RS is a genotype related to Nitrobacteria clade However
Nitrobacteria has not been described as PAH degrader but this bacteria transform nitrites in
nitrates from the oxidation of nitrites (Modrogan et al 2010) and it is likely involved in the
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
106
nitrites oxidation process when the bioavailability of PAH in the media are low and so it is
not toxic for this bacteria Finally DUB-8RS DUB-6RS and DUB-11RS showed a high
similitude with Pseudomonas strain though the phylogenetic relationship with Pseudomonas
clade of DUB-11RS should be confirmed
Analysis of DGGE gel (Figure 5) showed that treatment with Tergitol NP-10 had very
few changes during biodegradation process whereas when the consortium was grown with
the biodegradable surfactant Tween-80 more changes were observed Similarity (Table 3)
between treatments were compared and analyzed by type of surfactant (Tween-80 vs
Tergitol NP-10) or by sampling time (15 days vs 30 days) The MDS analysis (Table 3)
showed the lowest values of Bray Curtis similarity coefficient between the consortium at
initial time (T0 not exposed to PAH and surfactants) with the PAH and Tween-80 after 15
days (16) and 30 days (7) However the similarity of T0 with PAH and Tergitol NP-10 after 15
days (22) and 30 days (26) was much higher Similarity between time treatments (15 and 30
days) within Tergitol NP-10 (56) was higher than with Tween-80 (32) The similarity within
treatments with Tween-80 was mainly due to the bands 1 and 29 (Table 3 Uncultured
Nitrobacteria and Sphingobium and Pseudomonas respectively see Table 2) whereas the
similarity within Tergitol NP-10 treatment was due to bands 1 and 30 (Table 3 Uncultured
Nitrobacteria and Uncultured bacteria respectively see Table 2)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
107
Figure 5 Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen fragments
from the consortium C2PL05 with initial inoculum (lane 1) with Tween-80 at 15 (lane 2) and 30 (lane 4)
days with Tergitol NP-10 at 15 (lane 3) and 30 (lane 5) days and molecular weight markers (lane 0)
According to PRIMER analysis similar bands between treatments (15 and 30 days) with Tergitol NP-
10 () and between treatments (15 and 30 days) with Tween-80 () are shown
1 Uncultured Nitrobacteria sp(DUB-1RS) 21 Bradyrhizobium sp (DUB-2RS) 24 Uncultured bacterium (DUB-3RS)
Uncultured Pseudomonas (DUB-4RS) 28 Uncultured Sphingomonas sp (DUB-10RS)
Pseudomonas sp (DUB-11RS) 29 Pseudomonas stutzeri (DUB-6RS) Pseudomonas sp
(DUB-8RS) Sphingobium sp(DUB-5RS DUB-7RS)
30 Uncultured Bacterium (DUB-9RS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
108
Table 3 Bands contributing to approximately the first 70 of cumulative percentage
of average similarity () Bands were grouped by surfactant and time
Band Tween-80 TergitolNP-10 15 days 30 days 1 3828 2105 2707 3014 29 2969 1509
30 2469 19
24 881 3447
27 845
21 516
Cumulative similarity () 3168 4479 4479 3391 Cloning was not possible
The genera identified in this work have been previously described as capable to
degrade the three PAH completely and efficiently with a reduction of the toxicity (Bautista et
al 2009) In the case of the treatment with Tween-80 the lower biodiversity may be caused
by a few dominant species of these genera driven during the PAH degradation process by
antagonist and synergic bacterial interactions and not by differences in the functional
capacities However when consortium grows with a non-biodegradable surfactant there is
higher biodiversity of species and interaction because the activity of various functional
groups can be required to deal the unfavorable environmental conditions
Conclusions
The choice of surfactants to increase bioavailability of pollutants is critical for in situ
bioremediation because toxicity can persist when surfactants are not biodegraded
Nevertheless surfactants affect the dynamics of microbial populations in a stable PAH-
degrading consortium From the application point of view the combination of culturable and
non culturable identification techniques may let to optimize the bioremediation process For
bioaugmentation processes culturable tools help to select the more appropriate bacteria
allowing growing enough biomass before adding to the environment However for
biostimulation process it is important to know the complete consortium composition to
enhance their natural activities
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
109
Acknowledgment
Authors are deeply indebted to Raquel Sanz Laura Saacutenchez and Laura Garciacutea and for their
support during the development of the experiments Authors also gratefully acknowledged
the financial support from the Spanish Ministry of Environment (Research project 1320062-
11) and Fundacioacuten Alfonso Martiacuten Escudero Authors also thank Repsol-YPF for providing
the soil samples This work is framed within the Official Maacutester en Ciencia y Tecnologiacutea
Ambiental from Universidad Rey Juan Carlos
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
110
References
Allen CRC Boyd DR Hempenstall F Larkin MJ amp Sharma D 1999 Contrasting effects
of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons
to cis-dihydrodiols by soil bacteria Appl Environ Microbiol 65 1335-1339
Andreoni V Cavalca L Rao MA Nocerino G Bernasconi S DellrsquoAmico E Colombo M
amp Gianfreda L 2004 Bacterial communities and enzyme activities of PAH polluted
soils Chemosphere 57 401-412
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 30 1ndash10
Clements WH Oris JT amp Wissing TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Lepomis macrochirus
Archiv Environ Contam Toxicol 26 261ndash266
Colores GM Macur RE Ward DM amp Inskeep WP 2000 Molecular analysis of
surfactant-driven microbial population shifts in hydrcarbon-contaminated soil Appl
Environ Microbiol 66 2959-2964
Egamberdieva D A amp Kucharova Z 2009 Selection for root colonising bacteria stimulating
wheat growth in saline soils Biol Fert Soils 45 563ndash571
Gallego RJS Garciacutea-Martiacutenez MJ Llamas JF Belloch C Pelaacuteez AI amp Saacutenchez J
2007 Biodegradation of oil tank bottom sludge using microbial consortia
Biodegradation 18 269ndash281
Ghazali FM Rahman RNZA Salleh AB amp Basri M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hydrocarbons (PAH) A review J Hazard Mater 169 1-15
Hoffmann H Stindl S Stumpf A Mehlen A Monget D Heesemann J Schleifer KH amp
Roggenkamp A 2005 Description of Enterobacter ludwigii sp Nov a novel
Enterobacter species of clinical relevance Syst Appl Microbiol 28 206ndash212
Holtze MS Nielsen P Ekelund F Rasmussen LD amp Johnsen K 2006 Mercury affects
the distribution of culturable species of Pseudomonas Appl Soil Ecol 31 228ndash238
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor R 1969 Evolution of protein molecules in Mammalian protein
metabolism (H Munro ed) Academic Press New York
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
111
Katoh K amp Toh H 2008 Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMC Bioinformatics 9 paper
212
Kampfer P Ruppel S amp Remus R 2005 Enterobacter radicincitans sp Nov a plant
growth promoting species of the family Enterobactriaceae Syst Appl Microbiol 28
213ndash221
Kolomytseva MP Randazzo D Baskunov BP Scozzafava A Briganti F amp Ludmila A
2009 Role of surfactants in optimizing fluorene assimilation and intermediate
formation by Rhodococcus rhodochrous VKM B-2469 Bioresource Technol 100
839-844
Kruijt M Tran H amp Raaijmakers JM 2009 Functional genetic and chemical
characterization of biosurfactants produced by plant growth-promoting Pseudomonas
putida J Appl Microbiol 107 546-556
Kwon SW Jong WS Kim S Park IC Yoon SH Park DH Lim CK amp Go SJ 2003
Pseudomonas koreensis sp Nov Pseudomonas umsongensis sp Nov and
Pseudomonas jinjuensis sp Nov novel species from farm soils in Korea Int J Syst
Evol Microbiol 53 21ndash27
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang Y amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Modrogan C Diaconu E Orbulet OD amp Miron AR 2010 Forecasting Study for Nitrate Ion
Removal Using Reactive Barriers Rev Chim 6 580-584
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions Eur J Soil Sci 54 655-670
Piskonen R amp Itaumlvaara M 2004 Evaluation of chemical pretreatment of contaminated soil
for improved PAH bioremediation Appl Microbiol Biotechnol 65 627-634
Rafin C Veignie E Fayeulle A amp Surpateanu G 2009 Benzo[a]pyrene degradation using
simultaneously combined chemical oxidation biotreatment with Fusarium solani and
cyclodextrins Bioresource Technol 100 3157-3160
Roggenkamp A 2007 Phylogenetic analysis of enteric species of the family
Enterobacteriaceae using the oric-iocus Syst Appl Microbiol 30 180-188
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
112
Samantha SK Singh OV amp Jain RK 2002 Polycyclic aromatic hydrocarbons
environmental pollution and bioremediation Trends Biotechnol 20 243-248
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil in Singh
A Kuhad RC Ward OP (Eds) Adv Appl Biorem p 103-121 Springer Berlin
Tao X-Q Lu G-N Dang Z Yi X-Y amp Yang C 2007 Isolation of ohenanthrene-degrading
bacteria and characterization of phenanthrene metabolites Worl J Biotechnol 23
647-6554
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities Syst Appl Microbiol 29 244ndash252
Torsvik V amp Ovreas L 2002 Microbial diversity and function in soil from genes to
ecosystems Curr Opin Microbiol 5 240ndash245
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Mar Eco- Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Zocca C Gregori SD VisentiniF amp Vallini G 2004 Biodiversity amongst cultivable
polycyclic aromatic hydrocarbon-transforming bacteria isolated from an abandoned
industrial site FEMS Microbiol Lett 238 375-382
Capiacutetulo
Enviado a FEMS Microbiology Ecology en Diciembre 2012
Simarro R Gonzaacutelez N Bautista LF amp Molina MC
High molecular weight PAH biodegradation by a wood degrading
bacterial consortium at low temperatures
Biodegradacioacuten de hidrocarburos de alto peso molecular por un consorcio bacteriano
degradador de madera a bajas temperaturas
3
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
115
Abstract
The aim of this work was to evaluate the ability of two bacterial consortia (C2PL05 and
BOS08) extracted from very different environments to degrade low (naphthalene
phenanthrene anthracene) and high (pyrene and perylene) molecular weight polycyclic
aromatic hydrocarbons (PAH) at high (15-25ordmC) and low (5-15ordmC) temperature ranges
C2PL05 was isolated from a soil in an area chronically and heavily contaminated with
petroleum hydrocarbons and BOS08 from decomposing wood in an unpolluted forest free of
PAH Bacterial consortia were described by cultivable and no-cultivable techniques (DGGE)
PAH-degrading bacterial population measured by most probable number (MPN)
enumeration increased during the exponential phase Toxicity estimated by MicrotoxTM
method was reduced to low levels and the final PAH depletion determined by high-
performance liquid chromatography (HPLC) confirmed the high degree of low and high
molecular weight PAH degradation capacity of both consortia The PAH degrading capacity
was also confirmed at low temperatures and specially by consortium BOS08 where strains
of Acinetobacter sp Pseudomonas sp Ralstonia sp and Microbacterium sp were identified
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
117
Introcuduction
Polycyclic aromatic hydrocarbons (PAH) constitute a diverse class of organic compounds
formed by two or more aromatic rings in several structural configurations having
carcinogenic mutagenic and toxic properties Therefore environment contamination by PAH
is currently a problem of concern and it has been shown that bioremediation is the most
efficient practice retrieving the original conditions of the ecosystem (Haritash amp Kaushik
2009) However the high molecular weight PAH (HMW-PAH) such as pyrene
benzo[a]pyrene or benzo[b]fluoranthene are generally recalcitrant and resistant to microbial
attack due to their low solubility and bioavailability Therefore these compounds are highly
persistent in the environment and bioaccumulated in organisms (Lafortune et al 2009)
Studies on PAH biodegradation with less than three rings have been the subject of many
reviews (ie Sutherland et al 1995) However there is a lack of knowledge about the
HMWndashPAH biodegradation (Kanaly amp Harayama 2000)
Microbial communities play an important role in the biological removal of pollutants in
soils (MacNaughton et al 1999) Therefore changes in environmental condition may alter
species diversity of the soil microbiota and their metabolic rates (Margesin amp Schinner
2001) In areas chronically polluted by PAH there are abundant bacteria able to degrade
those toxic contaminants by using them as sole carbon and energy sources (Taketani et al
2010) Recent works (Tian et al 2008 Surridge et al 2009 Couling et al 2010) have
reported the potential ability to degrade PAH by microorganisms apparently not previously
exposed to those toxic compounds This is extensively known for lignin degrading white rot-
fungi that produce a set of extracellular enzymes such as oxidases and peroxidases (Wong
2009) with low substrate specificity that expand their oxidative action beyond lignin being
capable to degrade other complex phenolic compounds and PAH (ie Canet et al 2001)
Although less extensively than in fungus PAH degradation capacity have been also reported
in this type of environment in bacteria belonged to genera Pseudomonas (Zimmermann
1990 McMahon et al 2007) However according to Couling et al (2010) the wide-spread
capacity to degrade PAH by microbial communities even from unpolluted soils can be
explained by the fact that PAH are ubiquitously distributed by natural process throughout the
environment at low concentration enough for bacteria to develop degrading capacity
Regardless of these issues there are some abiotic factors such as temperature that
may greatly influence biodegradation process It has been shown (Mohn amp Stewart 2000)
that although biodegradation of PAH is more efficient in the range 20-30 ordmC it can be carried
out even in colder (lt5 ordmC) environments (Eriksson et al 2001) At low temperature diffusion
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
118
and solution rates and so bioavailability of PAH decreases (Haritash amp Kaushik 2009)
Simultaneously the microbial metabolism is slowed-down increasing the lag period (Atlas amp
Bartha 1972 Eriksson et al 2001) However and according to the hypothesis that
degrading microorganisms are present in most of ecosystems there are degrading bacteria
adapted to low temperatures (Yakimov et al 2003 Brakstad amp Bonaunet 2006) that can
express degrading capacity So the study of biodegradation at low temperatures is important
since the temperature of more than 90 of the seawater volume is below 5 ordmC In addition
PAH and anthropic discharges sometimes have occurred and may occur in sea water (Bode
et al 2006 Soriano et al 2006) or in cold and even extreme environments such as in
Alaska (Bence et al 1996)
The main goal of this work was to study the effect of low temperature on HMW-PAH
degradation rate by two different consortia isolated from two different environments one from
decay wood in an unpolluted forest (consortium BOS08) and other from a polluted soil
exposed to hydrocarbons The purpose of the present work was also to describe the
microbial dynamics along the biodegradation process as a function of temperature and type
of consortium used
Materials and methods
Chemicals and media
Naphthalene phenanthrene anthracene pyrene and perylene (all gt99 purity) purchased
from Sigma-Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) were prepared
in a stock solution in n-hexane (Fluka Steinheim Germany) to get a final concentration of
002 gl-1 for naphthalene phenanthrene and anthracene 001 gl-1 for pyrene and 0005 gl -1
for perylene Tween-80 purchased from Sigma-Aldrich was added according to previously
work (Bautista et al 2009) Composition of optimized Bushnell Haas Broth medium (BHB)
(Simarro et al 2010) was 02 g l -1 MgSO4middot7H2O 002 g l -1 CaCl2 2H2O 0088 g l -1 KHPO4
0088 g l -1 K2HPO4 209 g l -1 NaNO3 0015 g l -1 Fe2(SO4)3
Physicochemical characterization of soils and isolation of bacterial consortia
Consortia C2PL05 was isolated from a permanently polluted soil from a petroleum refinery
(Ciudad Real Spain) with a range of environmental temperatures from 10 ordmC in winter to 25
ordmC in summer The consortium BOS08 was extracted from dead wood in a pristine Atlantic
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
119
forest in Fragas do Eume Galicia Spain (latitude 43ordm 4175acute north longitude 8ordm 0683acute west)
with oaks as the dominant flora species and with a range of temperatures of 10 ordmC in winter
and 18 ordmC in summer To obtain the microbial consortia sieved soil and the wood sample
were suspended in PBS (110) and stirred overnight at 25 ordmC Then 15 ml of each extract
was inoculated in 50 ml of BHB (pH 70) with Tween-80 1 (vv) as surfactant and
naphthalene phenanthrene anthracene pyrene and perylene (each at 500 mg l -1) as carbon
sources Each culture were incubated in an orbital shaker at 150 rpm 25 ordmC and dark
conditions until the exponential phase was completed (asymp 5 days) monitoring cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK)
Sieved (lt2 mm) river sand was used as substrate Prior to use it was burned at 550
ordmC in a furnace to remove organic matter and microorganisms Water holding capacity (WHC)
of the river sand was measured following the method described by Wilke (2005)
Experimental design and treatments conditions
15 microcosms (triplicates by five different incubation times) were performed with consortium
C2PL05 at high temperature range (H) 16 hours with light at 25 ordmC followed by 8 hours in
the dark at 15 ordmC Another 15 microcosms with consortium C2PL05 were incubated at low
temperature range (L) 16 hours with light at 15 ordmC followed by 8 hours in the dark at 5 ordmC
The same experiments were performed with consortium BOS08 Microcosms were incubated
in suitable chambers equipped with temperature lightdarkness cycle and humidity (60)
control systems Each microcosms contained 90 g of sterilized sand 18 ml of BHB (60 of
WHC) with Tween-80 1 (vv) 2 ml of PAH stock solution in n-hexane (final amount of PAH
per tray of 20 mg of naphthalene 20 mg of phenanthrene 20 mg of anthracene 10 mg of
pyrene and 5 mg of perylene) and 35 ml of bacterial consortium (0088 AU = 275x104
cellsmiddotml -1 for C2PL05 and 0051 AU = 286 x 104 cellsmiddotml-1 for BOS08)
Bacterial growth MPN and toxicity assays
Bacterial density during the PAH degrading process was monitored at 0 11 33 66 101 and
137 days by changes in the absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) From the absorbance data the
intrinsic growth rate in the exponential phase was calculated by applying Equation 1
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
120
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time Increments were normalized by
absorbance measurements at initial time (day 0) to correct the inoculum dilution effect
Heterotrophic and PAH-degrading population from the consortia were estimated by a
miniaturized most probably number technique (MPN) in 96-well microtiter plates with eight
replicate wells per dilution (Wrenn amp Venosa 1996) Total heterotrophic microbial population
was estimated in 180 μl of Luria Bertani (LB) medium with glucose (15 gl -1) and 20 microl of the
microbial consortium PAH-degrading population in the inoculum was estimated in 180 microl of
BHB medium containing Tween-80 (1 vv) 10 microl of PAH stock mix solution as only carbon
source (n-hexane was allowed to evaporate prior to inoculation) and 20 microl of the microbial
consortium in each well
Toxicity during the PAH degradation was also monitored through screening analysis of
the samples following the MicrotoxTM method with the luminescent bacterium Vibrio fischeri
following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15 ordmC
Monitoring of PAH biodegradation
To confirm that consortium BOS08 was not previously exposed to PAH samples were
extracted with acetone and n-hexane according to Joslashrgensen et al (2005) and the
identification was performed by GC-MS analysis of the extract A gas chromatograph (model
CP3800 Varian Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary
column (15 m length 025 mm ID 025 μm film thickness) was coupled to a quadruple
mass-spectrometer detector (Model 1200L Varian) The stationary phase was composed by
phenyl (5) and dimethylpolysiloxane (95) as carried gas ice in the mobile phase
Temperature gradient program used was initial temperature of 80 ordmC for 2 min temperature
increase to 300 ordmC at the rate of 1 ordmC min-1 final temperature of 300 ordmC for 15 min with a
final duration of the method of 39 min In addition total petroleum hydrocarbons (TPH) in
both soils were extracted and quantified as is described previously
PAH from microcosms were extracted and analyzed at initial and final time to estimate
the total percentage of PAH depletion by gas cromatography using the gas cromatograph
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
121
equiped and protocol described previuosly For this 100 g of soil from each replicate were
dried overnight at room temperature and PAH were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inyect 05 μl in
the FDI chromatograph
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
To identify cultivable microorganisms samples from each microcosm were collected at zero
33 and 101 days of the biodegradation process To extract the microorganisms 15 g of soil
were suspended in PBS (110) and incubated overnight in an orbital shaker at 150 rpm
maintaining the same temperature and light conditions than during the incubation process
To get about 10 PAH-degrading colonies isolated 100 ml of the supernatant were placed
onto Petri plates with BHB medium and purified agar and were sprayed with a stock mix
solution of naphthalene phenanthrene anthracene pyrene and perylene (final concentration
500 mgL-1) as carbon source and incubated at the same temperature conditions
Total DNA of the PAH-degrading isolated cultures (DIC) was extracted using Microbial
DNA kit (MoBio Laboratories Solano Beach CA USA) and amplified using primers 16S F27
and 16S R1488 (Lane et al 1991) according to the ExTaq HS DNA polymerase protocol
(Molina et al 2009) Sequences were edited and assembled using ChromasPro software
version 142 (Technelysium Pty Ltd Tewantin Australia) to check for reading errors and
when possible resolving ambiguities BLAST search (Madden et al 1996 available at URL
httpncbinlmnihgovBLAST) was used to find nearly identical sequences for the 16S
rRNA sequences determined Sequences were aligned using the Q-INS-i algorithm (Katoh amp
Toh 2008a) of the multiple sequence alignment software MAFFT version 6611 (Katoh amp
Toh 2008b) aligning sequences in a single step
All identified sequence (by culture and no-culture techniques) and more similar
sequences downloaded from GenBank were used to perform the phylogenetic tree
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates using PAUP
40B10 (Swofford 2003) In addition maximum parsimony (MP) was also analyzed (Molina
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
122
et al 2009) Sequences of Aquifex piruphilus and Hydrogenobacter hydrogenophylus were
used as out-group
Denaturing gradient gel electrophoresis (DGGE) from microbial consortia during PAH
degrading process
A non culture-dependent molecular techniques as DGGE was performed to know the effect
of the temperature on total biodiversity of both microbial consortia during the PAH
degradation process by comparing the treatment at zero 33 and 101 day with the initial
composition of the consortia Total DNA was extracted from 025 g of the samples using
Microbial Power DNA isolation kit (MoBio Laboratories Solano Beach CA USA) and
amplified using the primers set 16S 338F-GC and 16S 518R according to ExTaq HS DNA
polymerase protocol (Promega Corp Madison WI USA) PCR product was loaded onto a
10 (wv) polyacrilamide gel with a denaturing gradient from 35 to 65 denaturant Gel
were stained with Syber-Gold and viewed under UV light and predominant bands in DGGE
gel were excised Due to impossibility to reamplify bands DNA of the bands was cloned in
the pGEM-T Easy Vector (Promega Madison WI) PAH-degrader uncultured bacterium
(DUB) were edited and assembled as described above and included in the matrix to perform
the phylogenetic tree Images of DGGE were digitalized and processed using the UN-Scan-It
gel analysis software version 60 (Silk Scientific US)
To identifiy the presence of fungi in the consortium BOS08 during the process total
DNA was extracted from the samples using Microbial Power DNA isolation kit (MoBio
Laboratories Solano Beach CA USA) and amplified with the primers set 18S ITS1F and
ITS4 according to Quiagen Multiplex PCR kit protocol DNA of Clitocybe metachroa was
extracted using DNeasy Plant Mini Kit (Quiagen) from the mushroom for use as PCR
positive PCR products were visualized under UV light on an agarose gel (1 ) using Syber-
Gold as intercalating agent
Statistical analysis
In order to evaluate the effects of inocula type and temperature on the final percentage of
PAH depletion and on the intrinsic growth rate (μ) bifactorial analysis of variance (ANOVA)
were used The variances were checked for homogeneity by the Cochranacutes test Student-
Newman-Keuls (SNK) test was used to discriminate among different treatments after
significant F-test representing this difference by letters in the graphs Data were considered
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
123
significant when p-value was lt 005 All tests were done with the software Statistica 60 for
Windows Differences in microbial assemblages were graphically evaluated for each factor
combination (time type of consortium and temperature) with a non-metric multidimensional
scaling (MDS) using PRIMER software (Clarke 1993) SIMPER method was used to identify
the percent contribution of each band from DGGE to the dissimilarity or similarity in microbial
assemblages between and within combination of factors Based on Viejo (2009) bands were
considered ldquohighly influentialrdquo if they contributed to the first 60 of cumulative percentage of
average dissimilaritysimilarity betweenwithin combination of factors
Results
Hydrocarbons in soils
Figure 1 shows GC-MS analysis of the extracted hydrocarbons from samples where both
consortia were isolated Soil samples where C2PL05 consortium was isolated contained 64
wt of total petroleum hydrocarbons (TPH) However no traces of PAH or any other
petroleum hydrocarbons were detected within samples where BOS08 consortium was
obtained
0 5 10 15 20 25 30 35
BO S08
C 2PL05
tim e (m in)
Figure 1 GC-MS total ion chromatogram from solvent extracted hydrocarbons in soils where
consortia C2PL05 and BOS08 were isolated
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
124
Cell growth intrinsic growth MPN and toxicity assays
Figure 2 (A B) shows the growth of both microbial consortia during PAH biodegradation
process Lag phases were absent and long exponential phases (until day 66 approximately)
were observed in all treatments except with the C2PL05 consortium at low temperature
(finished at day 11) In general higher cell densities were achieved in those microcosms
incubated in the higher temperature range Despite similar cell densities reached with both
consortia and both temperature levels the values of the intrinsic growth rate (μ) during the
exponential phase (Table 1) showed significant differences between consortia and
temperatures of incubation but not in their interaction (Table 2A) Differences between
treatments showed that the highest μ was obtained at high temperatures (25 ordmC-15 ordmC) and
with BOS08 consortium
Figure 2 (C D) showed that the initial number of PAH-degrading bacteria were at least
one order of magnitude lower than heterotrophic bacteria in both consortia The highest
heterotrophic bacteria concentration was reached after 33 days of incubation approximately
to a final value of 108- 109 cells g-1 soil (four orders of magnitude above the initial values)
The highest contribution of PAH-degrading bacteria to total heterotrophic bacteria was
observed at 33 days of incubation No differences were observed between temperature
ranges From 33 days both type of populations started to decrease but PAH-degrading
bacteria of consortia increased again at 101 days reaching values at the end of the process
similar to the initial ones
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
125
0 11 33 66 101 137
005
010
015
020
025
030
035
0 11 33 66 101 137
0 33 101 137102
103
104
105
106
107
108
109
0 33 101 137Time (day)Time (day)
Time (day)
Abs
orba
nce 6
00nm
(A
U)
Time (day)
DC
BA
cell
g so
il
Figure 2 Cell growth of consortia C2PL05 (A) and BOS08 (B) at high () and low () temperature
range during PAH biodegradation and MPN for consortia C2PL05 (C) and BOS08 (D) of heterotrophic
(squares) and PAH-degrading (circles) cultivated at high (filled symbols) and low (empty symbols)
temperature range
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
126
Table 1 Intrinsic growth rate (μ) and biodegradation percentage of phenanthrene (Phe) anthracene
(Ant) pyrene (Pyr) perilene (Per) and total PAH (Tot) at final time for consortia C2PL05 and BOS08 at
high (H) and low (L) temperature range Superscript letters (a to c) show differences between groups
(plt005 SNK) and plusmn SD the standard deviation
μ
Treatment d-1x10-3 plusmnSD x10-3
C2PL05 H 158 b 09 C2PL05 L 105 a 17
BOS08 H 241 c 17
BOS08 L 189 b 12
PAH biodegradation ()
Treatment Phe plusmn SD Ant plusmn SD Pyr plusmn SD Per plusmn SD Total plusmn SD
C2PL05 H 954 plusmn 04 993 plusmn 01 270 plusmn 62 986 plusmn 01 989 c plusmn 04
C2PL05 L 801 plusmn 61 459 plusmn 158 470 plusmn 118 538 plusmn 190 543 a plusmn 109
BOS08 H 938 plusmn 27 993 plusmn 04 472 plusmn 130 864 plusmn 61 866 bc plusmn 60
BOS08 L 940 plusmn 31 579 plusmn 31 542 plusmn 102 691 plusmn 137 677 ab plusmn 77
Table 2 Analysis of variance (ANOVA) of the effects on μ (A) total PAH biodegradation (B) and
biodegradation of pyrene and perilene (C) SS is the sum of squares and df the degree of freedoms
Factor df SS F
p-value
A) μ
Temperature a 1 36 x 10-3 5931 Consortium b 1 83 x 10-5 136
Temperature x Consortium 1 20 x 10-4 343 ns
Error 8 49 x 10-5 0001
B) Total PAH biodegradation ()
Treatment c 3 3526 73
Error 8 1281
C) Biodegradation of pyrene and perilene ()
Treatment c 3 11249 11 ns
PAH d 1 85098 251
Treatment x PAH 3 31949 31 ns
Error 16 54225
a high (15-25ordmC) or low (5-15ordmC) temperature range b consortium C2PL05 or BOS08 c C2PL05 at
high and temperature range or BOS08 at high and low temperature range d naphthalene
phenanthrene anthracene pyrene and perylene p lt 005 p lt 001 p lt 0001
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
127
With regard to toxicity values (Figure 3) complete detoxification were achieved at the
end of each treatment except for consortium C2PL05 (percentage of toxicity 40) incubated
at low temperature (Figure 3A) When consortium BOS08 was incubated at low temperature
there was a time period between 11 and 66 days that toxicity increased (Figure 3B)
0 11 33 66 101 137
0
20
40
60
80
100
0 11 33 66 101 137
BA
Time (day)
Tox
icity
(
)
Time (day)
Figure 3 Toxicity of microcosms with consortium C2PL05 (A) and BOS08 (B) incubated at high ()
and low () temperature range during PAH biodegradation process
Biodegradation of PAH
PAH biodegradation results are shown in Table 1 PAH depletion showed significantly
differences (Table 2B) within the consortium C2PL05 with highest values at high temperature
and the lowest at low temperature (Table 1) Those differences were not observed within the
BOS08 consortium and PAH depletion showed average values between values of C2PL05
depletion Regarding each individual PAH naphthalene was completely degraded at final
time 80 of phenanthrene was depleted in all treatments and anthracene and perylene
were further reduced at high (gt85) rather than low temperature (gt50) However pyrene
was significantly less consumed by the consortia than perylene (Table 1 and Table 2C)
Phylogenetic analyses
Phylogenetic relationships of the degrading isolated cultures and degrading uncultured
bacteria are shown in Figure 4 The aligned matrix contains 1349 unambiguous nucleotide
position characters with 505 parsimony-informative and 173 characters excluded Parsimony
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
128
analysis of the data matrix yielded 87 parsimonious trees with CI = 0756 RI = 0945 and a
length of 1096 Figure 4 also shows the topology of the neighbour joining tree
Inconsistencies were not found when analysing boostrap values of neighbour joining (NJ)
and maximum parsimony (MP)
Figure 4 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) and degrading uncultured bacteria (DUB) obtained from DGGE of the
consortia and cultivable identification process at day 0 33 and Boostrap values of neighbour joining
(NJ) and parsimonious (MP) are showed on the branch of the tree (NJMP) No incongruence between
parsimony and neighbour joining topology were detected Pseudomonas genus has been designated
as P Psychrobacter genus as Ps Acinetobacter as A and Ralstonia as R T= type strain
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
129
DIC-46-RS (Rhodococcus sp) DIC-47RS (Bacillus psychrodurans) and DUB-25RS
(Microbacterium sp) were not included in the phylogenetic tree due to their high phylogenetic
distance with most of the DIC and DUB Phylogenetic tree was composed by bacteria
belonged to γ- and β-Proteobacteria Group of γ- Proteobacteria was composed by
Acinetobacter clade Psychrobacter clade and Pseudomonas clade whereas β-
Proteobacteria group was only composed by Ralstonia clade Within Acinetobacter clade
although the identity approximation (BLAST option Genbank) reported A johnsonii and A
haemolyicus such as the species closest to some of the DIC and DUB the incorporation of
the types strains in the phylogenetic tree species do not showed a clear monophyletic group
Thus and as a restriction molecular identification of these strains (Table 3) was exclusively
restricted to genus level that is Actinobacter sp A similar criteria was taken for
Pseudomonas clade where molecular identifications carry out through BLAST were not
supported by the monophyletic hypothesis when type strains were included in the analysis
Psycrobacter clade sister group of Acinetobacter clade are represented by Psychrobacter
urativorans type strain (DQ143924T) in which DIC-14RS and DIC-23RS are nested β-
Proteobacteria is only composed by Ralstonia clade confirmed by RinsidiosaT (FJ772078T)
although DICs included in this clade are more related with the strain Ralsonia sp AF488779
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
130
Table 3 Identification and similarity () to bacteria from GenBank of cultivable strains
and DGGE bands (non-cultivable bacteria)
Days Consortium Temperature Strains Molecular Identification
(genera) 33
C2PL05
15 ordmC-5 ordmC
DIC-7RS DIC-8RS DIC-9RS DIC-11RS DIC-10RS DIC-12RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-13RS DIC-14RS DIC-15RS DIC-46RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Psychrobacter urativorans Pseudomonas sp Rhodococcus sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-16RS DIC-17RS DIC-18RS DIC-19RS DIC-20RS DIC-21RS DIC-22RS DUB-25RS DUB-26RS
Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-23RS DIC-47RS DUB-22RS DUB-23RS DUB-24RS DUB-25RS DUB-26RS
Psychrobacter urativorans Bacillus psychrodurans Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
101
C2PL05
15ordmC-5ordmC
DIC-24RS DIC-25RS DIC-26RS DIC-27RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-28RS DIC-29RS DIC-30RS DIC-31RS DIC-32RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-33RS DIC-34RS DIC-35RS DIC-36RS DIC-37RS DIC-38RS DIC-39RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
131
25 ordmC-15 ordmC
DIC-40RS DIC-41RS DIC-42RS DIC-43RS DIC-44RS DIC-45RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
Diversity and evolution of cultivated and uncultivated bacteria and dynamics during PAH
biodegradation
PCR analysis to identify fungal DNA in BOS08 was negative for the initial period of the
biodegradation process at both temperatures ranges Fungal DNA was only positive at high
temperatures and the end of the biodegradation process (101 and 137 days)
A minimum of 10 colonies were isolated and molecularly identified from the four
treatments at days 33 and 101 by cultivated methods The most influential bands of DGGE
to 60 of contribution to similarity (Figure 5 Table 4) according to the results of PRIMER
analysis were cloned and identified with the except of bands 2 4 27 and 36 that were not
cloned after several attempts likely due to DNA degradation The results of the identification
by cultivated and uncultivated methods (Table 3 Figure 5) show that different strains of
Acinetobacter (DUB-26RS uncultured Acinetobacter sp) and Microbacterium bands 24
(DUB-26RS uncultured Acinetobacter sp) and 22 (DUB-25RS Microbaterium sp)
respectively were always present in both consortia (Figure 5) both at high and low
temperatures However it should be also noted that Rhodococcus sp strains are unique to
C2PL05 consortium whereas Ralstonia sp and Bacillus sp were only found in BOS08
consortium being all of the above DIC strains (Table 3) In depth analysis of the community
of microorganisms through DGGE fingerprints and further identification of the bands allowed
to establish those bands responsible for the similarities between treatments (Table 4) and the
most influential factor MDS (Figure 6) shows that both time and temperature have and
important effects on C2PL05 microbial diversity whereas only time had effect on BOS08
consortium Both consortia tend to equal their microbial compositions as the exposed time
increase (Figure 6) The highest average of similarity (5327 ) was observed at day 101
being bands 36 4 (unidentified) and 24 (DUB-26RS Acinetobacter sp) responsible for that
similarity The lowest similarity (3543 ) was observed within the consortium C2PL05 (Table
4) being the high abundance of the band 20 (DUB-24RS Pseudomonas sp) and the lack of
the band 22 (DUB-25R Microbacterium sp) responsible of the dissimilarity Concluding it
can be observed that bands 20 (DUB-24RS Pseudomonas sp) 22 (DUB-25R
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
132
Microbacterium sp) 24 (DUB-26RS Acinetobacter sp) 36 and 4 (both unidentified) were
the most responsible for the similarity or dissimilarity between bacterial communities of
different treatments Another band showing lower contribution to these percentages but yet
cloned was band 12 from which two genotypes were identified (DUB-22RS and DUB-23RS)
as Pseudomonas sp Regarding to identification of DIC strains (Table 3) Rhodococcus sp
was exclusive of C2PL05 consortium and Ralstonia sp and Bacillus sp were only found in
BOS08 consortium
Table 4 Bands contribution to 60 similarity primer between treatments grouped by time type
of bacterial consortium and incubation temperature Average similarity of the groups determine
by SIMPER method
Time (day) Consortium Temperature
Band DUB 0 33 101 C2PL0 BOS0 High Low
22 DUB-25RS 2855 2789 2581 20 DUB-24RS 2993 2521 1797 2366
36 Unidentified 3546 1029 210
4 Unidentified 2855 1120 2362 1755 2315 175
27 Unidentified 139
2 Unidentified 1198
24 DUB-26RS 929
Cumulative similarity () 5710 5781 5595 6081 6134 5710 524Average similarity () 4433 4070 5327 3543 4660 4433 405
Unidentified bands from DGGE after several attempts to clone
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
133
Figure 5 Denaturant gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen
fragments from the consortium C2PL05 (line 1 to 5) and consortium BOS08 (line 6 to 10) Line 0
contains the molecular weight markers lines 1 and 6 correspond to initial time lines 2 and 7 to
high temperature range at day 33 lines 3 and 8 to high temperature range at day 101 lines 4
and 9 to low temperature range at day 33 and lines 5 and 10 to low temperature range at day
101
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
134
Figure 6 Multidimensional scaling (MDS) plot showing the similarity
between consortia BOS08 (BO) and C2PL05 (C2) incubated at low
(superscript L) and high (superscript H) temperature at day 0 33 and
101(subscripts 0 1 and 2 respectively)
Discussion
PAH degradation capability of bacterial consortia
Consortium BOS08 was isolated from a pristine soil since hydrocarbons and especially PAH
were not detected Opposite results were observed for samples where consortium C2PL05
was extracted with a large amount (64 wt) of petroleum compounds (ltC40) measured
However both consortia proved to be able to efficiently degrade HMW-PAH even at low
temperature range (5-15 ordmC) However both consortia have shown lower pyrene than
perylene depletion rates despite the former has lower molecular size and higher aqueous
solubility and bioavailability and lower hydrophobicity Previous work (Alves et al 2005)
have reported that UV and visible light can activate the chemical structure of some PAH
inducing changes in toxicity However whereas these authors classified phototoxicity of
pyrene and perylene as positive other phototoxic classifications (Mekenyan et al 1994)
consider pyrene as extremely toxic and perylene as moderately toxic So the high toxicity
level of pyrene due to phototoxic effect may explain the lower depletion rates of pyrene
opposite to that expected from their physicochemical properties above mentioned
Contrary to previous works (Spain amp ven Veld 1983 Jhonsen amp Karlson 2005) the
consortium BOS08 has not needed the pre-exposure to PAH to induce microbial adaptation
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
135
and consequently degradation of those pollutants In agreement with previous works
(Margesin amp Schinner 2001) our results have showed that the addition of PAH to the forest
consortium BOS08 was rapidly followed by an initial increase of PAH degrading bacteria
Considering the origin of consortium BOS08 extracted from a soil rich in organic matter and
decaying wood is possible that biodegradation process may be associated with wood
degrading bacteria and fungi However results confirmed that initial conditions when PAH
concentration was high fungi were not present Fungi appeared just at the end of the
biodegradation process (101 and 137 days) and only at high temperature when high PAH
concentration was already depleted and toxicity was low These results therefore confirm
that biodegradation process was mainly carried out by bacteria when PAH concentration and
toxicity were high
PAH degradation ability is a general characteristic present in some microbial
communities when community is exposed to PAH (Macleod amp Semple 2002 Jhonsen amp
Karlson 2005 Tian et al 2008) Microbial consortia were obtained from highly different
levels of contamination However although high differences were observed at the initial
microbial composition of both consortia they share some strains (Microbacterium sp and
Acinetobacter sp) The lower diversity found within the C2PL05 consortium (more details in
Molina et al 2009) obtained from a chronically and heavily polluted area with petroleum
hydrocarbons is typical of aged soils exposed to PAH These pollutants drive the selection of
specific bacteria that are able to degrade them (Vintildeas et al 2005)
Most of the identified species by DGGE (culture-independent rRNA approaches) in this
work were γ-proteobacteria (Pseudomonas and Acinetobacter) except DUB-26RS 98
similar to Microbacterium sp belonging to Actinobacteria phylum In agreement with previous
works (Harayama et al 2004) identification results retrieved by culture-dependent methods
showed some differences from those identified by the culture-independent rRNA
approaches DIC identified by culturable techniques belonged to a greater extend to
Proteobacteria phylum γ-Proteobacteria (Pseudomonas Pshycrobacter Acinetobacter) and
β-Proteobacteria (Ralstonia) Only two cultivable strains DIC-46RS and DIC-47RS identified
as Rhodococcus sp and Bacillus psychrodurans belonged to Actinobacteria and Firmicutes
phylum respectively Genera as Bacillus Pseudomonas and Ralstonia were identified within
the consortium BOS08 obtained from decaying wood in a pristine forest These genera are
typical from decomposing wood systems and have been previously mentioned as important
aerobic cellulose-degrading bacteria such as Bacillus sp (Lynd et al 2002) or degraders of
the highly oxidized oxalate (Pseudomonas sp Ralstonia sp) which is released by white-rot
fungi during degradation of lignocellulose (Dutton amp Evans 1996) Lignin is one of the most
slowly degraded components of dead plants and the major contributor to the formation of
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
136
humus as it decomposes The breakdown of lignin is mediated by extracellular enzymes
such as laccase lignin peroxidise and manganese peroxidase (Hatakka 1994 Hatakka
2001) The lack of specificity and the high oxidant activity of these enzymes make them able
to degrade different components as PAH (ie Pickard 1999) For this reason Bacillus
Pseudomonas and particularly Ralstonia identified within the consortium BOS08 and
typical from decomposing wood systems have been also previously identified as degrader of
aromatic compounds (Zhuang et al 2002 Chauhan et al 2008 Luo et al 2009) While
many eukaryotic laccases have been identified and studied laccase activity has been
reported in relatively few bacteria these include some strains identified in our decomposing
wood consortium BOS08 such as Ralstonia sp and Bacillus sp and others like Azospirillum
lipoferum Marinomonas mediterranea Amycolatopsis sp Streptomyces coelicolor
Arthrobacter cholorophenolicus and Rhodococcus opacus (McMahon et al 2007 Dawkar et
al 2009 Brown et al 2011)
HMW-PAH degradation at low temperatures
In the last 10 years research in regard to HMW-PAH biodegradation has been carried out
mainly through single bacterial strains or artificial microbial consortia and at optimal
temperatures (Kanaly amp Harayama 2000 Kanaly amp Harayama 2010) However there is a
lack of knowledge focused on HMW-PAH biodegradation at difficult conditions such as low
temperatures by full microbial consortia Temperature is a key factor in physicochemical
properties of PAH and in the control of PAH biodegradation metabolism in microorganisms
The diffusion rate of PAH into the aqueous phase increases with temperature and so PAH
bioavailability (Haritash amp Kaushik 2009) and PAH metabolism rate (Leahy amp Colwell 1990)
In agreement with previous results (Eriksson et al 2001) PAH biodegradation rates were
significantly higher at moderate temperatures (15-25 ordmC) because metabolic activity
diffusion and mass transfer was facilitated However there are also microorganisms with
capacity to efficiently degrade HMW-PAH even at lower temperatures (Margesin et al 2002)
as microorganisms present at both consortia (BOS08 and C2PL05)
Genera as Acinetobacter and Pseudomonas identified from both consortia growing at
low temperature have been previously reported as typical strains from cold and petroleum-
contaminated sites being capable to grow using solely hydrocarbons (MacCormack amp Fraile
1997 Eriksson et al 2003 Margesin et al 2003) According to previously works that
considered this genera as cold-tolerant (Margesin et al 2003 Ma et al 2006) our results
showed that they grow and efficiently degrade HMW-PAH at low temperature range (5-15 ordmC)
but with significantly lower rates than those at higher temperature In addition whereas time
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
137
was an influence factor in bacterial communities distribution temperature only affected to
C2PL05 consortium Possibly these results can be related with the environmental
temperature of the sites where consortia were extracted Whereas bacterial community of
BOS08 are adapted to temperatures below 20 ordmC all year C2PL05 consortium is adapted to
a range with maximum temperatures above 20 ordmC Hence although this consortium had cold-
tolerant species that degrade at low temperatures their probably less proportion than in the
BOS08 consortium resulted in differences between percentages of PAH depletion and
evolution of the bacterial community in function of temperature Therefore the cold-adapted
microorganisms are important for the in-situ biodegradation in cold environments
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (Projects 11-37320053-
B and 0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
138
References
amp Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int Biodet
Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bode A Gonzaacutelez N Lorenzo J Valencia J Varela MM amp Varela M 2006 Enhanced
bacterioplankton activity after the Prestige oil spill off Galicia NW Spain Aquatic
Microb Ecol 43 33-41
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0ndash5degC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Brown ME Walker MC Nakashige TG Iavarone AT amp Chang M 2011 Discovery and
characterization of heme enzymes from unsequenced bacteria Application to microbial
lignin degradation J Am Chem Soc 4518006-18009
Canet R Birnstingl JG Malcolm DG Lopez-Real JM amp Beck AJ 2001 Biodegradation
of polycyclic aromatic hydrocarbons (PAH) by native microflora and combinations of
white-rot fungi in a coal-tar contaminated soil Bioresource Technol 76113-117
Chauhan A Fazlurrahman Oakeshot JG amp Jain RK 2008 Bacterial metabolism of
polycyclic aromatic hydrocarbons strategies for bioremediation Indian J Microbiol 48
95-113
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158 3411-
3420
Dawkar VV Jadhav UU Telke AA amp Govindwar SP 2009 Peroxidase from Bacillus sp
VUS and its role in the decolorization of textile dyes Biotechnol Bioprocess Eng 14
361-368
Dutton MV amp Evans CS 1996 Oxalate production by fungi its role in pathogenicity and
ecology in the soil environment Can J Microbiol 42 881ndash895
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
139
Eriksson M Jong-Ok Ka amp Mohn WW 2001 Effects of low temperature and freeze-thaw
cycles on hydrocarbon biodegradation in Arctic Tundra soil Appl Environ Microbiol
675107-5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Harayama S Kasai Y amp Hara A 2004 Microbial communities in oil-contaminated seawater
Curr Opin Biotechnol 15 205-214
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycoilyclic aromatic
hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microb Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M Steinbuchel A(eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Johonsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-
does it depend on PAH exposure Microb Ecol 50 488ndash495
Joslashrgensen KS Jaumlrvinen O Sainio P Salminen J amp Suortti AM 2005 Quantification of
soil contamination In Margesin R Schinner F (eds) Manual of soil analysis
monitoring and assessing soil bioremediation Springer Berlin pp 97-119
Kanaly RA amp Harayama S 2000 Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059ndash2067
Kanaly RA amp Harayama S 2010 Advances in the field of high-molecular-weight polycyclic
aromatic hydrocarbon biodegradation by bacteria Microb Biotechnol 3 136ndash164
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Lafortune I Juteau P Deacuteziel E Leacutepine F Beaudet R amp Villemur R 2009 Bacterial
diversity of a consortium degrading high-molecular-weight polycyclic aromatic
hydrocarbons in a two-liquid phase biosystem Microb Ecol 57 455-468
Lane DJ 1991 16S23S sequencing In E Stackebrandt and M Goodfellow (ed) Nucleic
acid techniques in bacterial systematic John Wiley amp Sons Chischester UK
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environments
Microbiol Rev 54 305-315
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
140
Luo YR Tian Y Huang X Yan CL Hong HS Lin GH amp Zheng TL 2009 Analysis of
community structure of a microbial consortium capable of degrading benzo(a)pyrene
by DGGE Marine Poll Bull 58 1159-1163
Lynd LR Weimer PJ van Zyl WH amp Pretorius IS 2002 Microbial cellulose utilization
fundamentals and biotechnology Microbiol Mol Biol Rev 66 506ndash577
MacCormack WP amp Fraile ER 1997 Characterization of a hydrocarbon degrading
psychrotrophic Antarctic bacterium Antarct Sci 9 150-155
Macleod CJA amp Semple KT 2002 The adaptation of two similar soils to pyrene catabolism
Environ Pollut 119357-364
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Madden TL Tatusov RL Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts Extremophiles
7451ndash458
McMahon AM Doyle EM Brooksm S amp OacuteConnor KE 2007 Biochemical
charcaterization of the coexisting tyrosinase and laccase in the soil bacterium
Pseudomonas putida F6 Enzyme Microb Tech 401435-1441
Mekenyan OG Ankly GT Veith GD amp Call DJ 1994 QSAR for photoinduced toxicity I
Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere
28 567
Microbics Corporation 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mohn WW amp Stewart GR 2000 Limiting factors for hydrocarbon biodegradation at low
temperature in Artic soils Soil Biol Biochem 321161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Pickard MA Roman R Tinoco R Vazquez-Duhalt R 1999 Polycyclic aromatic
hydrocarbon metabolism by white rot fungi and oxidation by Coriolopsis gallica UAMH
8260 laccase Appl Environ Microbiol 65 3805-3809
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
141
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Soriano JA Vintildeas L Franco MA Gonzaacutelez JJ Ortiz L Bayona JM amp Albaigeacutes J 2006
Spatial and temporal trends of petroleum hydrocarbons in wild mussels from the
Galician coast (NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-
90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil In Singh
A Kuhad RC Ward OP (eds) Adv Appl Biorem 103-121 Springer Berliacuten
Sutherland JB Rafii F Khan AA amp Cerniglia CE 1995 Mechanisms of polycyclic
aromatic hydrocarbon degradation p 269ndash306 In L Y Young and C E Cerniglia
(ed) Microbial transformation and degradation of toxic organic chemicals Wiley-Liss
New York NY
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of Xiamen
China Marine Pollut Bull 56 1184-1191
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-95
Wong WSD 2009 Structure and action of ligninolytic enzymes Appl Biochem Biotechnol
157 174-209
Wrenn BA amp Venosa AD 1996 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
142
Yakimov MM Giuliano L Gentile G Crisafi E Chernikova TN Abraham W-R Luumlnsdorf
H Timmis KN amp Golyshin PN 2003 Oleispira antarctica gen nov sp nov a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water Int J
System Evol Microbiol 53779-785
Zhuang W-Q Tay J-H Maszenan AM amp Tay STL 2002 Bacillus naphthovorans spnov
from oil contaminated tropical marine sediments and its role in naphthalene
biodegradation ApplMicrobiol Biotechnol 58547-553
Zimmermann W 1990 Degradation of lignin by bacteria J Biotechnol 13119-130
Proteobacteria
Capiacutetulo
Manuscrito ineacutedito
Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez M amp Peacuterez L
Assessment the efficient of bioremediation techniques (biostimulation bioaugmentation
and natural attenuation) in a creosote polluted soil change in bacterial community
Evaluacioacuten de la eficacia de teacutecnicas de biorremediacioacuten (bioestimulacioacuten bioaumento y
atenuacioacuten natural) en un suelo contaminado con creosota cambios en la comunidad bacteriana
4
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
145
Abstract
The aim of the present work was to assess different bioremediation treatments
(bioaugmentation bioestimulation combination of both and natural attenuation) applied to a
creosote polluted soil with a purpose of determine the most effective technique in removal of
pollutant Toxicity microbial respiration degradation of creosote and PAH (antharcene
phenathrene and pyrene) as well as evolution of bacterial communities by non culture-
dependent molecular technique DGGE were analyzed Results showed that creosote was
degraded through time without significant differences between treatments but PAH were
better degraded by treatment with biostimulation Low temperatures at which the process
was developed negatively conditioned the degradation rates and microbial metabolism as
show our results DGGE results revealed that biostimulated treatment displayed the highest
microbial biodiversity However at the end of the bioremediation process no treatment
showed a similar community to autochthonous consortium The degrader uncultured bacteria
identified belonged to Pseudomonas Sphingomonas Flexibacter all of them involved in
degradation process Particularly interesting was the identification of two uncultured bacteria
belonged to genera Pantoea and Balneimonas did not previously describe as such
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
147
Introduction
Creosote is a persistent chemical compound derived from burning carbons as coal between
900-1200 ordmC and has been used as a wood preservative It is composed of approximately
85 polycyclic aromatic hydrocarbons (PAH) 10 phenolic compounds and 5 nitrogen
and sulfur PAH are a class of fused-aromatic compounds toxic mutagenic bioaccumulative
and persistent in the environment and so the United State Environmental Protection Agency
(US EPA) considered that the removal of these compounds is important and priority Against
physical and chemical methods bioremediation is the most effective versatile and
economical technique to eliminate PAH Microbial degradation is the main process in natural
decontamination and in the biological removal of pollutants in soils chronically contaminated
(MacNaughton et al 1999) in which degrading-bacteria are abundant (Taketani et al
2010) However recently works have reported (Tian et al 2008 Couling et al 2010) the
potential ability to degrade PAH of microorganisms from soils apparently not exposed
previously to those toxic compounds The technique based on this degradation capacity of
indigenous bacteria is the natural attenuation This technique avoid damage in the habitat
(Dowty et al 2001) allowing to retrieve the original conditions of the ecosystem converting
the toxic compounds into harmless (Kaplan amp Kitts 2004 Haritash amp Kaushik 2009)
However this method require a long period or time to remove the toxic components because
the number of degrading microorganisms in soils only represents about 10 of the total
population (Yu et al 2005a) Many of the bioremediation studies are focused on the
bioaugmentation which consist in the inoculation of allochthonous degrading
microorganisms (ie Atagana 2006) However bioaugmentation is a complicate technique
to study because a negative or positive effect depends on the interaction between the
inocula and the indigenous population due to the competition for resources mainly nutrients
(Yu et al 2005b) Other bioremediation techniques as biostimulation consist in to empower
the degrading capacity of the indigenous community by the addition of nutrients to avoid
metabolic limitations (ie Vintildeas et al 2005)
However inconsistent results have been reported with all these previuos treatments
Previous studies have shown that biodegradation rates can be increased (Mills et al 2004)
and have no effect influenced negatively with biostimulation (Yu et al 2005a Chen et al
2008) Similar enhance of biodegradation rates (Atagana et al 2006) and not significant
differences (Vintildeas et al 2005 Yu et al 2005b) have been described with bioaugmentation
It is necessary taking in to account that each contaminated site can respond in a different
way (Vintildeas et al 2005) therefore to carry out an in situ bioremediation process it will be
necessary to design a laboratory-scale assays to determine what technique is more efficient
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
148
on the biodegradation process and the effect on the microbial diversity In addition
previously works (Gonzalez et al 2011) showed that although PAH were completely
consumed by microorganisms toxicity values remained above the threshold of the non-
toxicity Although most of the work not perform toxicity assays these are necessary to
determine effectiveness of a biodegradation The main goal of the present study is to
determine through a laboratory-scale assays the most effective bioremediation technique in
decontamination of creosote contaminated soil evaluating changes in bacterial community
and the toxicity values
Materials and methods
Chemical media and inoculated consortium
The fraction of creosote used in this study was composed of 26 of PAH (naphthalene
05 phenanthrene 51 anthracene 122 pyrene 31 dibenzofurane 13 and
acenaphthene47) Creosote was diluted in acetonitrile (purchased form Sigma Aldrich
Steinheim Germany) in a stock solution of a final concentration of 0439 gmiddotml-1 containing
0117 g PAHmiddotml-1 The culture mediums LuriandashBertani (LB) and Bushnell-Haas Broth (BHB)
were purchased from Panreac (Barcelona Spain) Biostimulated treatments were amended
with BHB as inorganic nutrients source which composition was optimized for PAH-degrading
consortium (C2PL05 consortium) in a previously work (Simarro et al 2010) with the optimum
composition 02 gmiddotlminus1 MgSO4 7H2O 002 gmiddotlminus1 CaCl2 2H2O 0281 gmiddotlminus1 KHPO4 0281 gmiddotlminus1
K2HPO4 002 gmiddotlminus1 NH4NO3 0195 gmiddotlminus1 Fe2(SO4)3 According to Bautista et al(2009) Tween-
80 was the optimal surfactant for PAH biodegradation by bacteria and was added in a critical
micellar concentration (CMC) of 300 μlmiddotml-1 (0012 mM) Bioaugmented treatments were
inoculated with the PAH-degrading consortium C2PL05 extracted from a permanently PAH
contaminated soil from a refinery in Ciudad Real (Spain) and previously identified and
described in Molina et al(2009)
Experimental design
Five different treatments in microcosms designated as T1 to T5 (see Table 1) were carried
out each in duplicate for five sampling times zero 6 40 145 and 176 days from December
2009 to May 2010 In total 40 microcosms containing 550g of natural soil samples collected
from an uncontaminated area of Rey Juan Carlos University in Madrid (Spain) were carried
out The soil obtained from the first top 20 cm and sieved by 2 mm was located in plastic
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
149
trays and randomly arranged outdoor in terrace and protected with a plastic to avoid the rain
and snow on them Each tray except the treatment T1 contained 56 ml of a creosote
solution in n-hexano (0439 g ml-1) with final amount of creosote per tray of 25 g
Microcosms were maintained at 40 of water holding capacity (WHC) considered as
optimum during bioremediation process (Vintildeas et al 2005) For biostimulation microcosms
samples were hydrated with the required amount of the optimum BHB while in treatment no
biostimulated samples were hydrated with only mili-Q water Bioaugmented treatments were
inoculated with 5ml of the consortium C2PL05 (2015x107 plusmn 427x106 cellsmiddotg soil-1 of
heterotrophic microorganisms and 177x105 plusmn 101x105 cellsmiddotg soil-1 of creosote-degrading
microorganisms)
Table 1 Summary of the treatment conditions
Code Treatments Conditions
T1 Untreated soil (control) Uncontaminated soil
T2 Natural attenuation Contaminated soil with 56 ml creosote moistened 40WHC
with 1054 ml mili-Q water
T3 Biostimulation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1104 ml BHB
T4 Bioaugmentation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml mili-Q water 5 ml consortium
C2PL05
T5 Biostimulation
+ Bioaugmentation
Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml BHB inoculated with 5 ml
Characterization of soil and environmental conditions
The water holding capacity (WHC) was measured following the method described by Wilke
(2005) and the water content was calculated through the difference between the wet and dry
weigh after drying at 60ordmC during 1 hour pH was measured using a GLP 21 micro pHmeter
(Crison Barceona Spain) resuspending 1 g of the soil in mili-Q water (110) and incubating it
in an orbital shaker at 150 rpm at 25 ordmC during 1 h Temperature which the experiments were
developed was recorded on a temperature loggers (Tidbit Loggers Onset Computer
Pocasset Mass) located in the site
Total heterotrophic microorganisms (HM) and creosote-degrading microorganisms
(C-DM) of the microbial population of the natural soil was counted using a miniaturized most
probable number technique (MPN) in 96-well microtiter plates with eight replicates per
dilution (Wrenn amp Venosa 1996) The number of cells was calculated with Most Probable
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
150
Number Calculator software Version 404 (Klee 1993)To extract the microorganisms from
the soil 1 g of soil was resuspended in 10 ml of phosphate buffer saline (PBS) and was
shaker at 150 rpm at 25 ordmC during 24 h The HM were determined in 180 μl of LB medium
with glucose (15 gl-1) and C-DM were counted in 180 μl of BHB medium with 10 μl of
creosote stock solution as carbon source
Respiration and toxicity assays
To measure the respiration during the experiments 10 g of soil moistened with 232 ml of
mili-Q water (to maintain a water capacity of 40 WHC) was incubated in duplicate in a
desiccator during 14 days at 25ordmC Replicates contained 14 ml of NaOH 02 M to absorb the
CO2 produced by microorganisms The vials were periodically replaced and checked
calorimetrically with HCl (01M) and phenolphthalein as indicator The test was doing with
BaCl2 (01 M) in excess to ensure the precipitation of carbonates The numbers of moles of
CO2 produced were calculated as a difference between initial moles of NaOH in the
replicates and moles of NaOH checked with HCl (moles of NaOH free)
The toxicity evolution during the PAH degradation was also monitored through a short
screening of the samples with the Microtox TM method with the luminescent bacterium Vibrio
fischeri following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15ordmC
Monitoring the removal of creosote and polycyclic aromatic hydrocarbons
Organic compounds were extracted and analyzed from the microcosms samples at 0 6 40
145 and 176 days by gas chromatography-mass spectrometry (GC-MS) to estimate the
creosote and percentage of PAH depletion A gas cromatograph (model CP3800 Varian
Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary column (15 m
length 025 mm ID 025 μm film thickness) was coupled to a quadruple mass-spectrometer
detector (Model 1200L Varian) The stationary phase was composed by phenyl (5) and
dimethylpolysiloxane (95) as carried gas ice in the mobile phase Temperature gradient
program used was initial temperature of 80 ordmC for 2 min temperature increase to 300 ordmC at
the rate of 1ordmC min-1 final temperature of 300 ordmC for 15 min with a final duration of the
method of 39 min Organic compounds were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inject 05 μl in
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
151
the FDI chromatograph The concentration of each PAH and creosote was calculated from
the chromatograph of the standard curves
DNA extraction molecular and phylogenetic analysis for characterization of the total
microbial population in the microcosms
Non culture-dependent molecular techniques as denaturing gradient gel electrophoresis
(DGGE) was performed to identify non-culture microorganisms and to compared the
biodiversity between treatments and its evolution at 145 and 176 days of the process Total
community DNA was extracted from 25 g of the soil samples using Microbial Power Soil
DNA isolation kit (MoBio Laboratories Solano Beach CA USA) In total suitable yields of
high molecular-weight DNA (5-20 μgg of soil-1) were obtained The V3 to V5 variable regions
of the 16S rRNA gene were amplified using the primers set 16S 518R and 16S 338F-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primer 338F-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded on to a 10
(wtvol) polyacrylamide gels that was 075mm tick and the denaturing gradients used ranged
from 35 to 65 denaturant (more details in Gonzalez et al 2011) Gel were stained with
Syber-Gold and viewed under UV light and predominant bands were excised and diluted in
50μl of mili-Q water Due to impossibility of reamplified bands DNA of the bands was cloned
in the pGEM-T Easy Vector (Promega Madison WI) Plasmids were purified using the High
Pure plasmid Isolation Kit (Roche) and sequenced using the internal primers 338F and 518R
Creosote-degrader uncultured bacterium (DUB) were edited and assembled using version
487 of the BioEdit program (Hall 1999) BLAST search (Madden et al 1996) was used to
find nearly identical sequences for the 16S rRNA sequences determined All DUB identified
sequence and 25 similar sequences downloaded from GenBank were used to perform the
phylogenetic tree Sequences were aligned using the Q-INS-i algorithm (Katoh amp Toh 2008a)
of the multiple sequence alignment software MAFFT version 6611 (Katoh amp Toh 2008b)
aligning sequences in a single step Sequence divergence was computed in terms of the
number of nucleotide differences per site between of sequences according to the Jukes and
Cantor algorithm (1969) The distance matrix for all pair wise sequence combinations was
analyzed with the neighbour-joining method (NJ) of phylogenetic tree construction with 1000
bootstrap replicates by using version PAUP 40B10 (Swofford 2003) In addition maximum
parsimony (MP) was also analyzed (Molina et al 2009) Sequences of Sphirochatea
americans belonged to Sphirochaetes phylum were used as out-group (Gupta amp Griffiths
2002) Images of DGGE were digitalized and DGGE bands were processed using the UN-
Scan-It gel analysis software version 60 (Silk Scientific US)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
152
Statistical analysis
In order to evaluate the effects of treatments on intrinsic growth rate (μ) toxicity degradation
of organic compounds and respiration analysis of variance (ANOVA) were used The
variances were checked for homogeneity by the Cochranacutes test Student-Newman-Keuls
(SNK) test was used to discriminate among different treatments after significant F-test
representing these differences by letters in the graphs Data were considered significant
when p-value was lt 005 All tests were done with the software Statistica 60 for Windows
Differences in microbial assemblages by biostimulation by bioaugmentation and by time
(145 and 176 days) were graphically evaluated with a non-metric multidimensional scaling
(MDS) using PRIMER software (Clarke 1993) The previous period to 145 days was
considered a period of cold conditions and the time from 145 to 176 days a period of higher
temperatures SIMPER method was used to identify the percent contribution of each band to
the similarity in microbial assemblages between factors Bands were considered ldquohighly
influentialrdquo if they contributed to the first 60 of cumulative percentage of average similarity
betweenwithin combination of factors In addition Shannon index (Hacute) was calculated from
DGGE bands applying equation 2 to estimate the ecological diversity of each treatment at
136 and 145 days
Equation 2
where pi is the proportion in the gel of the band i with respect to the total of all bands
detected calculated as coefficient between band intensity and total intensity of all
bands (Baek et al 2007)
Results
Physical chemical and biological characteristics of the natural soil used for the treatments
pH of the soil was slightly basic 84 and the water content of the soil was 10 although the
soil had a high WHC (521) possibly due to their sandy character Initial proportion of C-DM
from natural soil represented only 088 of the total heterotrophic population with a number
of microorganisms two order of magnitude higher (201 x 107 plusmn 427 x 106 cells g soil-1)
Figure 1 shows that the evolution of the monthly average temperature observed during the
experiment and the last 30 years Average temperature decreased progressively from
October to January from 16 ordmC to a minimum average of 6 ordmC starting to increase
progressively to reach a mean value of 21 ordmC in June
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
153
October
November
DecemberJanuary
FebruaryMarch
April MayJune
468
10121416182022
0 day
40 day
145 day
176 day
6 dayT
empe
ratu
re (
ordmC)
Month
Figure 1 evolution of the normal values of temperature (square) and evolution of
the monthly average temperature observed (circle) during the experiment
Respiration of the microbial population
Table 2A shows the ANOVA results concerning to the accumulated values of CO2 produced
for each treatment in each time period (from 0- to 6 days from 40 to 145 days and from 145
to 176 days) Due to interval time was the only significant factor (Table 2A) differences in
percentage of accumulative CO2 by sampling times (6 40 145 and 176 days) were analyzed
and showed in Figure 2 Differences between sampling times showed that the accumulated
percentage of CO2 was significantly higher at 176 days than at other time
6 40 145 17600
10x10-4
20x10-4
30x10-4
40x10-4
50x10-4
a a
b
aCO
2 mol
esg
of
soil
Time (days)
Figure 2 accumulated CO2 issue at 6 40 145 and 176 days Error bars show the
standard deviation and the letters show significant differences between groups
(plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
154
Toxicity assays
Changes on the toxicity during the creosote degradation process (Figure 3A) showed that all
treatments had a similar evolution T1 (uncontaminated) was not toxic (lt20 ) but toxicity of
treatments with creosote increased constantly from initial value of 26 to a values higher
than 50 Only during last period of time (145 to 176 days) toxicity started to decrease
slightly Despite similar toxicity values reached with the treatments interaction between time
periods (0 to 6 days 40 to 145 days and 145 to 176 days) and treatments showed significant
differences (Table 2B) Differences between groups by both significant factors (Figure 3B)
showed that toxicity of all treatments in first time period was significantly lower than in the
other periods Differences in toxicity between the two last periods were only significant for
treatment T4 in which toxicity increase progressively from the beginning
0 6 20 40 56 77 84 91 98 1051121251321411760
10
20
30
40
50
60
70
80
90
100 BA
Tox
icity
(
)
Time (days)T2 T3 T4 T5
c
c
c
b
c
bc
bcbc
aa
aa
Treatment
Figure 3 (A) evolution of the toxicity () of the treatment T1 (square) T2 (circle) T3 (triangle) T4
(inverted triangle) and T5 (rhombus) during the experiment (B) percentage of toxicity of the treatment
in the interval times 1 (black bars) from 0- to 6 days interval 2 (with bars) from 6 to 40 days and
interval 3 (gray bars) from 40 to 176 days Error bars show the standard deviation and letters
differences between groups
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
155
Biodegradation of creosote and polycyclic aromatic hydrocarbons
The results concerning the chromatography performed on the microcosms at 0 40 145 and
176 days are shown in Figure 4 Creosote depletion during first 40 days was very low
compared with the intensive degradation occurred from 40 to 145 days in which the greatest
amount of creosote was eliminated (asymp 60-80) In addition difference between residual
concentration of PAH at final time by type of PAH (phenanthrene anthracene and pyrene)
and treatment were analyzed (Table 2C) Both factor were significantly influential although
was not the interaction between them Differences by PAH (Figure 4B) showed that
anthracene degradation was significantly higher than other PAH and differences by
treatments (Figure 4C) showed that difference were only significant between treatment T3
and T2 lower in the treatment T3
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
156
T1 T2 T3 T4 T50000
0005
0010
0015
0020
0025
0030
0035
0040
g cr
eoso
te
g so
il
Phenanthrene Anthracene Pyrene0
102030405060708090
100
C
aab
abb
a
bb
B
A
Ave
rage
res
idua
l con
cenr
atio
n of
PA
H (
)
T2 T3 T4 T50
102030405060708090
100
Tot
al r
esid
ual c
once
ntra
tion
of
PA
H (
)
Figure 4 (A) creosote depletion during the experiment at sampling times 6 days (black
bars) 40 days (with bars) 145 days (grey bars) and 176 days ( ) (B) average residual
concentration at 176 days of the identified PAH (phenanthrene anthracene and pyrene)
and (B) average residual concentration of the identified PAH as a function of applied
treatment (C) Error bars show the standard error and the letters show significant
differences between groups (plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
157
Table 2 Analysis of variance (ANOVA) of the effects on the μ of the
heteroptrophic population (A) μ of the creosote degrading microorganisms (B)
accumulated value of CO2 (C) toxicity (D) and residual concentration of PAH (E) SS is
the sum of squares and df the degree of freedoms
Factor df SS F P
C) Accumulated value of CO2 (n=40) Time interval 3 65-5 3112
Treatment 4 60-6 202 ns
Interval x Treatment 12 11-5 134 ns
Error 20 14-5
D)Toxicity (n=24) Time interval 2 907133 11075
Treatment 3 12090 098 ns
Interval x Treatment 6 122138 497
Error 12 49143
E) Residual concentration of the PAH (n=24) Treatment 3 95148 548
PAH 2 168113 1452
Treatment x PAH 6 17847 051 ns
Error 12 69486
p-value lt 005
p-value lt 001
p-value lt 0001
Diversity and evolution of the uncultivated bacteria and dynamics during the PAH
degradation
The effects of different treatments on the structure and dynamics of the bacterial community
at 145 days and 176 days were analyzed by DGGE (Figure 5) At 145 days 8 bands (3 4 10
810 16 17 26 and 27 see Figure 5) were cloned and 6 different genotypes (DUB 12-RS to
DUB-17RS) were identified whereas at 176 days 5 bands (4 112 113 22 and 26 see
Figure 5) and 6 different genotypes (DUB-12RS DUB-13RS DUB-18RS DUB-19RS DUB-
20RS and DUB-21RS) were identified Most influential bands considered as 60 of
contribution to similarity according to the results of PRIMER analysis is showed at the Table
3 Similarities between treatments at 145 and 176 days were compared and analyzed as a
function of the addition of nutrients (biostimulated vs no biostimulated treatments) and the
addition of degrading consortium C2PL05 (bioaugmentated vs no bioaugmentated
treatments) The addition of nutrients was the factor that best explained differences between
treatments and so results in Table 3 are as a function of the addition of nutrients At 145
days no-biostimulated treatments T1 T2 and T4 were only similar in 402 whereas
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
158
biostimulated treatments (T3 and T5) were 6567 (Table 3) The patter were slightly
opposite at 176 days where no-biostimulated treatments were more similar (7026 ) than
biostimulated treatments (average similarity 4384 ) In addition at 145 days (Figure 6A)
natural attenuation (T2) was the only similar treatment to microbial community from the
uncontaminated treatment (T1) However at 176 days (Figure 6B) bacterial communities
from all treatments were highly different to the treatment T1 and there was no defined group
In addition PRIMER analysis allowed us to estimate the Shannon diversity index (Hacute) for
each treatments at 145 and 176 days indicating that the bacterial diversity increased for the
treatments T1 (3328) T3 (4154) and T5 (3739) remarkably higher in the treatment T4
Table 3 Bands contribution to 60 similarity primer between treatments grouped by
treatments biostimulated and no biostimulated at 145 days and 176 days Average
similarity of the groups determined by SIMPER method
145 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
3 DUB-12RS
DUB-17RS 2875
16 DUB-17RS 1826
17 DUB-12RS
DUB-16RS 1414
18 Unidentified 3363
19 Unidentified 3363
Cumulative similarity () 6725 6115 Average similarity () 402 6567
176 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
11 Unidentified 2116 13 Unidentified 2078 1794
23 Unidentified 2225 2294
26 DUB-13RS 1296
Cumulative similarity () 6418 5383 Average similarity () 7026 4384
bands from DGGE unidentified after several attempts to clone
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
159
Figure 5 Denaturing gradient gel electrophoresis (DGGE) at 145 days (A) and 176 days (B) of PCR-
amplified 16S rDNA gen fragments from the consortium C2PL05 (lane B) control experiment (lane C)
treatment with natural attenuation T1 (lane T1)biostimulated treatment T2 (lane T2) bioaugmentated
treatment T3 (lane T3) bioaugmentated treatment T4 (lane T4) and biostimulated and
bioaugmentated treatment t5 (lane T5) Lane A is the molecular weigh marker Numbers are the
bands cloning
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
160
Figure 6 proximity analysis (MDS) based on the Bray-Curtis dissimilarity
matrix of each treatment from the bands obtained in DGGE at 145 days (A)
and 176 days (B)
Phylogenetic analyses
Phylogenetic relationships of the degrading uncultured bacteria are shown in Figure 7 The
aligned matrix contained 1373 unambiguous nucleotide position characters with 496
parsimony-informative Parsimony analysis of the data matrix yielded 87 parsimonious trees
with CI = 0671 RI = 0767 and a length of 1452 Figure 6 also shows the topology of the
maximum parsimony (MP) tree with the bootstrap values of the maximum parsimony and
neighbour joining analyses Inconsistencies were not found between parsimony and
neighbour joining (NJ) topology
Phylogenetic tree was composed by bacteria belonged to Proteobacteria (α- and γ-
Proteobacteria) and Bacteroidetes phylum From DUB-12RS to DUB-17RS were located in
the Pseudomonadaceae clade in which it can be observed five clearly species groups DUB-
13RS and DUB-15RS identified as Pseudomonas trivialensis (HM134251) and P poae
(HM640290) respectively were in an undifferentiated group supported by P trivialensis and
P poae type-strains DUB-14RS similar to P viridiflava (HM190224) formed a group
supported by P viridiflavaT (HM190229) DUB-12RS 98 similar to P fluorescens (GQ
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
161
496662) was grouped with P fluorescensT (D84013) DUB-16RS was identified as
uncultured Pseudomonas sp (HQ677222) and classified in an indefinite group Finally the
last group of the Pseudomonadaceae clade was formed by DUB17-RS 98 similar to P
parafulva (HQ406758) and grouped with P parafulvaT (D84015) DUB-21RS was nested in
the Enterobacteriaceae clade due to it was identified with 99 of similarity as Pantoea
Brenneri (HM163514) This clade is supported by types-strains of other species of Pantoea
as Pantoea agglomeransT (FJ613819) and other enteric bacteria as Enterobacter cloacaeT
(AJ251469) DUB nested in Enterobacteriaceae and Pseudomonadaceae clade were γ-
Proteobacteria In α-Proteobacteria class are included Rhizobiales and
Sphingomonadaceae clades In the first clade formed by uncultured Balneimonas and
Rihzobiales bacterium supported by Balneimonas floculansT was nested DUB-19-RS 99
similar to an uncultured Balneimonas strain (HM799006) In Sphingomonadaceae clade was
nested DUB-20RS identified as uncultured Sphingomonadales bacterium DUB-18RS was
similar in 99 to Uncultured Flexibacteriaceae bacterium and was nested in Cytophagaceae
clade belonging to Bacteroidetes phylum
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
162
Figure 7 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrading uncultured bacteria (DUB) obtained from DGGE of the treatments 145 and 176 days of the
process Boostrap values of neighbourjoining and parsimony higher than 50 are showed on the
branch of the tree (NJMP) No incongruence between parsimony and neighbour joining topology were
detected Pseudomonas genus has been designated as P Pantoea genus as Pa Balneimonas as B
and Bacteriovorax as Ba Hidrogenymonas as H Flexibacerium as F T= type strain
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
163
Discussion
The estimated time of experimentation (176 days) was considered adequate to the complete
bioremediation of the soil according to previous studies developed at low temperatures (15
ordmC ndash 5 ordmC) in which toxicity was reduced below 20 in 101 days and PAH were removed in
137 days above 60 (Simarro et al under review) However our results confirm that
toxicity evaluation of the samples is necessary to know the real status of the polluted soil
because despite creosote was degraded almost entirely (Figure 4A) at the end of the
experiment toxicity remained constant and high during the process (Figure 3A) Possibly the
low temperatures under which was developed the most of the experiment slowed the
biodegradation rates of creosote and its immediate products which may be the cause of
such toxicity In addtion the most removal of creosote (Figure 4A) and higher respiration
rates (Figure 2) occurred from 40 days when temperature began to increase Hence our
results according to other authors (Margesin et al 2002) show that biodegradation at low
temperatures is possible although with low biodegradation rates due to slowdown on the
diffusion rate PAH bioavailability and metabolisms rates (Haritash amp Kaushik 2009 Leahy amp
Colwell 1990)
As in a previously work (Margesin amp Schinner 2001) no significant differences were
observed between treatments in degradation of creosote The final percentage of creosote
depletion above 60 in all treatments including natural attenuation confirm that indigenous
community of the soil degrade creosote efficiently Concurring with these results high
number of creosote-degradaing microorganisms were enumerated in the natural soil at the
time in which the disturbance occurred There is much controversy over whether
preexposure to a pollutant is required for degradation (Johnsen amp Karlson 2005) or if it is a
characteristic intrinsically present in some species of the microbial community that is
expressed when community is exposed to a pollutant (Tian et al 2008 Spain amp van Veld
1983) According to Tian et al 2008) and similarly as in previuosly work in which a wood
degrading consotium from a free polluted soil degraded PAH efficiently bacterial consortium
from natural soil never preexposed to creosota was able to efficiently degrade the
contaminant
Traditionally is widely tested (Yachi amp Loreau 1999) and accepted that higher
diversity leads to greater protection against disturbances (Vilaacute 1998) because the
functionality is higher Bacterial diversity of the biostimulated treatments (T3 and T5) notably
increased during the biodegradation process and showed (T3) a significantly enhance of the
PAH depletion Hence the higher biodiversity of the biostimulated treatment could contribute
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
164
to the increased of PAH degradation Overall the soil microbial community was significantly
altered in the soil with the addition of creosote is evidenced by the reduction of the size or
diversity of the various population of the treatments precisely in treatments no biostimulated
Long-term exposure (175 days) of the soil community to a constant stress such as creosote
contamination could permanently change the community structure as it observed in DGGEN
AND mds Bioaugmentation (T4 and T5) not resulted in a significant increase of the reduction
of creosote or PAH possibly due to the high adaptability of the indigenous consortium to
degrade PAH The relationship between inoculated and autochthonous consortium largely
condition the results of bioaugmentation Some authors (ie Herwijnen et al2005 Andrenoi
amp Gianfreda 2007) purpose that this technique only has positive effects when indigenous
consortium is no capable to degrade The indigenous microbial community demonstrated
capacity to degrade creosote explains the ineffectiveness of bioaugmentation A study of the
bacterial communities during a bioremediation process is important because such as
demonstrate our results bioremediation techniques cause changes in microbial communities
Most of the DUB identified have been previously related with biodegradation process
of PAH creosote andor diesel 60 of the DUB identified (DUB-12RS to DUB17RS)
belonged to Pseudomonas genus widely studied in bioremediation (ie Ma et al 2006
Molina et al 2009) Our results showed that it was the unique representative group at 145
days and the most representative at 176 days of the biodegradation process However in
this work it has been identified some species of Pseudomonas grouped in P trivialis P poae
and P Viridiflava clades (DUB-13RS DUB-15RS and DUB-14RS respectively) less
commonly described in biodegradation process (ie Bogan et al 2003) α-Proteobacteria
class was composed by DUB-19RS (Uncultured balneimonas) and DUB-20RS (Uncultured
Sphingomonadales bacterium) DUB-18RS belonged to phylum Bacteroidetes previously
identified in degradation of high-molecular-mass organic matter in marine ecosystems in
petroleum degradation process at low temperatures and in PAH degradation during
bioremediation of creoste-contaminated soils (Cotrell amp Kiechman 2000a Brakstad et al
2006 Vintildeas et al 2005) Something important to emphasize is the identification of the
Pantoea brenneri (DUB-21RS Enterobacteriaceae clade) and an uncultured Balneimonas
bacteria (DUB-19RS Metylbacteriaceae Rhizobiales clade) as creosote degrader because
have not been previously described as such However very few reports have indicated the
ability to degrade PAH of some genera of the enteric bacteria group as Enterobacter (Molina
et al 2009) Klebsiella (Grant et al 1967) or Escherichia (Diaz et al 2001)
In conclusion temperature is a very influential factor in ex situ biodegradation process
that control biodegradation rates toxicity reduction availability of contaminant and bacterial
metabolisms and so is an important factor to take into account during bioremediation
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
165
process Biostimulation was the technique which more efficiently removed PAH compared
with natural attenuation In this work bioaugmentation not resulted in an increment of the
creosote depletion probably due to the ability of the indigenous consortium to degrade
Bioremediation techniques produce change in the bacterial communities which is important
to study to evaluate damage in the habitat and restore capability of the ecosystem
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
166
References
Andreoni V amp Gianfreda L 2007 Bioremediation and monitoring of aromatic-polluted
habitats Appl Microbiol Biotechnol 76 287-308
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Baek SH Kim KH Yin CR Jeon CO Im WT Kim KK amp Lee ST 2003 Isolation and
characterization of bacteria capable of degrading phenol and reducing nitrate under
low-oxygen conditions Curr Microbiol 47462-466
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Behrendt U Ulrich A amp Schumann P 2003 Fluorescent pseudomonas associated with the
phyllosphere of grasses Pseudomonas trivialis sp nov Pseudomonas poae sp nov
and Pseudomonas congelans sp nov Int J Syst Evol Microbiol 53 1461ndash1469
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0-5 ordmC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Bodour AA Wang JM Brusseau ML amp Maier RM 2003 Temporal changes in culturable
phenatrhene degraders in response to long-term exposure to phenantrhene in a soil
column system Environ Microbiol 5 888-895
Bogan BW Lahner LMamp Sullivan WR 2003 Degradation of straight-chain aliphatic and
high molecular weight polycyclic aromatic hydrocarbons by a strain of Mycobacterium
austroafricanum J Appl Microbiol 94 230-239
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Pollut Bull 57 695-702
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Austral Ecol 18 117-143
Cotrell MT amp Kirchman DL 2000 Natural assemblages of marine proteobacteria and
members of Cytophaga-Flavobacter cluster consuming low- and high molecular
weight dissolved organic matter Appl Environ Microbiol 66 1692-1697
Couling NR Towel MG Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158
3411-3420
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
167
Diaz E Fernandez A Prieto MA amp Garcia JL 2001 Bioremediation of aromatic
compounds by Eschericlia coli Microbiol Mol Biol Rev 65 523-569
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosm
simulation Marine Environ Res 52 195-211
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grant DJW 1967 Kinetic aspect of the growth of Klebsiella aerogenes with some
benzenoid carbon sources J Gen Microbiol 46 213-224
Hall TA 1999 bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 4195-98
Haritash AK Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJWuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kaplan CW Kitts CK 2004 Bacterial succession in a petroleum land treatment unit Appl
Environ Microbiol 70 1777-1786
Karen M amp Chistoserdov AY 2001 Phylogenetic analysis of the sucession of bacterial
communities in the Great South Bay (Long Island) Microb Ecol 35 85-95
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Klee AJ 1993 A computer program for the determination of the most probable number and
its confidence limits J Microbiol Methods 18 91-98
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Loacutepez Z Vila J Ortega-Calvo JJ amp Grifoll M 2008 Simultaneous biodegradation of
creosote-polycyclic aromatic hydrocarbons by a pyrene-degrading Mycobacterium
Appl Microbiol Biotechnol 78 165-172
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
168
MaY Wang L amp Shao Z 2006 Pseudomonas the dominant polycyclic aromatic
hydrocarbon-degrading bacteria isolated from Antarctic soils and the role of large
plasmids in horizontal gene transfer Environ Microbiol 8 455ndash465
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Methods
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
McConkey BJ Duxbury CL Dixon DG amp Greenberg BM 1997 Toxicity of a PAH
photooxidation product to the bacteria Photobacterium phosphoreum and the
duckweed Lemna gibba Effects of phenanthrene and its primary photoproduct
phenanthrenequinone Environ Toxicol Chem 16 892-899
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill App
Environ Microbiol 65 3566-3574
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2011 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Pollut 217 365-374Surridge
AKJ Wehner FC amp Cloete TE 2009 Bioremediation of polluted soil En Singh A
Kuhad RC Ward OP (eds) Adv Appl Biorem p103-121 Springer Berliacuten
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull 56 1184-1191
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
169
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol Progr Ser 390 55-65
Vilagrave M 1998 Efectos de la diversidad de especies en el funcionamiento de los ecosistemas
Orsis 13 105-117
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-97
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Yachi S amp Loreau M 1999 Biodiversity and ecosystem productivity in a fluctuating
environment The insurance hypothesis Proc Natl Acad Sci USA 96 1463-1468
Yu SH Ke L Wong YS amp Tam NFY 2005a Biodegradation of polycyclic aromatic
hydrocarbons (PAHs) by a consortium enrichment from mangrove sediments Environ
Int 32 149-154
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005b Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
bull Discusioacutengeneral
II
Discusioacuten general
173
Discusioacuten general
Temperatura y otros factores ambientales determinantes en un proceso de
biodegradacioacuten
El resultado final de la aplicacioacuten directa de teacutecnicas de biorremediacioacuten en un medio
contaminado estaacute fuertemente influenciado por los paraacutemetros ambientales Por este motivo
son numerosos los estudios (ej Chaicircneau et al 2005 Cheung amp Kinkle 2005 Leys et al
2005 Chen et al 2008) realizados para optimizar y en la medida de lo posible modificar
tanto los factores bioacuteticos como abioacuteticos Frecuentemente la optimizacioacuten se ha llevado a
cabo considerando exclusivamente un solo factor implicado por ejemplo la temperatura
(Torres et al 2005) la concentracioacuten de nutrientes y la relacioacuten CNP (Leys et al 2005) o
el tipo de nutrientes y los surfactantes adicionados (Cheung amp Kinkle 2005) Pocos son los
estudios en los que se valoran dos o tres factores conjuntamente (Kaumlstner et al 1998
Cheung amp Kinkle 2005) y menos auacuten en los que se combinan maacutes de cuatro paraacutemetros
variables Chen et al (2008) destacoacute la importancia de evaluar en el proceso de
optimizacioacuten tanto los efectos individuales como los derivados de la interaccioacuten entre
factores mediante un meacutetodo factorial completo La optimizacioacuten de un proceso de
biorremediacioacuten previo a la aplicacioacuten in situ es fundamental y un disentildeo ortogonal del
experimento va a permitir ademaacutes considerar los efectos sineacutergicos y antagoacutenicos
derivados de la interaccioacuten entre las variables bioacuteticas y abioacuteticas (Chen et al 2008) Los
resultados obtenidos en los dos trabajos de optimizacioacuten que componen el capiacutetulo 1
demuestran que los factores ambientales significativamente influyentes en la tasa de
biodegradacioacuten (kB) de HAP son diferentes cuando se fijan como constantes todos los
paraacutemetros excepto uno (capiacutetulo 1a) que cuando todos los paraacutemetros se consideran
variables y se combinan en un anaacutelisis ortogonal (capiacutetulo 1b) Sin embargo los resultados
obtenidos de un anaacutelisis factorial no invalidan la optimizacioacuten individual la cual es necesaria
y maacutes adecuada en casos en los que tan soacutelo interesa estudiar la influencia de un
determinado factor en el proceso de biodegradacioacuten En algunos casos determinados
paraacutemetros ambientales fijos e inamovibles (ej bajas temperaturas) dificultan el proceso de
biodegradacioacuten y mediante la optimizacioacuten individual y posterior modificacioacuten de otros
factores del medio (ej nutrientes fuente de carbono) se consigue aumentar la eficacia del
proceso Ademaacutes como resultado de la optimizacioacuten indiviadual de factores realizada en el
capiacutetulo 1a de la presente tesis se obtuvo un medio de crecimiento oacuteptimo (capiacutetulo 1) que
que se usoacute en ensayos y experimentos posteriores (capiacutetulos 3 y 4)
Discusioacuten general
174
Dada la elevada variabilidad de resultados que se pueden obtener en la eficacia de
biodegradacioacuten en funcioacuten de los factores ambientales y sus modificaciones proponemos
que los ensayos de optimizacioacuten del proceso para determinar las condiciones oacuteptimas del
mismo es fundamental para maximizar la eficacia (tiempo y costes) de la aplicacioacuten in situ
De entre todos los factores ambientales limitantes de la biodegradacioacuten de
hidrocarburos del petroacuteleo como son los HAP la temperatura es uno de los que maacutes
condiciona la eficacia del mismo (Chen et al 2008) En la presente tesis los procesos de
biodegradacioacuten realizados a bajas temperaturas (capiacutetulo 3 y 4) con el objetivo de evaluar la
influencia de este factor en la eficacia de degradacioacuten y en la comunidad bacteriana
muestran que la degradacioacuten del contaminante es menor a temperaturas inferiores a 15ordmC
(Margesin et al 2002) La notable ralentizacioacuten de las tasas de crecimiento bacteriano y
degradacioacuten a temperaturas bajas (capiacutetulos 3 y 4) fue debida a la menor solubilidad de los
HAP (Haritash amp Kaushik 2009) y al decrecimiento del metabolismo microbiano (Leahy amp
Colwell 1990) Los estudios centrados en la obtencioacuten de la temperatura oacuteptima durante los
procesos de degradacioacuten de HAP por un consorcio bacteriano (Capiacutetulos 1a 1b y 3) han
determinado que no existe un valor oacuteptimo sino maacutes bien un rango oacuteptimo que oscila entre
los 20ordmC y los 30ordmC Tal y como concreta Chen et al (2008) son las fluctuaciones amplias
de temperatura lo que dificulta el proceso de biodegradacioacuten Cuando el rango de variacioacuten
es estrecho y ademaacutes se encuentra dentro de los valores oacuteptimos la influencia es
significativamente despreciable (capiacutetulo 1b) Sin embargo hay que tener presente que
existen ecosistemas susceptibles de ser contaminados en zonas cuyas condiciones
climaacuteticas son extremas Histoacutericamente grandes desastres ecoloacutegicos se han producido en
aacutereas cuyas temperaturas medias estaacuten muy por debajo del rango oacuteptimo como es el caso
del petrolero Exxon Vadez en Alaska (Bence et al 1996) o el Prestige en Espantildea (Soriano
et al 2006) A pesar de la evidente importancia de este aspecto poco se sabe sin embargo
de la degradacioacuten de HAP a temperaturas friacuteas comprendidas entre los 5 ordmC-15 ordmC la cual
es posible gracias a la presencia de especies psicrotolerantes y psicroacutefilas (ldquocold-adaptedrdquo)
(Margesin amp Schinner 2001) Alguna de estas especies que han adquirido o que poseen
intriacutensecamente la capacidad para degradar hidrocarburos pertenecen a los geacuteneros
Pseudomonas Acinetobacter o Pshycrobacter (Eriksson et al 2003 Margesin et al 2003)
La identificacioacuten de estos geacuteneros en los consorcios bacterianos (C2PL05 y BOS08)
posiblemente ha sido determinante en los procesos de biodegradacioacuten a bajas temperaturas
(capiacutetulos 3 y 4) ya que aunque con menores tasas que a temperaturas altas la
biodegradacioacuten ha sido posible Estas especies son claves para el mantenimiento de dicha
comunidad ya que su actividad metaboacutelica durante periodos de bajas temperaturas o en
ambientes permanentemente friacuteos permite la mineralizacioacuten de los hidrocarburos y
subsecuente formacioacuten de otros compuestos maacutes sencillos y faacuteciles de degradar por el resto
Discusioacuten general
175
de las especies del consorcio o la comunidad (Pelz et al 1999) La utilizacioacuten de consorcios
bacterianos adaptados a climas friacuteos compuestos por especies con capacidad degradadora
puede ser una medida de actuacioacuten fundamental en aacutereas extremas Ademaacutes a partir de
estas cepas psicrotolerantes y psicroacutefilas se estaacuten aislando enzimas oxidativas capaces de
trabajar a bajas temperaturas con un importante potencial en procesos biotecnoloacutegicos
(Cavicchioli et al 2002)
Consorcios bacterianos durante un proceso de biodegradacioacuten factores que
determinan la sucesioacuten de especies
La sucesioacuten de especies en un consorcio durante un proceso de biodegradacioacuten depende
en gran medida de ciertas caracteriacutesticas celulares y metaboacutelicas de las especies que lo
componen sobre todo cuando la fuente de carbono son HAP de alto peso molecular
(Mueller et al 1997) Por ejemplo algunas especies de Pseudomonas (P aeruginosa
Soberon-Chavez et al 2005) tienen la capacidad de producir biosurfactantes para aumentar
la biodisponibilidad de HAP o bien como es el caso de las Gram-positivas la presencia de
una uacutenica membrana permite un transporte maacutes eficaz de los HAP al interior de la ceacutelula
(Mueller et al 1997) En la mayoriacutea de los casos las sustancias que se presentan como
recalcitrantes para una especie individual pueden metabolizarse a traveacutes de secuencias
cataboacutelicas complementarias que presentan las diferentes especies de un consorcio
(Fritsche 1985) De ahiacute que con los consorcios microbianos se puedan obtener tasas de
degradacioacuten mucho maacutes elevadas que con cepas individuales (Bautista et al 2009) Sin
embargo la estabilidad y eficacia de un consorcio bacteriano estaacuten determinadas por las
relaciones de supervivencia entre las especies que lo componen Un caso en el que las
asociaciones bacterianas son fundamentales son los procesos de biorremediacioacuten a bajas
temperaturas ya que tal y como Leahy amp Cowell (1990) exponen los consorcios bacterianos
cuentan con una capacidad enzimaacutetica maacutes amplia que especies aisladas y por tanto
mayor versatilidad y superioridad de supervivencia
Una modificacioacuten sobre el consorcio como es la dilucioacuten del mismo (capiacutetulo 1b)
puede afectar a las tasas de degradacioacuten finales precisamente porque modifican las
relaciones inicialmente establecidas entre las especies Igualmente este paraacutemetro puede
modificar el patroacuten de crecimiento sin que esto suponga un cambio significativo en la tasa de
degradacioacuten (capiacutetulo 1b) hecho que dependeraacute de la capacidad degradadora de la especie
favorecida (Szaboacute et al 2007) Por tanto la concentracioacuten del inoacuteculo introducido en un
medio contaminado puede condicionar la eficacia del proceso
Discusioacuten general
176
En los diferentes experimentos que componen los capiacutetulos de este proyecto doctoral
no se han realizado pruebas fisioloacutegicas para estudiar las rutas metaboacutelicas o la importancia
relativa del cometabolismo que condicionen la sucesioacuten o composicioacuten de especies de una
comunidad Sin embargo los anaacutelisis de la comunidad bacteriana a traveacutes de la
identificacioacuten de especies cultivables (capiacutetulos 2 y 3) y no cultivables (capiacutetulos 2 3 y 4)
mediante teacutecnicas moleculares indican que la comunidad bacteriana cambia y por tanto
existe una sucesioacuten y coexistencia determinada de especies en el tiempo Los resultados
obtenidos en el capiacutetulo 2 indican que las especies del consorcio cambian en funcioacuten de la
fuente de carbono disponible (HAP y subproductos de degradacioacuten de HAP) y la presencia
de determinados surfactantes (Tween-80 y HAP o solo HAP) por lo que eacutestos pueden ser
factores que intervienen en la sucesioacuten de especies en un consorcio En muchos procesos
de biodegradacioacuten es comuacuten la adicioacuten de ciertas fuentes de carbono para aumentar la
biomasa de los consorcios bacterianos o cepas concretas y acelerar por tanto el proceso de
biodegradacioacuten (Chen amp Aitken 1999 Lee et al 2003) Sin embargo dada la mencionada
influencia de la fuente de carbono sobre la composicioacuten de especies el resultado de esta
medida puede ser negativo en consorcios bacterianos en los que coexistan especies
degradadoras de una determinada fuente de carbono (ej HAP) con otras que no lo son
(capiacutetulo 1a y 1b) Este hecho es debido a que la adaptacioacuten a la nueva fuente de carbono
de los microorganismos degradadores de HAP se traduce en un aumento de la fase de
latencia y por tanto en un retraso de la tasa de degradacioacuten (Maier et al 2009) Este
fenoacutemeno se pudo observar con claridad cuando se suministroacute al consorcio degradador
C2PL05 glucosa como uacutenica fuente de carbono o en combinacioacuten con HAP (capiacutetulos 1a y
1b)
Nuevas especies bacterianas degradadoras de HAP
La identificacioacuten de especies en los numerosos trabajos de biodegradacioacuten realizados hasta
el momento verifican la existencia de una importante variedad de bacterias degradadoras
de HAP Sin embargo esto no implica que no haya taxa particularmente bien adaptados a
medios contaminados (Mueller et al 1997) y que frecuentemente esteacuten involucrados en
procesos de biodegradacioacuten Este es el caso de geacuteneros como Pseudomonas
Acinetobacter Sphingomonas y Stenothrophomonas identificados durante los ensayos que
componen los capiacutetulos 2 3 y 4 Ademaacutes de la identificacioacuten de especies pertenecientes a
estos geacuteneros ampliamente descritos en procesos de biodegradacioacuten (ej Pseudomonas
Sphingomonas Sphingobium Ralstonia Flexibacter Rhodococcus y Bacillus) cabe
destacar la importancia del aislamiento e identificacioacuten de secuencias englobadas en nuevos
geacuteneros degradadores ineacuteditos hasta el momento o cuya implicacioacuten en estos procesos es
Discusioacuten general
177
escasa Este es el caso de Enterobacter cloacae y E ludwigii (γ-Proteobacterias)
identificadas en el consorcio C2PL05 como degradadoras de HAP de bajo peso molecular
Incluso en un estudio previo (Bautista et al 2009) se ha determinado que la eficacia
degradadora de este geacutenero es mucho maacutes eficaz que otras especies degradadoras
frecuentemente descritas como Pseudomonas fluorescens o Stenotrophomonas maltophilia
Pantoea aglomerans (γ-Proteobacterias) es otra Enterobacteriaceae identificada por primera
vez como degradadora de (capiacutetulo 4) En escasas ocasiones (Toledo et al 2006) una
especie de la familia Enterobacteraceae ha sido identificada como degradadora de HAP o
de crudo (Zhang et al 2010) Asiacute mismo es la primera vez que bacterias Gram-positivas
pertenecientes a los geacuteneros Balneimonas sp (capiacutetulo 4) Bradyrhizobium sp y
Nitrobacteria sp (capiacutetulo 2) todas α-Proteobacterias y por otro lado el geacutenero
Microbacterium sp (Phylum Actinobacterias Capiacutetulo 3) se relacionan con procesos de
biodegradacioacuten de HAP y en procesos de mineralizacioacuten de sustancias recalcitrantes La
presencia de estos organismos debe quedar justificada por su capacidad degradadora dado
que han sido identificadas a partir de bandas de gran intensidad en DGGE teacutecnica que se
ha realizado con muestras procedentes de ensayos de biodegradacioacuten de HAP y creosota
(capiacutetulos 2 3 y 4) Es decir su mera presencia en el consorcio no parece justificable por
causas aleatorias sino maacutes bien por su implicacioacuten directa en los procesos metaboacutelicos
asociados a la degradacioacuten Por ejemplo el aislamiento e identificacioacuten en el capiacutetulo 2 de
especies del geacutenero Nitrobacteria podriacutea estar relacionada con la reduccioacuten de nitritos
presentes en el medio contaminado (capiacutetulo 2 Gonzaacutelez et al 2010)
Los resultados de identificacioacuten mediante teacutecnicas moleculares muestran la evidente
variedad de geacuteneros implicados en estos procesos La variabilidad observada fue mucho
menos intensa con las teacutecnicas moleculares dependientes de cultivo (capiacutetulo 2) ya que tan
solo entre un 1 y un 10 del total de bacterias del suelo son cultivables (Nannipieri et al
2003) Algunos autores (Menn et al 1993 Okpokwasili et al 1986) proponen que los genes
cataboacutelicos para la degradacioacuten de HAP probablemente se transmitan horizontalmente
mediante plaacutesmidos entre bacterias pertenecientes a grupos taxonoacutemicos muy diferentes
Mueller et al (1997) afirman que no es probable encontrar una clara relacioacuten entre grupos
taxonoacutemicos de bacterias y la produccioacuten de enzimas implicadas en la degradacioacuten de
hidrocarburos aromaacuteticos Por tanto no es extrantildeo que genes homoacutelogos (en este caso
degradativos) se expresen en bacterias que taxonoacutemicamente estaacuten muy poco relacionadas
(capiacutetulos 2 3 y 4) otorgando una alta variabilidad al conjunto de bacterias con capacidad
degradadora
Discusioacuten general
178
Preexposicioacuten a los HAP iquestes necesaria para una biodegradacioacuten eficaz HAP
Tradicionalmente algunos autores han sugerido que la preexposicioacuten de bacterias a un
determinado contaminante es necesaria para la adaptacioacuten y consecuente degradacioacuten
(Spain amp van Veld 1983) o para un aumento en la tasa del proceso (Haritash amp Kaushik
2009) Sin embargo autores como Johnsen amp Karlson (2005) se plantean si eacutesta es una
capacidad presente en las comunidades microbianas independientemente de su previa
exposicioacuten o si es una capacidad inducida por la exposicioacuten a elevados niveles de
contaminante Los procesos de biodegradacioacuten realizados con consorcios bacterianos
procedentes de zonas libres de contaminacioacuten por HAP (capiacutetulos 3 y 4) indican que eacutesta
es una capacidad intriacutenseca en las bacterias e independiente de la previa exposicioacuten y que
se manifiesta ante un periodo de contaminacioacuten Los geacuteneros identificados en el capiacutetulo 3
(Ralstonia Pseudomonas o Bacillus) son propios de sistemas con un alto contenido en
madera en descomposicioacuten en los que contribuyen a la degradacioacuten de lignocelulosa
celulosa y sus subproductos mediante enzimas oxidativas (Rastogi et al 2009) Las
enzimas lignoliacuteticas de los hongos saproacutefitos degradan compuestos con estructuras
quiacutemicas similares a la lignina como son los HAP (Hatakka 1994 2001 Barr amp Aust 1994
Meulenberg et al 1997) Por tanto las especies bacterianas con la bateriacutea enzimaacutetica para
degradar subproductos de lignina y celulosa pueden tambieacuten adaptarse y metabolizar HAP
(Tian et al 2008 Couling et al 2010) La capacidad degradadora de este tipo de
compuestos no solo se transmite de manera vertical sino que la transferencia horizontal de
genes puede ser tambien un factor determinante para la adquisicioacuten de esta capacidad entre
los microorganismos del consorcio o comunidad
Los resultados referentes a la alta capacidad degradativa que muestra el consorcio
BOS08 procedente de una zona limpia (capiacutetulo 3) gozan de una extraordinaria importancia
a nivel aplicado y ecoloacutegico La mayoriacutea de los trabajos que estudian el posible paralelismo
entre la degradacioacuten de lignina y la de compuestos aromaacuteticos se han llevado a cabo con
hongos maderables de la llamada ldquopodredumbre blancardquo El hecho de que un consorcio
bacteriano no adaptado a la degradacioacuten de HAP sea capaz de metabolizar eficazmente
HAP de alto peso molecular y ademaacutes disminuya la toxicidad del medio por debajo del
umbral de la toxicidad incluso a bajas temperaturas sin duda abre un campo de
investigacioacuten muy amplio dentro de la biorremediacioacuten Ecofisioloacutegicamente hablando
resultan tambieacuten de gran intereacutes estas espcies que han sido capaces de readaptar su
bateriacutea enzimaacutetica para metabolizar una fuente de carbono altamente recalcitrante y toacutexica
que no estaba presente en su medio natural
Discusioacuten general
179
Posibles actuaciones en un medio contaminado
Ante un caso de contaminacioacuten de un medio con HAP o sustancias que los contengan la
biorremediacioacuten resulta una de las teacutecnicas maacutes eficaces y respetuosas con el medio La
atenuacioacuten natural del contaminante por los microorganismos presentes en el propio medio
depende seguacuten Frosyth et al (1995) del tamantildeo de la poblacioacuten degradadora autoacutectona No
obstante los resultados obtenidos durante el proceso de biorremediacioacuten de un suelo
contaminado con creosota (capiacutetulo 4) indican que los resultados que puede ofrecer la
atenuacioacuten natural no dependen uacutenicamente del nuacutemero inicial de microorganismos
degradadores Las pruebas realizadas indicaron en el momento que se produjo la
contaminacioacuten la actividad degradadora era nula aunque tras un corto peridodo de
exposicioacuten al mismo comenzoacute la actividad de los microorganismos degradadores Esto
quiere decir que aunque en un primer momento la poblacioacuten degradadora sea miacutenima la
presencia del contaminante favorece su dominancia y hace patente su capacidad
degradadora Ademaacutes hay que tener en cuenta varias de las cuestiones abordadas en
apartados previos como son la rapidez y facilidad que tienen los microorganismos para
transferir esta capacidad incluso entre diferentes taxas (Menn et al 1993) o la alta
adaptabilidad a una nueva fuente de carbono Sin embargo la atenuacioacuten natural es una
teacutecnica muy ventajosa porque evita dantildeos en la comunidad bacteriana del medio a
diferencia de cualquier otra actuacioacuten que en menor o mayor medida modifican las
condiciones originales del ecosistema
Uno de los principales problemas de la biorremediacioacuten es el tiempo necesario para
la completa eliminacioacuten del contaminante del medio para lo cual se han desarrollado
estrategias de actuacioacuten con el uacutenico objetivo de acelerar y mejorar la eficacia del proceso
La bioestimulacioacuten tiene como principal objetivo potenciar la capacidad degradadora de los
microorganismos degradadores autoacutectonos mediante la adicioacuten de nutrientes inorgaacutenicos al
medio contaminado Sin embargo los resultados referentes a esta teacutecnica no son
concluyentes dada la elevada variabilidad de los mismo Los casos en los que la
bioestimulacioacuten favorece el proceso de biodegradacioacuten estaacuten estrechamente relacionados
con el impedimento de que los nutrientes se conviertan en un factor limitante para los
microorganismos ya que tal y como expone Leys et al (2005) los requerimientos de
nitroacutegeno y foacutesforo aumentan notablemente durante un episodio de contaminacioacuten Sin
embargo son numerosos los estudios que han obtenido resultados desfavorables con esta
teacutecnica debido a cuestiones relacionadas con altos iacutendices de salinidad (Braddock et al
1997) o tal y como se observa en el capiacutetulo 4 con los cambios que la bioestimulacioacuten
genera en la comunidad bacteriana que en muchos casos inducen a relaciones negativas
entre las especies de la comunidad debido a la competencia por los nutrientes (Rolling-
Discusioacuten general
180
Willfred et al 2002) Por otra parte la bioestimulacioacuten durante el proceso de
biorremediacioacuten del suelo contaminado con creosota (capiacutetulo 4) no favorecioacute
significativamente la biodegradacioacuten del contaminante Estos resultados se pueden atribuir a
una concentracioacuten de nutrientes suficientes en el medio o bien a la raacutepida y efectiva
capacidad degradativa de creosota que mostraron los microorganismos autoacutectonos
El bioaumento es una teacutecnica que pretende incrementar la eficacia del proceso de
biorremediacioacuten mediante el inoacuteculo a la poblacioacuten autoacutectona de una poblacioacuten
degradadora previamente definida como tal Sin embargo es un tratamiento complejo cuyos
resultados dependen de algo tan desconocido y variable como son las relaciones entre
especies y comunidades (Yu et al 2005) Por ello no hay gran nuacutemero de artiacuteculos en los
que se describan resultados favorables de esta teacutecnica pero podemos resumir que las
consecuencias del bioaumento dependen fundamentalmente de dos cuestiones Una de
ellas es que las relaciones de competencia que se establecen entre la comunidad
introducida y autoacutectona sean negativas para la poblacioacuten degradadora (Vintildeas et al 2005
Yu et al 2005) relaciones que principalmente estaacuten dirigidas por la competicioacuten por los
recursos (Yu et al 2005) La inexistencia de efectos significativos del bioaumento durante el
proceso de bodegradacioacuten de creosota (capiacutetulo 4) al igual que los descritos por Herwignen
et al (2005) indican que la presencia de una comunidad bacteriana autoacutectona con
capacidad degradadora o que se adapta raacutepidamente como es nuestro caso puede ser otra
de las cuestiones que hagan que el bioaumento no favorezca el proceso
Los ensayos de biorremediacioacuten realizados durante la presente tesis y los
consultados en las diferentes referencias bibliograficas nos llevan a concluir una vez maacutes
que los efectos de las diferentes teacutecnicas de biorremediacioacuten dependen de las condiciones
del medio contaminado y de la poblacioacuten bacteriana que alberga Por ello un estudio previo
que indique las caracteriacutesticas bioacuteticas (capacidad degradadora composicioacuten y evolucioacuten de
la comunidad bacteriana) y abioacuteticas (temperatura ambiente y caracteriacutesticas fisico-quiacutemicas
del suelo) del mismo asiacute como un breve ensayo a escala de laboratorio donde se apliquen
las diferentes teacutecnicas y seleccionando las maacutes adecuadas mejora en gran medida la
efectividad de la biorremediacioacuten in situ
Conclusiones generales
III
Conclusiones generales
183
Conclusiones generales
De los trabajos llevados a cabo en esta tesis doctoral se pueden extraer las siguientes
conclusiones generales
1 La optimizacioacuten de los factores abioacuteticos y bioacuteticos hace que el proceso de
biodegradacioacuten sea maacutes eficaz y permite modificarlo mediante estrategias de
biorremediacioacuten
2 Los factores que realmente influyen significativamente en un proceso se observan
mediante un estudio ortogonal de los mismos porque permite evaluar las
interacciones entre los factores seleccionados
3 No todos los ambientales son limitantes para la degradacioacuten de HAP Po ejemplo la
bioestimulacioacuten con nutrientes inorgaacutenicos no es efectiva en casos en los que la
cantidad de nutrientes en el medio es suficiente La adicioacuten de glucosa como fuente
adicional de carbono no es necesaria cuando el consorcio esta adaptado a los HAP
como fuente de carbono
4 Las actuaciones basadas en la adicioacuten de fuentes de carbono adicionales a los HAP
no son efectivas cuando los consorcios o cepas bacterianas estaacuten adaptadas a los
HAP porque esto supone un periodo de readaptacioacuten
5 La fuente de carbono disponible en cada momento durante un proceso de
biodegradacioacuten de HAP y otras sustancias en el medio como los surfactantes
condicionan la presencia de especies y por tanto la sucesioacuten de las mismas
6 La aparicioacuten de nuevas especies previamente no descritas como degradadoras
puede estar relacionada con la transferencia horizontal de genes degradativos que
en muchos casos ocurre entre grupos taxonoacutemicos poco relacionados lo que
ampliariacutea auacuten maacutes la expresioacuten de la capacidad degradativa en la comunidad
7 La identificacioacuten en un consorcio procedente de una zona limpia y rica en materia
orgaacutenica de especies fundamentales en sistemas de degradacioacuten de madera
sugiere que las enzimas oxidativas usadas por estas especies en la degradacioacuten de
subproductos de lignina y celulosa se emplean en la degradacioacuten de HAP Por tanto
Conclusiones generales
184
la previa exposicioacuten de los consorcios bacterianos o cepas individuales a un
contaminante no es necesaria cuando tienen una bateriacutea enzimaacutetica que se puede
adaptar y metabolizar el contaminante
8 El papel de las especies bacterianas adaptadas a la degradacioacuten de HAP en
ambientes friacuteos (Tordf lt 15ordmC) es fundamental para la biorremediacioacuten en climas
extremos Ademaacutes la actividad de estas especies en periodos de bajas temperaturas
permite el crecimiento de otras especies de la comunidad bacteriana a partir de los
subproductos de degradacioacuten
9 El bioaumento es una teacutecnica cuyos resultados estaacuten ampliamente influenciados por
las relaciones que se establecen entre la comunidad autoacutectona e introducida y soacutelo
se recomienda en aquellos casos en los que la comunidad autoacutectona no tenga
microorganismos degradadores o no sean capaces de desarrollar esta capacidad
Referencias bibliograacuteficas
IV
Referencias bibliograacuteficas
187
Referencias bibliograacuteficas
Aislabie J Foght J amp Saul D 2000 Aromatic hydrocarbon-degrading bacteria from soil near
Scott Base Antarctica Polar Biol 23 183-188
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Baek KH Yoon BD Kim BH Cho DH Lee IS Oh HM amp Kim HS 2007 Monitoring of
microbial diversity and activity during bioremediation of crude oil-contaminated soil
with different treatments J Microbiol Biotechnol 17 67-73
Barkay T amp Pritchart H 1988 Adaptation of aquatic microbial communities to pollutant
stress Microbiol Sci 5165-169
Barr DP amp Aust SD 1994 Mechanisms with rot fungi use to degrade pollutants Environ
Sci Technol 28 78A-87A
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Braddock JF Ruth ML Catterall PH Walworth JL amp McCarthynd KA 1997
Enhancement and inhibition of microbial activity in hydrocarbon contaminated arctic
soil implication for nutrients amended bioremediation Environ Sci Technol 31
2078-2084
Cavicchioli R Siddiqui KS Andrews D amp Sower KR 2002 Low temperature
extremophiles and their applications Curr Opin Biotechnol 13 253-261
Cerniglia1984 Microbial metabolism of polycyclic aromatic hydrocarbons Adv Appl
Microbiol 30 31-71
Cerniglia 1992 Biodegradation of polycyclic aromatic hydrocarbons Biodegradation 2-3
351-368
Referencias bibliograacuteficas
188
Chaicircneau CH Morel J Dupont J Bury E amp Oudot J 1999 Comparison of the fuel oil
biodegradation potential of hydrocarbon assimilating microorganisms isolated from a
temperate agricultural soil Sci Total Environ 227 237-247
Chaicircneau CH Rogeus G Yeacutepreacutemian C amp Outdot J 2005 Effects of nutrients
concentration on the biodegradation of crude oil and associated microbial
populations in the soil Soil Biol Biochem 37 1490-1497
Chauhan A Fazlurrahman Oakeshott JG amp Jain RK 2008 Bacterial metabolisms of
polycyclic aromatic hydrocarbons strategies for remediation Indian J Microbiol
4895-113
Chen S-H amp Aitken MD 1999Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
Environ Sci Technol 33 435ndash439
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of polycyclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Cheung P-Y amp Kinkle BK 2005 Effect of nutrients and surfactant on pyrene mineralization
and Mycobacterium spp populations in contaminated soil Soil Biol Biochem 37
1401-1405
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Clements WH Oris JT amp Wissin TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Leponis macrochirus
Arch Environ Contam Toxicol 26261-266
Colwell RR Mills AL Walker JD Garcia Tello P amp Campos V 1978 Microbial ecological
studies at the Metula spill in the Strait of Magellan J Fish Res Board Can 35573-
580
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Poll 158 3411-
3420
Das K amp Mukherjee AK 2006 Crude petroleum-oil biodegradation efficiency of Bacillus
subtillis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India Bioresour Technol 98 1339-1345
Delille D amp Pelletier E 2002 Natural attenuation of diesel-oil contamination in a subantartic
soil (Crozet island) Polar Biol 25 682-687
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge App Environ Mirobiol 37 729-739
Referencias bibliograacuteficas
189
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosms
simulation Marine Environ Res 52 195-211
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in artic tundra soil Appl Environ Microbiol 67 5107-
5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap
Evolution 39 783-791
Fiechter A 1992 Biosurfactants moving towards industrial application Trends Biotechnol
10 208-217
Fritsche JD 1985 Nature and significance of microbial cometabolism of xenobiotics J
Basic Bacteriol 25 603-619
Forsyth JV Tsao YM amp Bleam RD 1995 Biorremediation when is augmentation needed
In Hinchee RE Fredrickson J amp Alleman BC (Eds) Bioaugmentation for site
remediation Battelle Press Columbus pp 1-14
Ghazali FM Rahman RNZA Salleh AB amp Basr M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grimberg SJ Stringfellow WT amp Aitken MD 1996 Quantifying the biodegradation of
phenanthrene by Pseudomonas stutzeri P16 in the presence of a nonionic surfactant
Appl Environ Microbiol 62 2387-2392
Habe H amp Omori T 2003 Gentics of polycyclic aromatic hydrocarbon metabolisms in
diverse aerobic bacteria Biosci Biotechnol Biochem 67 225-243
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of polycyclic aromatic
hydrocarbons (PAHs) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microbial Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M amp Steinbuchel A (eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJ Wuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
Referencias bibliograacuteficas
190
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Internacional Agency for Research on Cancer 1972-1990 Monographs on the evaluation of
carcinogenics risks on human International Agency for Research on Cancer Lyons
France
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Johnsen AR Wick LY amp Harms H 2005 Principles of microbial PAH-degradation in soil
Environ Pollut 133 71-84
Johnsen AR Lipthay JR Sorensen SJ Ekelund F Christensen P Andersen O
Karlson U amp Jcobsen CS 2006 Microbial degradation of street dust polycyclic
aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil
Environ Microbiol 8535-545
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kanaly RA amp Harayama S 2000 Biodegradation of high molecular weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059-2067
Kaumlstner M Breueer-Jammali M amp Mahro B 1998 Impact of inoculation protocols salinity
and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil Appl Environ Microbiol 64 359-362
Kim Y H Freeman J P Moody J D Engesse K H amp Cerniglia C E 2005 Effects of pH
on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii
PYR-1 Appl Environ Microbiol 67 275ndash285
Koeber R Bayona JM amp Niessner R 1999 Determination of benzene[a]pyrene diones in
air particulates matter with liquid chromatography mass spectrometry Environ Sci
Technol 33 1552-1558
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Lee ML Novotny MV amp Bartle KD 1981 Analytical chemistry of polycyclic aromatic
hydrocarbons Academic Press Inc New York NY
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegrdation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Referencias bibliograacuteficas
191
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation by
Mycobacterium and Sphingomonas in soil Appl Microbiol Biotechnol 66 726-736
Lim LH Harrison RM amp Harrad S 1999 The contribution of traffic to atmospheric
concentration of polycyclic aromatic hydrocarbons Environ Sci Technol 33 3538-
3542
Liu Y Zhu L amp Shen X 2001 Polycyclic aromatic hydrocarbons in indoor and outdoor air of
Hangzhou China Environ Sci Technol 35 840-844
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Maliszewska-Kordybach B 1996 Polycyclic aromatic hydrocarbons in agricultural soils in
Poland preliminary proposals for criteria to evaluate the level of soil contamination
Appl Geochem 11 212-127
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts
Extremophiles 7451ndash458
Martiacuten Guirao L 2007 Aproximacioacuten ecotoxicoloacutegica a la contaminacioacuten por metales
pesados en la laguna costera del Mar Menor Tesis doctoral Universidad de Murcia
Murcia
Menn F-M Applegate BM amp Sayler GS 1993 NAH-plasmid mediated catabolisms of
anthracene and phenanthrene to naphtoic acids Appl Environ Microbiol 59 1938-
1942
Meulenberg R Rijnaarts HHM Doddema HJ amp Field A 1997 Partially oxidized polycyclic
aromatic hydrocarbons show an increased bioavailability and biodegradability FEMS
Microbiol 152 45-49
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Referencias bibliograacuteficas
192
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mueller JG Chapman PJ Blattman BO amp Pritchard PH 1990 Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis Appl
Environ Microbiol 56 1079-1086
Mueller JG Devereux R Santavy DL Lantz SE Willis SG amp Pritchard PH 1997
Phylogenetic and Physiological comparisions of PAH-degrading bacteria from
geographically diverse soils A van Leeuw J Microb 71 329-343
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions European J Soil Sci 54 655-670
Okpokwasili GC Somerville CC Grimes DJ amp Colwell RR 1986 Plasmid-associated
phenanthrene degradation by Chesapeake Bay sediment bacteria A Colloq Inst
Fran Rech Exploit Mer 3 601ndash610
Pelz O Tesar M Wittich RM Moore ERB Timmis KN Abraham WR 1999 Towards
elucidation of microbial community metabolic pathways unrevealing the network of
carbon sharing in a pollutant-degrading bacterial consortium by immunocapture and
isotopic ratio mass spectrometry Environ Microbiol 1167ndash174
Portaels F amp Pattyn SR 1982 Growth of mycobacteria in relation to the pH of the medium
Ann Microbiol 133 213-221
Puntus IF Filonov AE Akhmetov LI Karpov AV amp Boronin AM 2008 Phenanthrene
degradation by bacteria of the genera Pseudomonas and Burkholderia in model soil
systems Microbiology 77 7-15
Rastogi G Muppidi GL Gurram RN Adhikari A Bischoff KM Hughes SR Apel WA
Bang SS Dixon DJ amp Sani RK 2009 Isolation and characterization of cellulose-
degrading bacteria from the deep subsurface of the Homestake gold mine Lead
South Dakota USA J Ind Microbiol Biotechnol 36 585-598
Readman J W Fillmann G Tolosa I Bartocci J Villeneuve J -P Catinni C amp Mee L D
2002 Petroleum and PAH contamination of the Black Sea Marine Pollut Bull 44
48-62
Rolling Willfred FM Milner MG Jones DM Lee K Danniel F Swanell Richard JP amp
Head IM 2002 Robust hydrocarbons degradation and dynamics of bacterial
communities during nutrients-enhanced oil spill bioremediation Appl Environ
Microbiol 68 5537-5548
Rosenberg E amp Ron EZ 1999 High ndash and low- molecular mass microbial surfactant Appl
Microiol Biotechnol 52 154-162
Referencias bibliograacuteficas
193
Santos E C Jacques R J S Bento F M Peralba M-C R Selbach PA Saacute E L S
Camargo FAO 2008 Anthracene biodegradation and surface activity by an iron-
stimulated Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Shuttleworth KL amp Cerniglia E 1995 Environmental aspect of PAH biodegradation Appl
Biochem Biotechnol 54 291-302
Soberon-Chavez G Lepine F amp Deziel E 2005 Production of rhamnolipids by
Pseudomonas aeruginosa Appl Microbiol Biotechnol 68 718-725
Soriano JA Vintildeas MA Franco JJ Gonzaacutelez JM amp Albaigeacutes J 2006 Spatial and
temporal trends of petroleum hydrocarbons in wild mussels from the Galician coast
(NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquat Microb Ecol 47 1-10
Tian L Ma P amp Zhong J-J 2003 Impact of presence of salicylate or glucose on enzyme
activity and phenanthrene degradation by Pseudomonas mendocina Process
Biochem 38 1125-1132
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull56 1184-1191
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons
removal capacities Syst Appl Microbiol 29 244-252
Torres LG Rojas N Bautista G amp Iturbe R 2005 Effect of temperature and surfactantacutes
HLB and dose over the TPH-diesel biodegradation process in aged soils Process
Biochem 40 3296-3302
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated Soil App Environ Microbiol 71 7008-7018
Wagrowski DM amp Hites RA 1997 Polycyclic aromatic hydrocarbons accumulation in urban
suburban and rural vegetation Environ Sci Technol 31 279-282
Referencias bibliograacuteficas
194
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacilus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Pollut 139 1-13
Wu SC amp Gschwend PM 1986 Sorption kinetics of hydrophobic organic compounds to
natural sediments and soil Environ Sci Technol 20 717-725
Ye B Siddigi MA Maccubbin AE Kumar S amp Sikka HC 1996 Degradation of
polynuclear aromatic hydrocarbons by Sphyngomonas paucimobilis Environ Sci
Technol 30136-142
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005 Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
Zender M 1983 Physical and chemical properties of polycyclic aromatic hydrocarbons p 1-
26 In ABjorseth (ed) Handbook of polycyclic aromatic hydrocarbons Marcel
Dekker Inc New York NY
Zhang XX Cheng SP Zhu CJ amp Sun SL 2006 Microbial PAH-degradation in soil
degradation pathways and contributing factors Pedosphere 16 555-565
Zhang Z Gai L Hou Z Yang C Ma C Wang Z Sun B He X Tang H amp Xu P 2010
Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils Bioresource Technol 101 8452ndash8456
Agradecimientos
197
Agradecimientos
Todaviacutea recuerdo el primer diacutea que entre en el departamento en el laboratorio
aquello me parecioacute todo un mundo en el cual sin quererlo y sin estar convencida de
ello acabeacute metida de lleno Poco a poco fueron pasando los meses los antildeos
presenteacute el Practicum y me diacute cuenta de que queriacutea seguir adelante Unos cuantos
antildeos despueacutes he llegado a la meta lo cual no hubiera sido posible sin mucha gente
que me ha apoyado ayudado y empujado en los momentos en los que yo no podiacutea
maacutes A todos ellos gracias por hacer que esto haya sido posible
El primero de mis agradecimientos va dirigido a Natalia Fernando y Mari
Carmen Os tengo que dar las gracias por brindarme la oportunidad de formar parte
del grupo y por tantas cosas que con cada uno de vosotros he aprendido Despueacutes
de estos antildeos creo que hemos conseguido cosas maravillosas aunque hayamos
tenido imprevistos de todo tipo porque como ya sabemos si ponemos un circo nos
crecen los enanoshellippero aquiacute estamos Somos un grupo muy equilibrado
profesionalmente tenemos un poco de todo y por otro lado no es mal balance tres
histeacutericas frente a uno que pone la calma no se como no hemos acabado contigo
Fernando Natalia gracias por hacerme controlar el miura que llevo dentro y tener
tanta paciencia Carmen gracias por estar siempre ahiacute ya sea desde Espantildea desde
el otro lado del charco o nada mas ser mamaacute En todo momento a nivel personal y
profesional me he sentido arropada por vosotros gracias por vuestro apoyo y ganas
de seguir adelante Vosotros habeis sido los responsables de que quiera investigar
Si una persona en concreto se merece especial agradecimiento es mi Yoli
Aunque al principio de todo no nos conociacuteamos no hay mas que vernos ahora Por
un lado ha sido imprescindible la ayuda que me has dado trabajando cuando maacutes
perdida estaba Por todo tu apoyo ten presnete que me has ayudado a escribir cada
una de las liacuteneas que has leiacutedo Has sabido ser mi amiga y estar conmigo cuando
maacutes lo he necesitado y hacer que me olvidara de todo ya sea haciendo toriijas
pizzas viendo una peli tomando una copichuela o con nuestros preciados pinchitos
sobre todo estos uacuteltimos meses estresantes en los que no seacute como no te he vuelto
loca Gracias tambieacuten por hacerme reir hasta llorar por preocuparte cada diacutea de
198
estas uacuteltimas semanas de coacutemo voy por conocerte todas y cada una de las cosas
en las que estoy trabajando y un largo etc Te conoces mejor yo el estado de cada
uno de mis artiacuteculos las correcciones que tengo y las que me faltan Eres estupenda
y espero no dejar de descubrir nunca cosas sobre ti Mil gracias
Son muchas las personas que han pasado por el despacho Pepe aunque
estas muy muy lejos agardezco tu ayuda continua sobre todo en el Maacutester la mitad
de las cosas se me hubieran olvidado si no hubiera sido por ti que cabeza la miacutea
Tambieacuten tengo que recordar a Raquel Felipe y Cris el antiguo equipo Ecotox
pasamos muy buenos ratos que se echan de menos A mis actuales compantildeeros
Alfredo Pesca Julia Silvia y Carlos que aunque no estas en el despacho como si lo
estuvieras Gracias por amenizar las horas de laboratorio y los madrugones Silvia
especialmente a ti gracias por sacar siempre un rato para charlar y escucharnos
mutuamente aunque nos separen un porroacuten de cajas y un poto gigante ahiacute estas
siempre Espero seguir aquiacute mucho tiempo para apoyarte igual que tuacute lo has hecho
conmigo Cris no me olvido de ti que desde el principio y hasta ahora te has
preocupado de saber que tal me iba estabas al tanto de todo y me has animado a
seguir adelante Te deseo que las cosas te vayan genial porque te lo mereces
asique aacutenimo que no es por presionar pero en breve te toca a tiacute Me faltan palabras
para contar todo lo que Moacutenica y Andrea me han ayudado y ensentildeado desde un
primer momento Igualmente agredezco el apoyo que Patri y Ester me han dado al
igual que los buenos ratos cotilleando imprescindibles Tambieacuten tengo que
agradecer a Jose Luis Sanz de la Universidad Autoacutenoma de Madrid que me abriera
las puertas de su laboratorio para aprender la maravillosa teacutecnica del DGGE y unas
cuantas cosas maacutes Ine a tiacute si que te agradezco un montoacuten las horas que has
perdido de tu trabajo para ensentildearme Desde un primer momento simpre con la
sonrisa puesta auacuten sin concocerme de nada Han sido muchos los viajes que he
hecho y el tiempo empleado en ello pero ha merecido la pena Asique igualmente
formas parte de esta tesis porque cada uno de los artiacuteculos no hubieran estado
completos sin tu ayuda
Son muchas las personas que sin formar parte del gremio han estado siempre
presentes Mis padres y mi hermano ya sabeis que no podriacutea hacer nada sin
vosotros a mi lado Durante estos antildeos no habeis dejado de preocuparos por mi y de
apoyarme ni un solo instante maacutes auacuten cuando las cosas han sido tan complicadas
199
para miacute Nada hubiera salido bien sin vosotros una vez maacutes os doy las gracias por
ser tan maravillosos y por teneros Por otro lado mis amigos ellos si que andan
agenos al tema y sin embargo siempre han sabido cuando preguntar y que palabras
usar cuando mas lo he necesitado Tengo que hacer una mencioacuten especial al sentildeor
Jimmy (responsable graacutefico y de disentildeo de la tesis) a ti si que te ha caiacutedo una
buena desde aquella llamada en la que te dije ldquoha llegado el momentordquo A
parte del gran trabajo que has hecho vistiendo la tesis tuacute una de las personas maacutes
sosegadas que conozco has podido aguantar el histerismo de los diacuteas previos a
depositar la tesis Gracias Jimmy eres un sol pero que sepas que auacuten me queda la
defensa oacutesea presentacioacuten en power pointhellipyo no digo nada Tambieacuten
agaradezco al ldquogrupo parkeeerdquo las horas que pasamos en las cuales a parte de
mucho friacuteo tambieacuten pasamos muy buenos ratos Especialmente a Lauri gracias por
acercarte un buen diacutea y preguntarme iquesttodo bien Desde entonces tus achuchones
tus canciones y tu ldquoflower powerrdquo han hecho que me despeje cada tarde Gracias
tambieacuten por interesarte tanto por mi trabajo dentro de poco te lo podreacute presentar
Las uacuteltimas palabras van dirigidas a Javi A ti que has estado conmigo desde el
principio gracias por no dejar que me desquicie y darme siempre tranquilidad Son
muchas las horas que he dedicado a esto y siempre has estado recordaacutendome
cuando era el momeno de parar Gracias por saber comprender lo que hago aunque
a veces me queje tanto y por ayudarme a echarle un par de narices cuando maacutes
desanimada estaba Gracias por hacer que este mundo roto no estropee mi sonrisa
Todo el tiempo que no te he dedicado lo recuperaremos juntos en nuestra casa
A todos y cada uno de vosotros gracias
Raquel
Iacutendice
I Resumen Antecedentes 13 Objetivos 25 Listado de manuscritos 27 Siacutentesis de capiacutetulos 29 Metodologiacutea general 33
Capiacutetulo 1a Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium 47
b Evaluation of the influence of multiple environmental factors on the biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal experimental design 67
Capiacutetulo 2 Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process 85
Capiacutetulo 3 High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures 113
Capiacutetulo 4 Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil change in bacterial community 143
II Discusioacuten general 171
III Conclusiones generales 181
IV Referencias bibliograacuteficas 185
V Agradecimientos 195
Resumen
AntecedentesObjetivos
Listado de manuscritosSiacutentesis de capiacutetulosMetodologiacutea general
I
Resumen Antecedentes
13
Antecedentes
Tal y como su propio nombre indica biorremediacioacuten significa ldquodar remediordquo mediante
teacutecnicas bioloacutegicas por lo que una definicioacuten acertada de biorremediacioacuten seriacutea el conjunto
de teacutecnicas que permiten resolver problemas de contaminacioacuten mediante el uso de
microorganismos (bacterias algas unicelulares etc) hongos plantas o enzimas derivadas
de ellos En el contexto de esta tesis la biorremediacioacuten se aplica a suelos u otros sistemas
contaminados con hidrocarburos aromaacuteticos policiacuteclicos (HAP o PAH siglas en ingleacutes
polyciclic aromatic hydrocarbons) Los HAP son compuestos que se generan por la
combustioacuten incompleta de combustibles foacutesiles por causas naturales y en mayor medida
antroacutepicas Si tenemos en cuenta que el sustento del sistema energeacutetico mundial son los
combustibles foacutesiles podemos hacernos una idea de la relevancia y elevada presencia de
estos compuestos en la vida cotidiana Considerando sus complejas propiedades y su
caraacutecter perjudicial para el ser humano y los ecosistemas (Internacional Agency for
Research on Cancer 1972-1990) los HAP suscitaron una creciente preocupacioacuten a partir
del pasado siglo siendo los primeros carcinoacutegenos ambientales reconocidos (Haritash amp
Kaushik 2009) Eacutesto dio lugar a numerosos estudios cientiacuteficos con el objetivo de
determinar sus efectos en el medio y el ser humano asiacute como a la buacutesqueda de soluciones
para su eliminacioacuten Frente a muchas otras teacutecnicas de eliminacioacuten de contaminantes
(teacutecnicas fiacutesicas yo quiacutemicas) la biorremediacioacuten presenta una caracteriacutestica clave que la
hace destacar sobre las otras teacutecnicas y es que se basa en procesos que respetan el medio
perturbado y permiten en la medida de lo posible su recuperacioacuten
Los hidrocarburos aromaacuteticos policiacuteclicos (HAP) Legislacioacuten espantildeola sobre medios
contaminados
La presente tesis se centra en el estudio de la biodegradacioacuten de los hidrocarburos
aromaacuteticos policiacuteclicos y por ello es esencial conocer a fondo queacute son cuaacuteles son sus
caracteriacutesticas y porqueacute suscitan este intereacutes Los HAP son compuestos quiacutemicos formados
por la fusioacuten de un determinado nuacutemero de anillos de su principal componente aromaacutetico el
benceno La estructura quiacutemica de alguno de los compuestos que han sido utilizados
durante el desarrollo de esta tesis aparecen en la Figura 1
Resumen Antecedentes
14
Figura 1 Hidrocarburos aromaacuteticos poliacuteciacuteclicos de bajo (naftaleno fenantreno y antraceno) y alto peso
molecular (pireno y perileno)
Los HAP se pueden clasificar en funcioacuten del nuacutemero de anillos benceacutenicos en HAP de
bajo (menos de tres anillos) y de alto peso molecular Tan soacutelo el naftaleno fenantreno y
antraceno (dos y tres anillos respectivamente) seriacutean considerados HAP de bajo peso
molecular (Cerniglia 1984 1992) La propiedades quiacutemicas de los HAP y por tanto su
destino en el medioambiente depende del nuacutemero de anillos aromaacuteticos que lo componen y
de su tipologiacutea molecular (Kanaly amp Harayama 2000) Por ejemplo el fenantreno y
antraceno son compuestos isoacutemeros (Figura 1) con el mismo peso molecular porque tienen
el mismo nuacutemero de anillos benceacutenicos pero en distinta disposicioacuten lo que les confiere
distintas caracteriacutesticas quiacutemicas En general a medida que aumenta su tamantildeo peso
molecular y angularidad aumenta su hidrofobicidad y estabilidad electroquiacutemica (Zander
1983) Tal y como algunos trabajos han demostrado eacutestos son dos factores primarios que
contribuyen a la persistencia de los HAP en el medio Por ejemplo de acuerdo con
Shuttleworth amp Cerniglia (1995) la vida media en suelos y sedimentos de un HAP de tres
anillos como el fenantreno podriacutea oscilar en un rango de entre 6 a 126 diacuteas mientras que
para moleacuteculas de cuatro a cinco anillos el tiempo aumentariacutea de 229 a maacutes de 1400 diacuteas
Ademaacutes debido a su naturaleza lipofiacutelica tiene un elevado potencial de bioacumulacioacuten en la
cadena troacutefica fenoacutemeno conocido como biomagnificacioacuten (Clements et al 1994) Se sabe
que los HAP ejercen un acusado efecto toacutexico y poseen propiedades mutageacutenicas
teratogeacutenicas y en algunos casos carcinogeacutenicas (Internacional Agency for Research on
Cancer 1972-1990) De hecho dieciseacuteis HAP han sido clasificados como contaminantes
prioritarios por la US Environmental Protection Agency (Agencia de proteccioacuten ambiental
Resumen Antecedentes
15
de Estados Unidos) y por la Comisioacuten Europea de Medio Ambiente (Maliszewska-Kordybach
1996)
Los HAP estaacuten presentes como constituyentes naturales de los combustibles foacutesiles y
se forman durante la combustioacuten incompleta de la materia orgaacutenica Las fuentes naturales
de produccioacuten de HAP son los incendios forestales y de pastizales yacimientos de petroacuteleo
o erupciones volcaacutenicas (Haritash amp Kaushik 2009) Sin embargo las fuentes antroacutepicas
son las que maacutes contribuyen a su formacioacuten mediante la quema de combustibles foacutesiles con
fines energeacuteticos en el tratamiento de la madera con creosota mediante el uso de
lubricantes y en el refino del petroacuteleo y actividades de transporte (Lee et al 1981) Aunque
los vertidos se produzcan en una zona determinada es posible que la carga contaminante
se extienda si alcanza un efluente o mediante su filtracioacuten a traveacutes del suelo pudiendo
alcanzar acuiacuteferos Otras cargas contaminantes se generan por descarga directa
procedentes de efluentes industriales en grandes superficies de suelos o mares o por la
liberacioacuten accidental de materia prima (Kanaly amp Harayama 2000) Se han detectado HAP
en el aire procedente fundamentalmente de la quema industrial de combustibles foacutesiles y el
traacutefico (Koeber et al 1999 Lim et al 1999) en suelos y en la parte superficial y profunda
de la columna de agua y sedimentos (Readman et al 2002 Johnsen et al 2005 2006) En
alimentos vegetales y plantas aparecen como consecuencia de la difusioacuten y posterior
sedimentacioacuten de los HAP atmosfeacutericos sobre la vegetacioacuten (Wagrowski amp Hites 1997) y
por la adsorcioacuten de HAP acumulados en el agua del suelo
El suelo constituye uno de los medios receptores de la contaminacioacuten maacutes sensibles y
vulnerables Sin embargo y auacuten dada la gravedad y extensioacuten creciente de la contaminacioacuten
con HAP no fue hasta la Conferencia de Naciones Unidas sobre el Medio Ambiente y el
Desarrollo celebrada en Riacuteo de Janeiro en 1992 cuando se reconocioacute y planteoacute de forma
trascendente la importancia de la proteccioacuten de los suelos y la definicioacuten de sus usos
potenciales La Agencia Europea de Medio Ambiente (AEMA) estimoacute en 1999 que el
nuacutemero de zonas o aacutereas contaminadas en Europa Occidental estaba entre 300000 y
1500000
Hasta la promulgacioacuten de la Ley 101998 de 21 Abril de Residuos Espantildea careciacutea de
cualquier instrumento normativo para legislar controlar y proteger lo referente a suelos
contaminados Con esta Ley las Comunidades Autoacutenomas son las encargadas de declarar
delimitar e inventariar los suelos contaminados de sus territorios ademaacutes de establecer las
bases para una determinada actuacioacuten Con el Real decreto 92005 del 14 de Enero se da
cumplimiento a lo dispuesto en la 101998 de Residuos y en eacutel se establece la relacioacuten de
actividades potencialmente contaminantes del suelo y los criterios y estaacutendares para la
Resumen Antecedentes
16
declaracioacuten de un suelo bajo la categoriacutea de ldquocontaminadordquo Uno de los aspectos maacutes
importantes desde el punto de vista de la biorremediacioacuten se recoge en el Artiacuteculo 7 del
Real Decreto 92005 por el cual ldquola declaracioacuten de un suelo como contaminado obligaraacute a la
realizacioacuten de las actuaciones necesarias para proceder a su recuperacioacuten ambientalrdquo
Ademaacutes antildeade que las teacutecnicas deben ser las maacutes apropiadas en cada caso garantizando
soluciones de caraacutecter permanente y prioriza las teacutecnicas de tratamiento in situ que eviten la
generacioacuten traslado y eliminacioacuten de residuos
Lo dispuesto en esta ley sin duda supone un enorme impulso a las teacutecnicas de
biorremediacioacuten ya que a traveacutes de ellas se favorece el tratamiento in situ y la recuperacioacuten
del ecosistema a su estadio original sin generacioacuten de residuos y con el menor impacto
ambiental posible
Factores que condicionan la biodegradacioacuten
Aunque la biodegradacioacuten bacteriana es una de las teacutecnicas maacutes eficaces en la
descontaminacioacuten in situ de medios contaminados con HAP la eficacia y tasas de
biodegradacioacuten dependen en gran medida del nuacutemero y tipo de microorganismo
degradador presente en el medio y de la naturaleza y estructura quiacutemica del contaminante a
degradar (Haritash amp Kaushik 2009) Ademaacutes a la hora de disentildear un sistema de
biorremediacioacuten debemos tener en cuenta que existen muacuteltiples factores ambientales que
van a condicionar la eficacia y la rapidez del proceso con el agravante de que durante la
aplicacioacuten in situ es difiacutecil y en algunos casos imposible poder controlar o modificar alguno
de estos factores La biorremediacioacuten es una teacutecnica eficaz y econoacutemica pero cuenta con la
desventaja del tiempo ya que en algunos casos la descontaminacioacuten del medio y su
recuperacioacuten pueden durar antildeos
Por tanto los estudios de optimizacioacuten en los que se combinen todos los factores
posibles considerando los efectos sineacutergicos y antagoacutenicos son esenciales en
biorremediacioacuten Entre los factores ambientales maacutes estudiados en la literatura destacamos
temperatura pH tipo y concentracioacuten de nutrientes inorgaacutenicos y fuentes de carbono
Temperatura y pH
La temperatura es una de las variables maacutes influyentes en el proceso de biodegradacioacuten
bacteriana ya que afecta tanto a las propiedades fisicoquiacutemicas de los HAP como al
Resumen Antecedentes
17
metabolismo microbiano La temperatura guarda una relacioacuten proporcional con los rangos
de difusioacuten y solubilidad de los HAP e inversamente proporcional con el coeficiente de
particioacuten suelo-agua (Wu amp Gschwend 1986) Mientras que el coeficiente de particioacuten de los
HAP decrece entre un 20-30 por cada incremento de 10ordmC en temperaturas comprendidas
entre los 5 ordmC - 45 ordmC el coeficiente de difusioacuten en agua aumenta entre 4-5 veces con un
incremento de la temperatura de 20 a 120 ordmC Esto se traduce en que cuanto menor es la
temperatura menor es la solubilidad de los HAP en la fase acuosa y consecuentemente
menor es su biodisponibilidad para ser mineralizados por los microorganismos (Haritash amp
Kaushik 2009)
Por otro lado las bajas temperaturas afectan negativamente al metabolismo
microbiano ralentizaacutendolo y aumentando la duracioacuten de la fase de latencia en la que hay
inactividad (Atlas amp Bartha 1972 Eriksson et al 2001) Tal y como se ha demostrado en
estudios previos (Leahy amp Colwell 1990) la velocidad de metabolizacioacuten normalmente se
duplica por cada aumento de 10 ordmC en temperaturas comprendidas entre los 10 y 40 ordmC Sin
embargo y a pesar de las desventajas que las bajas temperaturas presentan para la
biodegradacioacuten existe degradacioacuten de hidrocarburos en ambientes friacuteos cuyas temperaturas
oscilan entre los 0 ordmC ndash 10 ordmC (Margesin et al 2002) Algunos trabajos se han centrado en el
estudio de la biodegradacioacuten en zonas de agua marina y suelos bajo temperaturas
extremadamente bajas (Colwell et al 1978 Mohn amp Stewart 2000 Ericksson et al 2001
Delille amp Pelletiere 2002) obteniendo resultados positivos Sin embargo la mayoriacutea de los
estudios de biodegradacioacuten se han llevado a cabo en condiciones de laboratorio en un rango
de temperaturas comprendido entre los 20 ndash 35 ordmC sin observar a penas diferencias en las
tasas de biodegradacioacuten (Chen et al 2008) Por debajo de estas temperaturas la
degradacioacuten es maacutes complicada porque el metabolismo de los microorganismos se ralentiza
y la solubilizacioacuten de los HAP disminuye Aun asiacute hay bacterias adaptadas a estas
condiciones que hacen posible la degradacioacuten en ambientes con temperaturas extremas
Varias especies de Pseudomonas y Sphingomonas se han identificado como bacterias
degradadoras de HAP en la Antaacutertida (Aislabie et al 2000) Eacutestas y otras especies estaacuten
adaptadas a las temperaturas locales y a otras condiciones de estreacutes ya que durante el
deshielo sobreviven en suelos friacuteos y secos pobres en nutrientes y a menudo alcalinos Sin
embargo la capacidad de estas bacterias para crecer en suelos con condiciones climaacuteticas
suaves y la utilizacioacuten de HAP para su crecimiento implica que estas bacterias son
psicrotolerantes (Aislabie et al 2000) cuya temperatura oacuteptima es superior a los 20 ordmC pero
son capaces de sobrevivir cerca o por debajo de los 0 ordmC Ademaacutes existen algunas especies
cuyo crecimiento se desarrolla en ambientes que permanentemente esteacuten por debajo de los
5 ordmC este grupo de bacterias son psicroacutefilas La temperatura es un factor que difiacutecilmente se
puede controlar o manipular en proyectos de aplicacioacuten in situ por lo que es importante
Resumen Antecedentes
18
elaborar un estudio previo bajo las condiciones del ecosistema afectado Esto es
fundamental sobre todo en ambientes con temperaturas bajas en los que se puede estudiar
queacute otros factores modificar para suplir las desventajas de la temperatura como puede ser
inocular cepas bacterianas adaptadas a las bajas temperaturas aumentar el oxiacutegeno o
adicionar nutrientes En estas condiciones no toda la comunidad tiene por queacute ser eficaz en
la degradacioacuten de un contaminante aunque se ha propuesto que las bacterias y no los
hongos son las mayores colonizadoras y degradadoras (Kerry 1990) La identificacioacuten de
las especies de la poblacioacuten autoacutectona asiacute como la refrenciacioacuten de sus capacidades
metaboacutelicas son muy importantes en la biorremediacioacuten de suelos de ambientes friacuteos Esta
cuestioacuten es especialmente importante en la Antaacutertida ya que el Sistema del Tratado
Antaacutertico prohiacutebe la introduccioacuten de organismos aloacutectonos
Por otro lado el pH es un factor abioacutetico que de forma similar a la temperatura puede
afectar significativamente tanto a la actividad y diversidad microbiana como a la
mineralizacioacuten de los HAP Los rangos de pH oacuteptimos para el proceso de metabolizacioacuten
pueden ser muy variables ya que depende de las caracteriacutesticas del medio contaminado y
de la poblacioacuten microbiana que alberga (Dibble amp Bartha 1979) Las micobacterias son
bacterias neutroacutefilas cuyo pH oacuteptimo es superior 6 (Portaels amp Pattyn 1982) Sin embargo
a paritr de este pH se ha observado que la degradacioacuten de HAP por Mycobacterium es maacutes
eficaz cuando el pH tiende ligeramente a aacutecido (65) porque la membrana de aacutecidos
micoacutelicos es maacutes permeable a compuestos hidrofoacutebicos (Kim et al 2005) Otros autores
han mostrado que para otro tipo de bacterias comuacutenmente descritas en procesos de
biodegradacioacuten como Pseudomonas sp el rango oacuteptimo de pH oscila entre 55 y 78
notablemente mejor cuanto maacutes neutro (Dibble amp Bartha 1979) El uso de ciertos
surfactantes puede causar la basificacioacuten del medio (Bautista et al 2009) por lo que este
aspecto debe ser considerado a la hora de disentildear un proceso de biorremediacioacuten Tambieacuten
se pueden generar variaciones de pH durante el proceso como consecuencia de los
metabolitos intermedios derivados de los HAP Por ejemplo al comienzo de la degradacioacuten
se generan metabolitos con grupos hydroxiacutelicos que producen un aumento del pH (Habe amp
Omori 2003 Puntus et al 2008)
Nutrientes inorgaacutenicos
Ante una perturbacioacuten por un contaminante el requerimiento de nutrientes de las bacterias
degradadoras del ecosistema aumenta para poder metabolizar el aporte extra de carbono
que supone el contaminante Por este motivo en biorremediacioacuten es importante encontrar
una relacioacuten oacuteptima de carbononitroacutegenofoacutesforo (CNP) que tradicionalmente se han fijado
Resumen Antecedentes
19
en 100101 (ej Bouchez et al 1995) Sin embargo este aspecto es objeto de controversia
ya que otros autores (Leys et al 2005) han demostrado que la relacioacuten anteriormente
propuesta como oacuteptima puede ser insuficiente limitando el crecimiento bacteriano y por
tanto ralentizando la biodegradacioacuten La bioestimulacioacuten es una teacutecnica de biorremediacioacuten
que consiste en la adicioacuten de nutrientes inorgaacutenicos a los substratos contaminados La
disponibilidad de nutrientes es un aspecto muy importante en la eficacia de la
biodegradacioacuten Nutrientes como el nitroacutegeno el foacutesforo o el hierro son esenciales para el
metabolismo bacteriano en general y mucho maacutes en el caso de biorremediacioacuten de medios
contaminados por HAP Aunque la mayoriacutea de los trabajos indican que la adicioacuten de
nutrientes mejora el proceso algunos autores (Yu et al 2005) obtuvieron resultados
opuestos La diferencia entre unos resultados y otros radican en que la necesidad de
nutrientes depende del tipo de bacteria tipo de hidrocarburo y de las condiciones del medio
(Leys et al 2005) El hierro es un nutriente esencial necesario en el proceso de
biodegradacioacuten ya que por un lado es cofactor de las enzimas que catalizan la oxidacioacuten de
los HAP y por otro se ha relacionado con la produccioacuten de biosurfactantes para potenciar la
solubilidad de los HAP (Wei et al 2003) Sin embargo determinar la proporcioacuten oacuteptima de
este nutriente es fundamental pues altas concentraciones pueden ser toacutexicas (Santos et al
2008) Es tambieacuten una cuestioacuten a considerar la forma en la que se adicionan o se
encuentran los nutrientes en el medio ya que condiciona su biodisponibilidad Asiacute algunos
autores (Schlessinger 1991) proponen que las formas oxidadas como nitratos son maacutes
solubles que las formas reducidas como amonio que ademaacutes tiene propiedades
adsorbentes Establecer si un determinado problema medioambiental requiere un aporte
exoacutegeno de nutrientes es por tanto una cuestioacuten a discutir que probablemente dependa de
otras variables bioacuteticas y abioacuteticas
Fuentes de carbono laacutebiles
La adicioacuten a un medio contaminado de otras fuentes de carbono faacutecilmente biodegradables
se considera una alternativa que puede favorecer la biodegradacioacuten porque aumenta la
biomasa de la poblacioacuten microbiana y por tanto de la poblacioacuten degradadora Realmente se
puede entender como una forma de bioestimulacioacuten enfocada a aumentar y estimular el
crecimiento bacteriano o su actividad y por consiguiente la degradacioacuten Algunas de las
sustancias tratadas con este fin son el piruvato que estimula el crecimiento de ciertas cepas
bacterianas o el salicilato que induce la activacioacuten de enzimas degradadoras En el caso de
la glucosa su raacutepida asimilacioacuten y aumento de biomasa asociado se podriacutea traducir en un
aumento de la biodegradacioacuten (Ye et al 1996) Lee et al (2003) propusieron y
comprobaron que el piruvato potenciaba el crecimiento de la cepa degradadora
Resumen Antecedentes
20
Pseudomonas putida lo que se tradujo en un aumento de la tasa de biodegradacioacuten de
naftaleno Chen amp Aitken (1999) han comprobado que el salicilato induce la siacutentesis de
enzimas cataboacutelicas y por tanto su adicioacuten favorece la metabolizacioacuten de HAP siempre
que su concentracioacuten en el medio no supere una concentracioacuten liacutemite inhibitoria Wong et al
(2000) observoacute que la adicioacuten de glucosa favoreciacutea el crecimiento total de la poblacioacuten pero
las tasas de biodegradacioacuten fueron significativamente menores Estos resultados se deben
a que la cepa o consorcio degradador es capaz de mineralizar un HAP como uacutenica fuente de
carbono y la asimilacioacuten de glucosa inhibe la siacutentesis de enzimas implicadas en la
degradacioacuten del contaminante Es necesario valorar en cada caso de estudio coacutemo afecta la
adicioacuten de una nueva fuente de carbono ya que en el caso de bacterias no pre-adaptadas a
degradar HAP es posible que sus efectos sean positivos (Wong et al 2000) pero en
poblaciones microbianas histoacutericamente adaptadas a substratos contaminados la adicioacuten de
glucosa puede favorecer el crecimiento de microorganismos heteroacutetrofos no degradadores
Importancia y efecto de los surfactantes en la biodegradacioacuten de HAP
La baja solubilidad de los HAP y de la mayoriacutea de los compuestos del petroacuteleo limita la
capacidad de los microorganismos para acceder y degradar los compuestos contaminantes
Los surfactantes son tensioactivos que actuacutean disminuyendo la tensioacuten superficial del agua
para facilitar la disolucioacuten de los HAP en la fase acuosa En algunos estudios (Bautista et al
2009) se ha demostrado que el uso de surfactantes en procesos de biodegradacioacuten es
necesario para solubilizar los HAP Muchas bacterias degradadoras de HAP han
desarrollado la capacidad de generar biosurfactantes (surfactantes de origen microbiano)
como parte de su superficie celular o como moleacuteculas liberadas extracelularmente (Fiechter
1992) Algunas de estas especies pertenecen a los geacuteneros Pseudomonas (P aeruginosa
P fluorescens) Rhodococcus Mycobacterium Lactobacillus Acinetobacter o
Sphingomonas Los biosurfactantes se clasifican en funcioacuten de su masa molecular en
biosurfactantes de bajo peso molecular como glicoliacutepidos o lipopeacuteptidos y de alto peso
molecular que incluyen moleacuteculas maacutes complejas como polisacaacuteridos anfipaacuteticos proteiacutenas
lipopolisacaacuteridos y lipoproteiacutenas Se han observado resultados muy contradictorios en
cuanto a sus efectos sobre las tasas de biodegradacioacuten por un lado positivos (Jing et al
2007) pero tambieacuten inhibitorios (Laha amp Luthy 1991) Los biosurfactantes de alto peso
molecular son eficaces en la estabilizacioacuten de emulsiones de aceite en agua mientras que
los de bajo peso molecular son maacutes eficaces en la disminucioacuten de la tensioacuten interficial y
superficial (Rosenberg amp Ron 1999) En el caso de los surfactantes sinteacuteticos su eficacia
estaacute determinada por sus propiedades de carga (no ioacutenicos anioacutenicos o catioacutenicos) su
balance hidrofiacutelico-lipofiacutelico y su concentracioacuten micelar criacutetica (CMC) concentracioacuten a la cual
Resumen Antecedentes
21
la tensioacuten superficial es miacutenima y los monoacutemeros de surfactante se agregan formando
micelas Sin embargo algunos surfactantes pueden inhibir la mineralizacioacuten de los HAP por
cuestiones como la toxicidad del medio derivada de una elevada concentracioacuten de
surfactantes la cual resulta toacutexica para los microorganismos (ej Tergitol NP-10) o porque
al solubilizarse los HAP por accioacuten del surfactante aumenta toxicidad del medio (Liu et al
2001) En algunos casos ademaacutes los surfactantes no son biodegradables (Bautista et al
2009) De hecho Bautista et al (2009) comprobaron que el surfactante no ioacutenico Tergitol
NP-10 es un surfactante no biodegradable y toacutexico para los microorganismos en
comparacioacuten con el Tween-80 Dada la amplia variabilidad de resultados referentes a los
surfactantes es importante la eleccioacuten correcta en cada proceso considerando el tipo de
contaminante a eliminar y los microorganismos presentes en el medio
Biodegradacioacuten bacteriana cepas y consorcios microbianos degradadores de HAP
Son muchas las especies bacterianas descritas con capacidad degradadora de HAP la
mayoriacutea de ellas aisladas de aguas sedimentos y suelos previamente contaminados con
hidrocarburos La biodegradacioacuten de HAP de bajo peso molecular como el naftaleno
fenantreno y antraceno ha sido ampliamente estudiada Sin embargo son escasos los
estudios realizados sobre la biodegradacioacuten de HAP de alto peso molecular como el pireno
perileno acenafteno o fluoreno (Kanaly amp Harayama 2000) De acuerdo con Chauhan et al
(2008) especies de Pseudomonas y Ralstonia se relacionan en mayor medida con la
degradacioacuten de naftaleno y fenantreno Burkolderia y Stenotrophomonas con naftaleno
fenantreno y antraceno y otras especies pertenecientes a los geacuteneros Rhodococcus
Sphingomonas y Mycobacterium con HAP de mayor peso molecular como fluoranteno
benzo[a]pireno pireno benzo[b]fluoranteno Las especies bacterianas degradadoras
pertenecen a grupos filogeneacuteticos muy diversos y en muchos casos taxonoacutemicamente
alejados Trabajos previos (Vintildeas et al 2005 Molina et al 2009 Gonzaacutelez et al 2011)
muestran una gran parte de las bacterias degradadoras pertenecen al phylum
Proteobacteria en mayor proporcioacuten a las clases α- Proteobacteria (Sphingomonas
Bradyrizobium Nitrobacteria Balneimonas) y γ- (Pseudomonas Stenotrhophomonas
Enterobacter Pantoea Acinetobacter o Psychrobacter) Tambieacuten se han aislado especies
pertenecientes a la clase β- Proteobacterias (Ralstonia) y a los phylum Actinobacteria
(Microbacterium sp Rhodococcus sp) Firmicutes (Bacillus subtillis) y Bacteroidetes
(Flexibacter) aunque eacutestas en menor frecuencia Muchos de los trabajos de degradacioacuten
bacteriana se han realizado con cepas individuales (Grimberg et al 1996 Das amp Mukherjee
2006) extraiacutedas de suelos contaminados o bien con consorcios artificiales formados por
varias cepas degradadoras (Ghazali et al 2004) siendo muy pocos aquellos en los que se
Resumen Antecedentes
22
ha utilizado un consorcio bacteriano natural extraiacutedo directamente de un suelo Bautista et al
(2009) sentildeala que la capacidad de degradacioacuten de un consorcio artificial es mayor que la de
las cepas individuales Seguacuten algunos autores (Fritsche 1985 Mueller et al 1997) la mejor
eficiencia de degradacioacuten de un consorcio es debido a que la diversidad de especies permite
que cada una tenga un papel en el proceso de biodegradacioacuten facilitando la degradacioacuten de
HAP gracias al cometabolismo establecido entre las especies implicadas
Existe una importante controversia referente a la capacidad degradadora que
presentan los consorcios naturales ya que se ha observado que ciertos consorcios
extraiacutedos de zonas no contaminadas con HAP son capaces de metabolizar dichos
compuestos (Tian et al 2008 Couling et al 2010) Seguacuten estos autores es una
caracteriacutestica general presente en algunas comunidades microbianas que se expresa ante
una determinada perturbacioacuten Sin embargo Barkay amp Pritchart (1988) exponen que es una
caracteriacutestica que soacutelo estaacute presente en comunidades previamente expuestas y por lo tanto
preadaptadas como consecuencia de presiones selectivas Algunos autores (Jhonsen et al
2005) subrayan que la capacidad cataboacutelica se propaga faacutecilmente entre bacterias de un
mismo suelo contaminado como resultado de la transferencia horizontal de genes (ej
conjugacioacuten y transformacioacuten) Esto facilitariacutea auacuten maacutes que una comunidad no preadaptada
pueda hacer frente a una perturbacioacuten
Teacutecnicas de biorremediacioacuten
El objetivo uacuteltimo de la biorremediacioacuten es que el proceso de biodegradacioacuten se desarrolle
de la forma maacutes eficaz posible y por eso muchos trabajos se centran en la optimizacioacuten del
proceso mediante el desarrollo de teacutecnicas que aumenten la eficacia del mismo Teacutecnicas
como la bioestimulacioacuten anteriormente mencionada se centran en aumentar la capacidad
degradadora de la comunidad autoacutectona bacteriana mediante la adicioacuten de nutrientes
(nitroacutegeno foacutesforo potasio) de forma que la falta de nutrientes no suponga una limitacioacuten
para el metabolismo microbiano y por consiguiente para la biorecuperacioacuten de la zona
perturbada Otras teacutecnicas se basan en el aumento de la poblacioacuten degradadora mediante la
adicioacuten de cepas o consorcios con capacidad reconocida para metabolizar un determinado
compuesto es lo que se conoce como bioaumento En algunos trabajos los resultados
derivados de la bioestimulacioacuten y el bioaumento han sido positivos (Mills et al 2004
Atagana 2006) pero en trabajos como Chen et al (2008) o Yu et al (2005) los efectos de
ambas teacutecnicas en el proceso fueron negativos o simplemente no tuvieron efecto Se tiene
que tener en cuenta que ambas teacutecnicas generan cambios en las comunidades autoacutectonas
que afectan y modifican las relaciones de competencia Estos cambios pueden ser auacuten maacutes
Resumen Antecedentes
23
acusados en el caso del bioaumento pues la introduccioacuten de una comunidad foraacutenea puede
tener resultados difiacuteciles de predecir La atenuacioacuten natural es otra teacutecnica basada en la
mera actuacioacuten de la comunidad autoacutectona sin ninguacuten tipo de modificacioacuten de la comunidad
yo adicioacuten de sustancias Dowty et al (2001) entre otros defiende que cuando se trata de
restablecer el medio a las condiciones originales preservando la biodiversidad la
atenuacioacuten microbiana puede ser la mejor opcioacuten siempre que las poblaciones autoacutectonas
presenten capacidad degradadora
Resumen Objetivos
25
Objetivos
El objetivo general de la tesis es el conocimiento profundo de la biodegradacioacuten bacteriana
de hidrocarburos aromaacuteticos policiacuteclicos para la biorremediacioacuten y recuperacioacuten de medios
contaminados con estos compuestos toacutexicos El proyecto se ha centrado en la identificacioacuten
y conocimiento de la poblacioacuten bacteriana de consorcios procedentes de ambientes
(contaminados o no) y de su dinaacutemica ante determinadas condiciones durante el proceso de
biodegradacioacuten Para alcanzar este objetivo principal se fijaron objetivos especiacuteficos
desarrollados en cuatro capiacutetulos
1 Estudiar los factores abioacuteticos a fin de optimizar las condiciones de desarrollo en el
proceso de biodegradacioacuten de HAP en cultivos liacutequidos (capiacutetulo 1a) En un segundo
proyecto de optimizacioacuten el objetivo fue asemejar el proceso en laboratorio lo maacutes
posible a las condiciones naturales considerando los efectos derivados de la
interaccioacuten muacuteltiple de factores ambientales y bioloacutegicos (capiacutetulo 1b)
2 Analizar el efecto de la aplicacioacuten de distintos tipos de surfactantes (no ioacutenicos
biodegradables y no biodegradables) en la eficacia de degradacioacuten de HAP de un
consorcio bacteriano previamente adaptado (C2PL05) Asiacute mismo se quiso estudiar el
efecto del tipo de surfactante en la sucesioacuten y dinaacutemica del consorcio identificando los
microorganismos implicados a lo largo del proceso (capiacutetulo 2)
3 Estimar la capacidad degradadora de microcosmos inoculados con consorcios
procedentes de suelos con distinta historia de contaminacioacuten suelo croacutenicamente
contaminado (C2PL05) frente a un suelo procedente de un ambiente libre de
contaminacioacuten (BOS08) bajo condiciones climaacuteticas suaves y extremas Describir y
comparar las comunidades bacterianas que componen ambos consorcios (capiacutetulo 3)
4 Evaluar la eficacia de diversas teacutecnicas de biorremediacioacuten (atenuacioacuten natural
bioestimulacioacuten yo bioaumento) tanto en la eliminacioacuten del contaminante y la
toxicidad como en la capacidad de recuperacioacuten del ecosistema (capiacutetulo 4) Para el
desarrollo de este objetivo se llevoacute a cabo una simulacioacuten a pequentildea escala
(microcosmos) de un proceso de biorremediacioacuten in situ de suelos naturales
contaminados con creosota
Resumen Listado de manuscritos
27
Listado de manuscritos
Los capiacutetulos que integran este proyecto doctoral han sido redactados en ingleacutes para su
publicacioacuten en revistas cientiacuteficas de aacutembito internacional Por ello se presentan los
manuscritos originales de dichos artiacuteculos A continuacioacuten se detalla la traduccioacuten del tiacutetulo
los nombres de los coautores y el estado de publicacioacuten de los manuscritos
Capiacutetulo 1a Simarro R Gonzaacutelez N Bautista LF Sanz R y Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium
Water Air and Soil Pollution (2011) 217 365-374
Capiacutetulo 1b Simarro R Gonzaacutelez N Bautista LF y Molina MC
Evaluation of the influence of multiple environmental factors on the
biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial
consortium using an orthogonal experimental design
Water Air and Soil Pollution (Aceptado febrero 2012)
Capiacutetulo 2 Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L y Villa
JA
Effect of surfactants on PAH biodegradation by a bacterial consortium and
on the dynamics of the bacterial community during the process
Bioresource Technology (2011) 102 9438-9446
Capiacutetulo 3 - Simarro R Gonzaacutelez N Bautista LF y Molina MC
High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures
FEMS Microbiology Ecology (Subscrito Diciembre 2011 En revisioacuten)
Resumen Listado de manuscritos
28
Capiacutetulo 4 - Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez L y Peacuterez
M
Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil
change in bacterial community
Manuscrito ineacutedito
Resumen Siacutentesis de capiacutetulos
29
Siacutentesis de capiacutetulos
La presente tesis doctoral se desarrolla dentro de un proyecto de investigacioacuten basado en la
biorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicos y
sustancias contaminantes que los contengan Este proyecto se esta llevando a cabo desde
hace seis antildeos por el grupo de Biorremediacioacuten del Departamento de Biologiacutea y Geologiacutea de
la Universidad Rey Juan Carlos Los artiacuteculos citados anteriormente componen los cuatro
capiacutetulos que se desarrollan en el cuerpo de la tesis
Anteriormente al desarrollo de los experimentos que componen los capiacutetuos de la
presente tesis se realizoacute un trabajo (Molina et al 2009) en el que se estudioacute la capacidad
de degradacioacuten de un consorcio bacteriano extraiacutedo de un suelo croacutenicamente contaminado
y se describioacute su poblacioacuten bacteriana mediante teacutecnicas dependientes e independientes de
cultivo El consorcio fue capaz de degradar los HAP (naftaleno fenantreno y antraceno) en
maacutes de un 98 en un periodo de 18 diacuteas y ademaacutes eliminoacute completamente la toxicidad del
medio en 41 diacuteas La identificacioacuten molecular permitioacute aislar e identificar 5 cepas bacteriana
(DIC-1 a DIC-6 DIC Degrading isolated Culture) todas γ-Proteobacterias pertenecientes a
los geacuteneros Enterobacter Pseudomonas y Stenotrophomonas (maacutes detalles en Molina et al
2009) Ademaacutes el anaacutelisis de la poblacioacuten mediante electroforesis en un gel con gradiente
desnaturalizante (DGGE Denaturing Gradient Gel Electrophoresis) confirmoacute que estos tres
geacuteneros eran dominantes La alta eficacia en la degradacioacuten de los HAP y la escasa
biodiversidad tiacutepica de suelos sometidos a elevadas concentraciones de contaminantes
durante largos peridos de tiempo indican que el consorcio C2PL05 estaacute totalmente
adaptado a la degradacioacuten de HAP
En el capiacutetulo 1 se optimizoacute el proceso de biodegradacioacuten a traveacutes de dos disentildeos
experimentales diferentes que se recogen en los subcapiacutetulos 1a y 1b En el capiacutetulo 1a
se evaluacutea y mejora la influencia de varios factores ambientales como la relacioacuten molar de
CNP la fuente de nitroacutegeno fuente y concentracioacuten de hierro pH y fuente de carbono El
anaacutelisis estadiacutestico de las tasas de degradacioacuten (Kb) y los incrementos de la densidad celular
indicoacute que todos los factores fueron significativamente influyentes en la Kb Esto permitioacute
establecer un valor oacuteptimo de estos factores y descartar en los siguientes ensayos aquellos
paraacutemetros como el pH cuyo valor oacuteptimo (pH 7) seguacuten nuestros resultados coincidiacutea con
otros estudios y estaba claramente definido en la bibliografiacutea A partir de los resultados de
esta primera parte se realizoacute un segundo ensayo de optimizacioacuten ortogonal multifactorial
(capiacutetulo 1b) que permitioacute la optimizacioacuten de 8 factores de forma conjunta La concentracioacuten
de surfactante y de inoacuteculo bacteriano son dos factores que no fueron incluiacutedos en el
anterior anaacutelisis pero a traveacutes de la bibliografiacutea se consideraron factores importantes en la
Resumen Siacutentesis de capiacutetulos
30
biodegradacioacuten de HAP Los resultados confirmaron que la temperatura la fuente de
carbono y la concentracioacuten de inoacuteculo fueron factores significativos en el incremento de la
densidad celular pero soacutelo la fuente de carbono influyoacute significativamente el porcentaje total
de degrad acioacuten Estos resultados (capiacutetulo 1) permitieron conocer cuaacuteles son las
condiciones oacuteptimas del cultivo para una degradacioacuten maacutes eficaz de HAP con el consorcio
bacteriano C2PL05
El uso de surfactantes en la biodegradacioacuten de HAP puede optimizar la eficacia del
proceso y en algunos casos su uso es imprescindible Sin embargo su utilizacioacuten implica
un elevado coste y en ocasiones pueden tener efectos negativos dependiendo de la
concentracioacuten y tipo de surfactante En el capiacutetulo 2 se evaluacutea el efecto de dos
surfactantes no ioacutenicos Tergitol NP-10 (no biodegradable) y Tween-80 (biodegradable) en
la capacidad degradadora del consorcio microbiano C2PL05 teniendo en cuenta la
velocidad de degradacioacuten de los HAP y la dinaacutemica de la poblacioacuten microbiana durante el
proceso (teacutecnicas cultivo-dependientes e independientes) La degradacioacuten bacteriana de
los HAP y la reduccioacuten de la toxicidad del medio fue significativamente mejor con el
surfactante no ioacutenico y biodegradable Tween-80 Ademaacutes el tipo de surfactante utilizado
para optimizar la biodegradacioacuten de HAP afectoacute significativamente a la dinaacutemica de la
comunidad bacteriana del consorcio siendo especies pertenecientes a los geacuteneros
Pseudomonas Sphingomonas Sphingobium y Agromonas responsables de estas
diferencias Teoacutericamente la uacutenica funcioacuten del surfactante en el proceso de
biodegradacioacuten es aumentar la solubilidad de los HAP pero sin embargo en este capiacutetulo
se ha puesto de manifiesto que modifican notablemente las poblaciones bacterianas y la
sucesioacuten de especies pudiendo afectar a la eficacia del proceso Un estudio previo que
desemboque en la eleccioacuten del surfactante maacutes adecuado asiacute como su concentracioacuten
favorece la efiacacia de la biorremediacioacuten
El capiacutetulo 3 se centra en el estudio de la capacidad degradadora de los
microorganismos El principal objetivo es comprobar si la capacidad de degradacioacuten se
adquiere necesariamente tras un periodo de exposicioacuten a un contaminante o si bien es una
caracteriacutestica intriacutensecamente presente en algunas bacterias Se considera que la
temperatura es uno de los factores maacutes influyentes en el proceso de biodegradacioacuten de
manera que a temperaturas friacuteas (lt15 ordmC) o extremas (lt5 ordmC) se dificulta el proceso porque
afecta a la solubilidad de los HAP y al metabolismo microbiano Sin embargo existen
especies que toleran o estaacuten adaptadas a las bajas temperaturas y que ademaacutes pueden
degradar HAP En este capiacutetulo se avaluoacute la capacidad degradadora de un consorcio
preadaptado a HAP (C2PL05) frente a un consorcio extraiacutedo de una zona priacutestina rica en
madera en descomposicioacuten (BOS08) Al mismo tiempo se simularon dos ambientes de
Resumen Siacutentesis de capiacutetulos
31
biodegradacioacuten uno a temperaturas suaves comprendidas entre los 15 ordmC-25 ordmC y otro maacutes
extremo con temperaturas entre los 5 ordmC-15 ordmC todo ello en un sustrato soacutelido (suelo) con
objeto de ajustarnos a las condiciones naturales Sin duda el resultado maacutes significativo fue
que el consorcio BOS08 no adaptado a la degradacioacuten de HAP fue capaz de degradar
eficazmente e incluso mejor que el consorcio C2PL05 cuando las temperaturas fueron bajas
Ademaacutes se observoacute que aunque hubo geacuteneros exclusivos de cada consorcio (Ralstonia
Bacillus) otros fueron comunes en ambos (Microbacterium Acinetobacter Pseudomonas)
Los resultados obtenidos confirman la hipoacutetesis de que la capacidad de degradacioacuten estaacute
presente de forma intriacutenseca en algunas especies y no depende de una pre-exposicioacuten al
contaminante
En la biorremediacioacuten de un suelo contaminado con HAP es muy importante tener en
cuenta la respuesta de la poblacioacuten bacteriana autoacutectona del suelo frente a un episodio de
contaminacioacuten En el capiacutetulo 4 se estudioacute el comportamiento de la comunidad bacteriana
de un suelo previamente no contaminado cuando es perturbado con creosota La
biorremediacioacuten in situ es un proceso maacutes complejo que cuando se estudia bajo condiciones
controladas de laboratorio ya que hay factores como la escasez de nutrientes o las bajas
temperaturas que dificultan el proceso (capiacutetulos 1 y 3) Sin embargo la aplicacioacuten de
tratamientos in situ como la bioestimulacioacuten o el bioaumento pueden mejorar la eficacia de la
biorremediacioacuten En este capiacutetulo se determinoacute la respuesta de la comunidad bacteriana
frente a la bioestimulacioacuten el bioaumento o a la atenuacioacuten natural evaluando el porcentaje
de degradacioacuten de creosota y los HAP que la componen la reduccioacuten de la toxicidad y al
mismo tiempo estudiando los cambios poblacionales El criterio para la eleccioacuten de la
teacutecnica maacutes eficaz se determinoacute en funcioacuten de la eficacia en la degradacioacuten y en la
reduccioacuten de la toxicidad Los resultados mostraron que aunque la creosota se redujo
considerablemente y sin diferencias significativas entre tratamientos la toxicidad del medio
permanecioacute alta durante todo el proceso La ausencia de diferencias significativas entre
tratamientos en cuanto a la eliminacioacuten de creosta se refiere indica que la comunidad
autoacutectona del suelo tiene mcroorgasnimos con capacidad degradadora aunque previamente
no hayan estado expuestos a HAP Las bajas temperaturas a las que se desarrolloacute el
experimento fue la causa de que la toxicidad del medio no se redujera Cabe destacar la
importancia de las identificaciones mediante teacutecnicas no cultivables de especies
pertenecientes a los geacuteneros Balneimonas y Pantoea previamente no descritas en procesos
de biodegradacioacuten de creosota o HAP
Resumen Metodologiacutea general
33
Metodologiacutea general
Todos los materiales y meacutetodos estaacuten descritos y con sus respectivas refrencias en cada
uno de los capiacutetulos que se indican a continuacioacuten Sin embargo en algunos casos y dado
que la publicacioacuten de los datos en muchos casos obliga a ajustarse a los formatos de cada
revista especializada algunos meacutetodos no se han explicado en detalle en los capiacutetulos Este
apartado ldquoMetodologiacutea generalrdquo tiene como objetivo profundizar en el fundamento de
algunos de los meacutetodos utilizados durante el desarrollo de este proyecto
Preparacioacuten de consorcios bacterianos
El consorcio bacteriano C2PL05 fue utilizado en los experimentos de los capiacutetulos que
componen esta tesis como consorcio degradador de HAP Este consorcio fue extraiacutedo de un
suelo croacutenicamente contaminado con HAP (Figura 2A) de una refineriacutea de petroacuteleo situada
en Puertollano Ciudad Real (Espantildea) Su capacidad degradadora se verificoacute en un cultivo
semicontinuo en matraces Erlenmeyer de 100 ml que conteniacutean 50 ml BHB con Tween-80
(1 vv) y naftaleno fenantreno (05 gmiddotlminus1) y antraceno (005 gmiddotlminus1) realizando refrescos del
medio cada 15 diacuteas
Cuando se indique (capiacutetulo 3) se preparoacute un consorcio de un suelo procedente de un
bosque (43ordm 4175acuteN 8ordm 0683acuteO Frgas do Eume Galicia Espantildea Figura 2B) totalmente
libre de contaminacioacuten por HAP al que se denominoacute BOS08 El suelo se obtuvo de la parte
maacutes superficial por lo que teniacutea un alto contenido en materia orgaacutenica y restos de madera
muerta
Figura 2 Suelo contaminado procedente de la refineriacutea (A) y suelo
procedente de bosque (B) de los cuales se extrajeron los consorcios
C2PL05 y BOS08 respectivamente
A B
Resumen Metodologiacutea general
34
Para la extraccioacuten de ambos consorcios bacterianos 1 g de suelo se resuspendioacute en
10 ml de solucioacuten salina PBS (pH 70) y se mantuvo en agitacioacuten constante a 150 rpm en
oscuridad y a 25ordmC durante 24 horas Posteriormente se formoacute un cultivo madre de cada
consorcio en 50 ml de BHB con la mezcla de HAP que se fuera a utilizar en el experimento
tween-80 (1 vv) como surfactante y 15 ml del extracto de cada consorcio Los cultivos se
incubaron en un agitador orbital a 150 rpm y 25ordmC hasta que alcanzara la fase exponencial
En este momento se inoculaba la cantidad de cultivo madre necesario en los microcosmos
de los experimentos en funcioacuten de la concentracioacuten de inoacuteculo deseada en los mismos
Disentildeos experimentales
En este apartado se explica el disentildeo y la composicioacuten de los experimentos que conforman
los capiacutetulos de esta tesis para facilitar su comprensioacuten Generalizando los capiacutetulos 1 (1a y
1b) y 2 tratan de optimizar el medio nutritivo suministrado al consorcio C2PL05 el tipo y
concentracioacuten de surfactante y otros factores ambientales para lo cual los microcosmos
eran cultivos liacutequidos incubados en Erlenmeyers en un agitador orbital Los capiacutetulos 3 y 4
se centran en el estudio de la biodegradacioacuten de HAP en sustrato soacutelido (arena de riacuteo y
suelo natural respectivamente) para reproducir en la medida de los posible las condiciones
naturales
En el capiacutetulo 1a se optimizaron 6 factores (3 posibles valores cada factor) de forma
individual y consecutiva En total se desarrollaron 18 tratamientos en cultivos liacutequidos (3
reacuteplicas) incubados en un agitador orbital a 150 rpm 25 ordmC y oscuridad (Figura 3) durante
168 horas En el capiacutetulo 1b el disentildeo ortogonal L18 (37) (21) permitioacute mediante el desarrollo
de 18 tratamientos (3 reacuteplicas cada uno) la optimizacioacuten de 8 factores 7 de ellos con 3
posibles valores (37) y un factor con dos valores (21) Un total de 54 cultivos se incubaron
durante 159 horas en las mismas condiciones que en el capitulo 1a variando la temperatura
seguacuten las necesidades del tratamiento En la Figura 4 y 5 se muestran los disentildeos
experimentales correspondientes a los capiacutetulos 1a y 1b respectivamente
Resumen Metodologiacutea general
35
Figura 3 Cultivos liacutequidos incubados en un agitador orbital
Optimizacioacuten
CNP
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
100101
1002116
100505
Optimizacioacuten
fuente de N
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
NaNO3
NH4NO3
(NH4)2SO3
Optimizacioacuten
fuente de Fe
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
FeCl3
Fe(NO3)3
Fe2(SO4)3
Optimizacioacuten
[Fe]
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
005 mM
01 mM
02 mM
Optimizacioacuten
pH
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
50
70
80
Optimizacioacuten
fuente de C
BHB tween-80
C2PL05
Naftaleno fenantreno
antraceno y glucosa (20 80 100)
X 3
HAP
HAPglucosa (5050)
Glucosa
2ordm 3ordm
4ordm 5ordm 6ordm
Figure 4 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 1a
Resumen Metodologiacutea general
36
Tordf
Optimizacioacuten CNP
OptimizacioacutenFuente N
OptimizacioacutenFuente Fe
Optimizacioacuten[Fe]
Optimizacioacuten[Tween-80]
Optimizacioacutendilucioacuten inoacuteculo
Optimizacioacutenfuente de C
20ordmC25ordmC30ordmC
1001011002116100505
NaNO3
NH4NO3
(NH4)2SO3
FeCl3Fe(NO3)3
Fe2(SO4)3
005 mM01 mM02 mM
CMC20 CMC
10-1
10-2
10-3
0100505020100
18 tratamientos
X 3
C2PL05Antraceno dibenzofurano pireno
BHB (modificado seguacuten tratamiento)
Figura 5 Disentildeo experimental correspondiente a al experimento que conforma el capiacutetulo 1b
En el capiacutetulo 2 se estudioacute la capacidad de degradacioacuten y la evolucioacuten del consorcio
C2PL05 en dos tratamientos (cada uno en triplicado) uno adicionado con Tween-80 y otro
con Tergitol NP-10 (1 vv) como surfactantes En total 6 cultivos liacutequidos se incubaron a
150 rpm 25 ordmC y oscuridad durante 45 diacuteas como se muestra en la Figura 3 El disentildeo
experimental de este capiacutetulo se resume graacuteficamente en la Figura 6
Tratamiento 1con Tween-80
Tratamiento 2con Tergitol NP-10
C2PL05BHB-Tergitol NP-10 (1)Naftaleno fenantreno antraceno
X 3
X 3
C2PL05BHB-Tween-80 (1)Naftaleno fenantreno antraceno
Figura 6 Disentildeo experimental correspondiente al experimento que conforma
el capiacutetulo 2
Resumen Metodologiacutea general
37
El capiacutetulo 3 se desarrolloacute en microcosmos con 90 g de arena de riacuteo esterilizada
(Figura 7) e incinerada en una mufla a 300 ordmC para eliminar cualquier tipo de
microorganismos o materia orgaacutenica que pudiera contener Se realizaron 4 tratamientos
distintos en funcioacuten de la temperatura de incubacioacuten (5-15 ordmC o 15-25 ordmC) y del consorcio
inoculado (C2PL05 o BOS08) cada tratamiento con tres reacuteplicas para cada uno de los 5
tiempos de muestreo lo que supuso un total de 60 microcosmos (Figura 8) Los nutrientes
se suministraron antildeadiendo 18 ml de medio BHB que proporcionaba una humedad relativa
del 60 y que ademaacutes conteniacutea Tween-80 (1 vv) Los microcosmos se inocularon con
35 ml de un cultivo madre del consorcio C2PL05 oacute BOS08 y se incubaron en caacutemaras bajo
condiciones controladas de temperatura (seguacuten tratamiento) humedad (60 constante) y
luz (16 horas de luz8 horas oscuridad)
Figura 7 Microcosmos del experimento para el capiacutetulo 3 en caacutemara de crecimiento
Resumen Metodologiacutea general
38
Tratamiento 1
Tratamiento 2
Tratamiento 3
Tratamiento 4
C2PL0515-25ordmCBHB oacuteptimoNaftaleno fenantreno antracenopireno y perileno
C2PL055-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS0815-25ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS085-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
X 3
X 3
X 3
X 3
X 5 tiempos
X 5 tiempos
X 5 tiempos
X 5 tiempos
TOTAL = 60 MICROCOSMOS
Figura 8 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 3
El experimento que compone el capiacutetulo 4 de biorremediacioacuten in situ se desarrolloacute
bajo condiciones ambientales externas en una zona del campus preparada para ello Como
sustrato se utilizoacute suelo natural extraiacutedo de los primeros 20 cm y tamizado con una maya lt
2 mm El sustrato se depositoacute en bandejas de plaacutestico para evitar que el agente
contaminante se filtrara al suelo y se protegioacute de la lluvia tal y como se observa en la Figura
9 Cada uno de los cinco tratamientos (control atenuacioacuten natural bioestimulacioacuten
bioaumento y bioestimulacioacuten junto con bioaumento) se hizo en duplicado para cada uno de
los 4 muestreos realizados durante los 8 meses de experimentacioacuten (octubre-junio) Cada
microcosmos (bandeja) conteniacutea 550 g de suelo humedecidos (40) con agua o BHB como
fuente de nutrientes en el caso de los tratamientos con bioestimulacioacuten Los tratamientos
bioaumentados se enriquecieron con 5 ml de un cultivo madre del consorcio C2PL05 Como
agente contaminante se utilizoacute creosota antildeadiendo 25 ml de una disolucioacuten de creosota en
Resumen Metodologiacutea general
39
n-hexano (25 g creosota por bandeja) a todos los tratamientos excepto al control Resumen
del disentildeo en la Figura 10
Figura 9 Experimento para el capiacutetulo 4 bajo condiciones ambientales
externas en el Campus de la Universidad Rey Juan Carlos Moacutestoles
Tratamiento 1 Control
Tratamiento 2 Atenuacioacuten
natural
Tratamiento 3 Bioestimulacioacuten
Tratamiento 4 Bioaumento
Tratamiento 5 Bioestimulacioacuten
y Bioaumento
Suelo sin contaminar X 4 tiempos
CreosotaH2O-Tween-80 X 4 tiempos
CreosotaBHB oacuteptimo-Tween-80 X 4 tiempos
CreosotaH20 ndash Tween-80 X 4 tiemposC2PL05
CreosotaBHB oacuteptimo-Tween-80 X 4 tiemposC2PL05
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
TOTAL = 40 MICROCOSMOS
Figura 10 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 4
Resumen Metodologiacutea general
40
Anaacutelisis fiacutesico-quiacutemicos
La caracterizacioacuten del suelo contaminado del cual se extrajo el consorcio C2PL05 asiacute como
la explicacioacuten de las teacutecnicas y metodologiacuteas empleadas se detallan en Molina et al (2009)
No obstante en la Tabla 1 se presentan las propiedades fiacutesico-quiacutemicas de dicho suelo
contaminado
Tabla 1 Propiedades fisico-quiacutemicas y bioloacutegicas del suelo contaminado con HAP
Propiedades Unidades Media plusmn ES
Tamantildeo medio de partiacutecula μm3 291 plusmn 6 Composicioacuten (arenaslimosarcillas) v 291009000 plusmn 03603600
pH - 77 plusmn 01
Conductividad μSmiddotcm-1 74 plusmn 22
WHCa v 33 plusmn 7
(NO3)- μgmiddotKg-1 40 plusmn 37
(NO2)- μgmiddotKg-1 117 plusmn 01
(NH4)+ μgmiddotKg-1 155 plusmn 125
(PO4)3- μgmiddotKg-1 47 plusmn 6
Carbono total v 96 plusmn 21
TOCb (tratamiento aacutecido) v 51 plusmn 04
MPNc (heteroacutetrofos) x104 ceacutelulasmiddotg-1 97 plusmn 12
MPNc (degradador de HAP) x103 ceacutelulasmiddotg-1 93 plusmn 19
Toxicity EC50d gmiddot100ml-1 144 plusmn 80
Hidrocarburos extraiacutedos w 92 plusmn 18
a Capacidad de campo del agua (WHC Water holding capacity) maacutexima cantidad de agua que
puede contener un suelo b Carbono orgaacutenico total (TOC total organic carbon) c Nuacutemero maacutes
probable (MPN most probably number) teacutecnica cultivo-dependiente que estima el nuacutemero de
ceacutelulas capaces de crecer con una determinada fuente de carbono (ver apartado Anaacutelisis
bioloacutegicos) d EC50 es una medida de la eficacia de una determinada sustancia o de su toxicidad
y representa la cantidad de un compuesto necesaria para disminuir al 50 una funcioacuten En
nuestro caso indica la toxicidad del medio que disminuye a la mitad la actividad microbiana del
consorcio
La metodologiacutea utilizada para la extraccioacuten de HAP (capiacutetulos 1 2 y 3) y creosota
(capiacutetulo 4) se detalla en el apartado de material y meacutetodos de los capiacutetulos
correspondientes La cromatografiacutea liacutequida de alto rendimiento (HPLC high-performance
liquid chromatography) fue la teacutecnica utilizada para el anaacutelisis de los HAP en los capiacutetulos 1
y 2 siguiendo el protocolo descrito por Bautista et al (2009) El equipo de anaacutelisis HPLC
(Prestar 230 Varian Palo Alto CA USA) esta compuesto por una columna C18 en fase
reversa Luna C18 (2) (75 cm longitud x 46 mm diaacutemetro interno y 3 μm tamantildeo de partiacutecula
Phenomenex Torrance CA USA) y conectado a una matriz de fotodiodos de UVVis
Resumen Metodologiacutea general
41
(ultravioletavisible) y un detector de fluorescencia La fase moacutevil utilizada se compone de un
gradiente acetonitriloagua programado como se detalla a continuacioacuten gradiente isocraacutetico
6040 (0-2 min) gradiente de 7525 (2-14 min) gradiente isocraacutetico 7525 (14-15 min)
gradiente de 1000 (15-16 min) El volumen de inyeccioacuten de muestra es de 10 μl y el flujo de
elusioacuten en la columna de 08 mlmiddotmin-1 La deteccioacuten de los HAP se realiza a 254 nm El
posterior tratamiento de los datos se detalla en los respectivos capiacutetulos
El meacutetodo para la deteccioacuten de HAP en el capiacutetulo 3 y de creosota en el capitulo 4 fue
la cromatografiacutea de gases (GC Gas Chromatography) utilizando un cromatoacutegrafo de gases
(system Varian 3900 Palo Alto CA USA) con un detector con ionizador de llama (FID
Flame Ionization Detector) La metodologiacutea protocolo y posterior tratamiento de los datos se
detallan en el material y meacutetodos de los respectivos capiacutetulos
Anaacutelisis bioloacutegicos
La densidad celular es una teacutecnica utilizada en todos los ensayos que componen esta tesis y
por tanto la metodologiacutea y el posterior tratamiento de los datos estaacuten detalladamente
descritos en todos los manuscritos que conforman los capiacutetulos de la tesis
Las teacutecnicas cultivo dependientes desarrolladas en los ensayos han sido el NMP
descrito en los capiacutetulos 2 3 y 4 y el aislamiento de colonias aplicando la metodologiacutea
empleada por Molina et al (2009) y descrita en los capiacutetulos 2 y 3
Teacutecnicas moleculares
Extraccioacuten y amplificacioacuten de ADN
La extraccioacuten de ADN de muestras de cultivos liacutequidos y muestras de biomasa de una
colonia aislada (capiacutetulos 2 y 3) se realizoacute usando el kit de extraccioacuten fiacutesico-quiacutemico de ADN
bacteriano Microbial DNA isolation Kit (Laboratorios MoBio Solano Beach CA USA) Para
la extraccioacuten de ADN total de muestras de suelo (capiacutetulos 3 y 4) se usoacute el kit de extraccioacuten
fiacutesico-quiacutemico Power Soil DNA kit (Laboratorios MoBio Solano Beach CA USA) siguiendo
en ambos casos el protocolo recomendado por el fabricante
Resumen Metodologiacutea general
42
Para la amplificacioacuten de las secuencias de ADN se utilizaron varias parejas de
cebadores en funcioacuten de la teacutecnica posterior de anaacutelisis del producto de PCR La
amplificacioacuten del ADN se realizoacute con el fin de identificar las secuencias de las cepas
aisladas o para un posterior anaacutelisis del ADN total de una muestra mediante electroforesis
en gel con gradiente desnaturalizante (DGGE denaturing gradient gel electrophoresis)
Cuando fue necesario reamplificar material geneacutetico procedente de una banda de DGGE la
pareja de primers utilizada no presentaba cola de GC (guanina-citosina) En la Tabla 2 se
describen las caracteriacutesticas de los cebadores y en la Figura 11 se detallan las condiciones
del programa correspondiente a cada pareja de cebadores
Tabla 2 Caracteriacutesticas de los cebadores utilizados para la amplificacioacuten de ADN por PCR
Cebador Secuencia 5acute--3acute Nordm de bases
Tordf hibridacioacuten
(ordmC)
Programa de PCR (Figura
Teacutecnica de anaacutelisis del producto de
16F27 AGAGTTTGATCMTGGCTCAG 20 55 I Purificacioacuten Secuenciacioacuten16R1488 CGGTTACCTTGTTACGACTTCAGG 24 55 I
16F341 CCTACGGGAGGCAGCAG 17 54 II DGGE Clonacioacuten Ecoli 16R907 CCGTCAATTCCTTTRAGTTT 20 54 II
16F338 CTCCTACGGGAGGCAGCAG 19 55 II DGGE Clonacioacuten Ecoli 16R518 CGTATTACCGCGGCTGCTGG 20 55 II
ITS1F CTTGGTCATTTAGAGGAAGTAA 20 54 III Presencia material geneacutetico ITS4 TCCTCCGCTTATTGATATGC 20 54 III
Primer con posibilidad de antildeadir una secuencia de 40 bases (5acute-CGC CCG CCG CGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) rica en guanina (G) y citosina(C) unida al extremo 5acute- del
cebador necesaria para electroforesis en gel con gradiente desnaturalizantede
Resumen Metodologiacutea general
43
Figura 11 Condiciones de los programas de PCR I II y III a) Paso en el cual se procede a la
activacioacuten del principio activo de la polimerasa ExTaq-HS a una Tordf de activacioacuten de 94ordmC b) Tordf de
desnaturalizacioacuten c) Tordf de hibridacioacuten d) Tordf de polimerizacioacuten e) Tordf de extensioacuten f) Tordf final y de
conservacioacuten del producto de PCR
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 5 min
95 ordmC 1 min
54 ordmC 05 min
72 ordmC 15 min
72 ordmC 10 min
30 CICLOS
PROGRAMA PCR III
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR II
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
94 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR I
Resumen Metodologiacutea general
44
Electroforesis en gel con gradiente de desnaturalizacioacuten (DGGE) y clonacioacuten en
Escherichia coli
El estudio de la comunidad bacteriana se realizoacute mediante la teacutecnica DGGE ampliamente
descrita en los capiacutetulos 2 3 y 4 Las bandas maacutes predominantes fueron extraiacutedas del gel
eluiacutedas en de agua esterilizada y almacenadas a -20 ordmC para su posterior reamplificacioacuten y
clonacioacuten Las imaacutegenes de DGGE se analizaron graacutefica y estadiacutesticamente para diferenciar
entre las comunidades objeto de estudio y la influencia de los tratamientos en los cambios
de una comunidad El anaacutelisis graacutefico mediante el programa UN-Scan-It (v 60 Silk Scientific
US) permitioacute identificar el porcentaje de abundancia de cada banda con respecto de una
comunidad
La clonacioacuten en Ecoli se empleoacute debido a la imposiblidad de reamplificar el ADN
contenido en una banda cortada del gel de DGGE La metodologiacutea empleada para el
desarrollo de esta teacutecnica en los capiacutetulos 2 3 y 4 es la recomendada por el fabricante del
kit utilizado pGEM-T Easy Vector System II (Pomega)
Alineamiento de secuencias y anaacutelisis filogeneacuteticos
Las secuencias fueron editadas utilizando el programa Chromas Pro v142 que permite
ademaacutes visualizar y modificar posibles ambiguumledades en los nucleoacutetidos Las secuencias
fueron descargadas en las bases de datos disponibles (Genbank
(httpwwwncbinlmnihgovgenbank) y Ribosomal Sequence Data
(httprdpcmemsueduseqmatchseqmatch_introjsp)) a traveacutes de la opcioacuten BLAST con el
fin de aproximarnos a la identificacioacuten molecular de los organismos La secuencias fueron
alineadas utilizando el programa Bioedit v709 y posteriormente se elaboroacute una matriz de
datos a partir de la cual se establecieron las posibles relaciones filogeneacuteticos entre las
secuencias problema y aquellas descargadas de las bases de datos El programa utilizado a
tal efecto fue PAUP 40B10 (Swofford 2003)
Se utilizaron dos tipos de anaacutelisis para estimar las relaciones filogeneacuteticas y la
fiabilidad de las topologiacuteas obtenidas Por un lado se utilizoacute la Maacutexima Parsimonia estaacutendar
(Maxima Parsimonia de Fitch MP) un meacutetodo que elige el aacuterbol que requiere el menor
nuacutemero de cambios evolutivos para explicar las relaciones entre taxones a partir de la
informacioacuten generada por los sitios informativos el valor relativo de los diferentes caracteres
y de sus transformaciones Para evaluar la fiabilidad de las relaciones establecidas por
parsimonia se selecciono el meacutetodo Bootstraping (Felsenstein 1985) donde los caracteres
Resumen Metodologiacutea general
45
de las matrices se combinan al azar con las repeticiones necesarias considerando los
paraacutemetros establecidos en el anaacutelisis de parsimonia Asiacute el porcentanje con que aparece
un determinado grupo es una medida de la bondad de dicho grupo o rama Por otro lado la
diferencia entre secuencias (distancia geneacutetica) se computoacute en teacuterminos de nuacutemero de
nucleoacutetidos diferentes por sitio entre secuencias realizando un anaacutelisis de neighbour-joining
de acuerdo al algoritmo de Jukes amp Cantor (1969) Ambos tipos de anaacutelisis se llevaron a
cabo usando el software PAUP 40B10 (Swofford 2003)
Anaacutelisis estadiacutesiticos
Todos los capiacutetulos se disentildearon de forma que tras la finalizacioacuten del experimento los datos
pudieran ser tratados estadiacutesticamente El tratamiento estadiacutestico y los anaacutelisis realizados
con los datos de los ensayos estaacuten descritos en el apartado correspondiente de los
manuscritos que componen los artiacuteculos de la presente tesis Es necesario explicar
detalladamente el experimento que compone el capiacutetulo 1b disentildeado con un experimento
ortogonal del tipo L18 (37) (21) seleccionado del modulo de Statistica (Version 60) Este tipo
de disentildeo permitioacute hacer una combinacioacuten de muacuteltiples factores de forma reducida Es decir
un total de 18 experimentos representan todas las combinaciones posibles que se pueden
dar entre 8 factores siete de los cuales pueden tomar tres valores (37) diferentes (ej factor
Tordf valores 30ordmC 25ordmC y 20ordmC) y uno de ellos con dos valores (21) (ej factor concentracioacuten
de surfactante valores CMC y +20 CMC)
Para visualizar cambios en las comunidades microbianas (patrones univariantes) en
cada combinacioacuten de factores (ej tiempo tipo de consorcio temperatura) se realizoacute una
ordenacioacuten multivariante mediante un escalamiento multidimensional no-meacutetrico (MDS non-
parametric Multidimensional Scaling) usando el programa PRIMER (Clarke 1993) Este tipo
de anaacutelisis se realizoacute en los capiacutetulos 3 y 4 La ordenacioacuten se hizo sobre la base de la matriz
de dismilaridad de Bray-Curtis construida a partir de la transformacioacuten de los datos de
abundancia por la raiacutez cuarta para minimizar la influencia de los valores maacutes extremos
(Clarke 1993 Martiacuten Guirao 2007) Se usoacute el procedimiento SIMPER (Clarke 1993) para
identificar el porcentaje de contribucioacuten de cada banda a la disimilitud entre tratamientos
establecida en la matriz de Bray-Curtis Las bandas se consideraron influyentes cuando su
contribucioacuten se encontraba dentro de los primeros 70 (capiacutetulo 2) 60 (capiacutetulo 3) o 50
(capiacutetulo 4 Viejo 2009) del porcentaje medio de similaridaddisimilaridad acumulado entre y
dentro de la combinacioacuten de factores El criterio aplicado para escoger el porcentaje de
contribucioacuten limite se hizo en funcioacuten de la riqueza de bandas de forma que cuanto menor
fuera este paraacutemetro mayor el porcentaje liacutemite
Capiacutetulo
Publicado en Water Air amp Soil Pollution (2011) 217 365-374
Simarro R Gonzaacutelez N Bautista LF Sanz R amp Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene and
anthracene) biodegradation process by a bacterial consortium
Optimizacioacuten de los principales factores abioacuteticos de un proceso de biodegradacioacuten
de HAP (naftaleno fenantreno y antraceno) por un consorcio bacteriano
1a
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
49
Abstract
The aim of this work is to determine the optimum values for the biodegradation process of six
abiotic factors considered very influential in this process The optimization of a polycyclic
aromatic hydrocarbons (naphthalene phenanthrene and anthracene) biodegradation
process was carried out with a degrading bacterial consortium C2PL05 The optimized
factors were the molar ratio of carbonnitrogenphosphorus (CNP) the nitrogen source the
iron source the iron concentration the pH and the carbon source Each factor was optimized
applying three different treatments during 168 h analyzing cell density by spectrophotometric
absorbance at 600 nm and PAH depletion by HPLC To determine the optimum values of the
factors an analysis of variance (ANOVA) was performed using the cell density increments
and biotic degradation constants calculated for each treatment The most effective values of
each factor were a CNP molar ratio of 1002116 NaNO3 as nitrogen source Fe2(SO4)3 as
iron source using a concentration of 01 mmolmiddotl-1 a pH of 70 and a mixture of glucose and
PAH as carbon source Therefore high concentration of nutrients and soluble forms of
nitrogen and iron at neutral pH favour the biodegradation Also the addition of glucose to
PAH as carbon source increased the number of total microorganism and enhanced the PAH
biodegradation due to augmentation of PAH degrader microorganisms It is also important to
underline that the statistical treatment of data and the combined study of the increments of
the cell density and the biotic biodegradation constant has facilitated the accurate
interpretation of the optimization results For an optimum bioremediation process is very
important to perform these previous bioassays to decrease the process development time
and so the costs
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
51
Introduction
Polycyclic aromatic hydrocarbons (PAH) are persistent organic compounds with two or more
aromatic rings They are formed by incomplete combustion of fossil fuels and pyrolysis of
organic matter derived from human activities and as a result of natural events like forest fires
The toxic mutagenic and carcinogenic properties of PAH have concerned the Unites States
Environmental Protection Agency (US-EPA) proposing some of them as priority pollutants
(including naphthalene phenanthrene and anthracene) In addition the PAH solubility is very
low in aqueous medium (Luning Prak amp Pritchard 2002) affecting their degradation and
biomagnification within the ecosystems The microbial bioremediation removes or
immobilizes the pollutants reducing toxicity with a very low environmental impact Generally
microbial communities present in PAH contaminated soils are enriched by microorganisms
able to use them as only carbon source (Heitkamp amp Cerniglia 1988 Gallego et al 2007)
However this process can be affected by a few key environmental factors (Roling-Wilfred et
al 2002) that may be optimized to achieve a more efficient process The molar ratio of
carbon nitrogen and phosphorus (CNP) is very important for the metabolism of the
microorganisms and so for PAH degradation (Bossert amp Bartha 1984 Alexander 1994
Kwok amp Loh 2003) The molar ratio 100101 is frequently considered optimal for
contaminated soils (Bossert amp Bartha 1984 Alexander 1994) while other author have
reported negative or non-effects (Chaicircneau et al 2005) According to Leys et al (2005)
these contradictory results are due to the nutrients ratio required by PAH degrading bacteria
depends on environmental conditions type of bacteria and type of hydrocarbon In addition
the chemical form of those nutrients is also important being the soluble forms (ie iron or
nitrogen in form of phosphate nitrate and ammonium) the most frequent and efficient due to
their higher availability for microorganisms Depending on the microbial community and their
abundance another factor that may improve the PAH degradation is the addition of readily
assimilated such as glucose carbon sources (Zaidi amp Imam 1999)
Moreover the pH is an important factor that affects the solubility of both PAH and
many chemical species in the cultivation broth as well as the metabolism of the
microorganisms showing an optimal range for bacterial degradation between 55 and 78
(Bossert amp Bartha 1984 Wong et al 2001)
In general bioremediation process optimization may be flawed by the lack of studies
showing the simultaneous effect of different environmental factors Hence our main goal was
to set up the optimum values of six abiotic factors CNP molar ratio nitrogen source iron
source iron concentration pH and carbon source for the biodegradation of three PAH
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
52
(naphthalene phenanthrene and anthracene) at 25 ordmC In order to achieve the main objective
we analyzed the effects of the above factors on the microbial growth and the biotic
degradation rate
Materials and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all gt99 purity) were purchased from Sigma-
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) The consortium C2PL05
was not able to degrade PAH significantly without the addition of surfactants (data not
shown) Therefore surfactant Tween-80 (Sigma-Aldrich Steinheim Germany) was selected
as the most efficient biodegradable and non-toxic surfactant (Bautista et al 2009) for the
consortium C2PL05 Bushnell Haas Broth medium (BHB) was purchased from Panreac
(Barcelona Spain) and its composition is 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-
1 KHPO4 1 gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 This base composition was
modified in each experiment as required
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1g of soil (lt 2 mm) was resuspended in 10 ml
of phosphate buffer saline (PBS) and incubated during 12 h in an orbital shaker (Innova 40
New Brunswick Scientific Edison NJ USA) at 150 rpm and 25ordmC under dark conditions
After that 15 ml of the supernatant was inoculated in 50 ml of BHB broth (pH 70) 1 wt
Tween-80 as surfactant and naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1)
as carbon source The culture was incubated at 150 rpm and 25ordmC under dark conditions
until the exponential phase was completed This was confirmed by monitoring the cell density
by absorbance at 600 nm in a spectrophotometer (Spectronic GenesysTM UK) Then the
consortium was stored at 4 ordmC to stop its growth At the beginning of each experiment 500 μl
of the stored consortium was inoculated into the fermentation flasks To identify the microbial
consortium C2PL05 colonies from aliquots of the soil extract were isolated in BHB agar
plates with PAH as only carbon source to confirm that these colonies were PAH degraders
Eight colonies were isolated and transferred onto LB-glucose agar plates in order to increase
microbial biomass for DNA extraction Total DNA of the colonies was extracted using
Microbial DNA isolation kit (MoBio Laboratories) Amplification of the 16S rRNA coding
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
53
region of the DNA was performed as described by Vintildeas et al (2005) using the primers
16F27 and 16R1488 Sequences were edited and assembled using BioEdit 487 software
(Hall 1999) All isolated strains of the consortium C2PL05 were γ-proteobacteria and the
genera present were Enterobacter Pseudomonas and Stenotrophomonas In addition non
culture-dependent molecular techniques as denaturant gradient gel electrophoresis (DGGE)
was performed to know the total biodiversity of the microbial consortium C2PL05 16S rRNA
gen was amplified using the primers 341F-GC and 907R (GC clamp 5acute-CGC CCG CCG
CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995) About 6 of
polyacrylamide (3751 acrylamidebisacrylamide) gels with a 30-60 urea-formamide
denaturant gradient and 075 mm were used in 1xTAE buffer at 200V for 4h at 60 ordmC The
bands were excised and reamplificated to identify the DNA The two genera identified
coincided with genera Pseudomonas and Stenotrophomonas identified by culture-dependent
techniques (more details in Molina et al 2009)
Experimental design
A total of 6 abiotic factors were evaluated To obtain an optimum value three treatments
each in triplicate were performed for each factor The replicates were carried out in 100 ml
Erlenmeyer flasks with 50 ml of BHB medium (pH 70) Tween-80 (1wt) naphthalene
phenanthrene and anthracene (each at 500 mgmiddotl-1) and 500 microl of the C2PL05 consortium
The concentration of the inoculum was 315x106 cells ml-1 of the heterotrophic microorganism
and 695x105 cells ml-1 of the PAH degrading microorganism The number of the
microorganisms capable to degrade any carbon source present in the medium (heterotrophic
microorganisms) and microorganisms capable to degrade PAH as sole carbon source (PAH-
degrading bacteria) were measured by the most probably number (MPN) method (Wrenn amp
Venosa 1996) LB-glucose broth and BHB medium were used to determine heterotrophic
microorganism and PAH degrading microorganism respectively To maintain the same initial
number of cells in each experiment the absorbance of the inoculum was measured and
diluted if necessary before inoculation to reach an optical density of 16 AU The replicates
were incubated in an orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA)
at 150 rpm and 25 ordmC under dark conditions Previous to inoculate the consortium the
Erlenmeyer flasks were shacked overnight to solubilize most of the PAH Samples were
withdrawn at 0 15 24 39 48 64 72 159 and 168 h to monitor the PAH depletion and cell
growth
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
54
Treatment conditions
Composition of BHB base was 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-1 KHPO4 1
gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 The compounds MgSO4 and CaCl2 and their
concentration were constant for all treatments and KHPO4 and K2HPO4 were modified only in
concentration The other components were modified both the concentration and compounds
according to the requirements of the optimized factors PAH at 1500 mgmiddotl-1 (500 mgmiddotl-1 of
naphthalene phenathrene and anthracene) was used as carbon source for all treatments
except for those in which the carbon source was optimized and PAH were mixed with
glucose in a proportion of 50 PAH-glucose or only glucose was added In all cases an
overall carbon concentration of 01176 mmoll-1 was used Once a factor was optimized its
optimum value was kept for the subsequent factor optimization
The levels of each factor studied were selected as described below For the CNP
molar ratio the values employed were 100101 frequently described as optimal (Bossert
and Bartha 1984) 100505 and 1002116 To optimize the nitrogen source NaNO3
NH4(NO3) and (NH4)2SO3 were used The optimal iron source was selected amongst FeCl3
Fe(NO3)3 and Fe2(SO4)3 The concentration levels of the optimal iron form were 005 01 and
02 mmoll-1 and three different pH values were also tested 50 70 and 80 The effect of the
carbon source was determined by adding PAH as only carbon source PAH and glucose
(50 of carbon atoms from each source) or glucose as only carbon source
Bacterial growth
Bacterial growth during the PAH degradation process was monitored at 0 15 24 39 48 64
72 159 and 168 h by spectrophotometric absorbance of the culture media at 600 nm in a
UV-Vis spectrophotometer (Spectronic GenesysTM UK) From the above optical density data
the average of the cell density increments (CDI) was calculated by applying the following
equation
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
55
Kinetic degradation
Naphthalene phenanthrene and anthracene concentrations in the culture media were
analysed using a ProStar 230 HPLC system (Varian Palo Alto CA USA) with a reverse
phase C18 column following the method described in Bautista et al (2009) The
concentration of each PAH was calculated from a standard curve based on peak area using
the absorbance at 254 nm Depletion rate of each PAH (-ri) during the experiments was fitted
to a first order kinetic model (Equation 2)
iBiiAii
i CkCkdt
dCr Eq 2
where C is the concentration of the corresponding PAH kA is the apparent first-order
kinetic constant due to abiotic processes kB is the apparent first-order kinetic constant
due to biological processes t is the time elapsed and the subscript i corresponds to
each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1 wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40 New Brunswick Scientific Edison
NJ USA) at 150 rpm and 25 ordmC under dark conditions PAH concentration in the control
experiment were analysed using the HPLC system described previously The values of kA for
each PAH was calculated by applying eq 2 considering kB asymp 0 since no bacterial consortium
was inoculated
Statistical analysis
In order to evaluate the effects of the treatments on the kinetic biodegradation constant (kB)
and cell density increments (CDI) bifactorials analysis of variance (ANOVA) were used The
variances were checked for homogeneity by applying the Cochranacutes test When indicated
data were transformed to homogenize variances Student-Newman-Keuls (SNK) test was
used to discriminate among different treatments after significant F-test All tests were
performed with the software Statistica 60 for Windows
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
56
Results
Control experiments (Figure 1) show that phenathrene and anthracene concentration was
not affected by any abiotic process since no depletion was observed along the experiment
so that kA asymp 0 h-1 However in the case of naphthalene some degree of abiotic depletion was
measured during the controls yielding an apparent first-order abiotic rate constant of 27x10-
3 plusmn 7x10-5 h1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the optimisation experiments
0 100 200 300 400 500 600 700
20
40
60
80
100
Rem
aini
ng P
AH
(
)
Time (hour)
Figure 1 Naphthalene ( ) phenathrene ( ) and anthracene ( )
depletion due to abiotic processes in control experiments
Table 1 Analysis of variance (ANOVA) summary for the cell density increments (CDI) and the
biotic degradation constant (kB) MS is the means of squares and df degrees of freedom
CDI kB
Factor df MS F-value p-value df MS F-value p-value
CNP ratio 2 27middot10-1 238 4 57middot10-2 566 Error 6 11middot10-2 18 10middot10-3
N source 2 21middot10-1 234 4 90middot10-6 113
Error 6 10middot10-2 18 70middot10-7
Fe source 2 18middot10-2 51 4 30middot10-6 43
Error 6 36middot10-3 18 70middot10-8
Fe Concentration 2 45middot10-1 348 006 4 30middot10-6 38
Error 6 95middot10-2 18 10middot10-7
pH 2 30middot10-2 1103 4 15middot10-4 5
Error 6 27middot10-3 18 33middot10-5
GlucosePAHs 2 54middot10-1 45401 2 66middot10-4 7
Error 6 12middot10-3 12 93middot10-5
a Logarithmically transformed data to achieve homogeneity of variance
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
57
Cell density increments of the consortium for three different treatments of CNP molar
ratio are showed in Figure 2A According to statistical analysis of CDI there was significant
differences between CNP molar ratio (F26 = 238 p lt 001 Table 1) and SNK showed that
treatments with molar ratios of 100101 and 1002116 reached larger increases With
regard to the kinetic biodegradation constant (kB) the interaction between kB of the
treatments with each hydrocarbon was significant (F418 = 57 p lt 0001 Table 1) The SNK
test (Figure 2B) showed that the treatment 1002116 with naphthalene yielded the highest
value whereas the lowest were achieved with 100505 and 100101 for anthracene and
phenanthrene In addition within each PAH group the highest values were observed with
1002116 molar ratio Therefore although there are no differences for CDI between ratios
100101 and 1002116 1002116 molar ratio is the most effective for the PAH degradation
so that this ratio was considered as the optimal
171819202122232425
100101 1002116100505
bb
a
A
CNP molar ratio
CD
I
Naphthalene Phenanthrene Anthracene-35
-30
-25
-20
-15
-10
-05
00B
d
g
e
bc
f
ab
f
Log
k B (
h-1)
Figure 2 (A) Cell density increments of the consortium C2PL05 with the treatments 100505
100101 and 1002116 Error bars show the standard error (B) Differences between treatments
(100101 100505 and 1002116 ) and PAHs in the biodegradation kinetic constant (kB)
The letters show differences between groups (p lt 005 SNK) and the error bars the standard
deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
58
Figure 3A shows that the three different nitrogen sources added had significant effects
on CDI (F26 = 234 p lt 001 Table 1) The SNK test shows that the addition of NaNO3
significantly improved CDI The interaction between PAH and the nitrogen sources were
significant (F418 = 113 p lt 0001 Table 1) and the highest kB values were achieved with
NaNO3 for naphthalene phenanthrene and anthracene (Figure 3B) According to these
results NaNO3 is considered as the best form to supply the nitrogen source for both PAH
degradation and growth of the C2PL05 consortium
19
20
21
22
23
24
25
(NH4)
2SO
4NH4NO
3NaNO
3
a
b
a
A
Nitrogen source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
Bf
ba
e
bcb
dbc
a
kB (
h-1)
Figure 3 (A) Cell density increments of the consortium C2PL05 with the treatments NaNO3 NH4NO3
and (NH4)2SO4 Error bars show the standard error (B) Differences between treatments (NaNO3
NH4NO3 and (NH4)2SO4 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
59
CDI of the treatments performed with three different iron sources (Figure 4A) were
significantly different (F26 = 51 p lt 005 Table 1) Although no significant differences
between adding Fe2(SO4)3 or Fe(NO3)3 were observed the addition of Fe2(SO4)3 contributes
more to CDI than FeCl3 The kB (Figure 4B) showed significant differences in the interaction
between PAH and the different iron sources (F418 = 43 p lt 0001 Table 1) The highest kB
values were observed with Fe2(SO4)3 for the degradation of phenanthrene followed by FeCl3
degrading naphthalene and phenanthrene The lowest values of kB were observed with
Fe(NO3)3 degrading naphthalene and anthracene Nevertheless the most recalcitrant PAH
(phenanthrene and anthracene) showed the highest kB values with Fe2(SO4)3 in agreement
with the highest CDI values also obtained with Fe2(SO4)3
168
172
176
180
184
188
192
196
Fe(NO3)
3 Fe2(SO
4)
3FeCl
3
ab
b
a
A
Iron source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
B
c
a
b
c
b
d
b
a a
k B
(h-1
)
Figure 4 (A) Cell density increments of the consortium C2PL05 with the treatments FeCl3 Fe(NO3)3
and Fe2(SO4)3 Error bars show the standard error (B) Differences between treatments (FeCl3
Fe(NO3)3 and Fe2(SO4) ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
60
Concerning the effect of the iron concentration (Figure 5) supplied in the form of the
optimal Fe2(SO4)3 no significant differences in CDI were found for all three concentration
used (F26 = 348 p = 006 Table 1 Figure 5A) However the interaction between iron
concentration and kB of three PAH was significant (F418 = 38 p lt 0001 Table 1) reaching
the highest values for kB by using an iron concentration of 01 mmoll-1 degrading
naphthalene and phenanthrene (Figure 5B) The lowest values of kB were observed with 005
mmoll-1 and 02 mmoll-1 degrading phenanthrene and anthracene (Figure 4B) Since each
PAH showed the highest kB with 01 mmoll-1 this iron concentration was considered as the
most efficient for the PAH biodegradation process
005 01 02
38
40
42
44
46
48
50
a
a
a
A
Iron concentration (mmol l-1)
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
B
c
f
d
b
e
d
cb
a
k B (
h-1)
Figure 5 (A) Cell density increments of the consortium C2PL05 with the treatments 005 mmolmiddotl-1 01
mmolmiddotl-1 and 02 mmolmiddotl-1 Error bars show the standard error (B) Differences between treatments
(005 mmolmiddotl-1 01 mmolmiddotl-1 and 02 mmolmiddotl-1 ) and PAHs in the biodegradation kinetic
constant (kB) The letters show differences between groups (p lt 005 SNK) and the error bars the
standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
61
With reference to pH Figure 6A and statistical analysis (F26 = 1103 p lt 001 Table 1)
clearly show that the neutral pH of the medium favour the CDI of the consortium The kB of
the three different treatments (Figure 6B) also showed significant differences in the
interaction (F49 = 5 p lt 005 Table 1) The highest value of kB was observed for anthracene
degradation at neutral pH (Figure 6B) The other two PAH naphthalene and phenanthrene
did not show significantly differences between any treatments Therefore given that the
highest values of both parameters (CDI and kB) were observed at pH 7 this value will be
considered as the most efficient for the PAH biodegradation process
5 7 8
215
220
225
230
235
240
245
a
b
a
A
pH
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
25x10-2
30x10-2
B
b
a
ab ab
a
ab
c
ab ab
kB
(h-1
)
Figure 6 (A) Cell density increments of the consortium C2PL05 with the treatments pH 50 pH 70
and pH 80 Error bars show the standard error (B) Differences between treatments (pH 50 pH
70 and pH 80 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
62
The last factor analyzed was the addition of an easily assimilated carbon source
(Figure 7) Regarding to CDI values (Figure 7A) there were significant differences between
treatments (F26 = 45401 p lt 0001 Table 1) The addition of glucose as only carbon source
significantly improved CDI Figure 7B only show the kB of the treatments with PAH (100 or
50 of PAH) therefore the treatment with glucose as only carbon source was not included in
the ANOVA analysis The interaction between PAH and type of carbon source was
significant (F212 = 7 p lt 005 Table 1) The kB for the treatment with PAH and glucose
(5050) was significantly higher for phenanthrene and naphthalene (Figure 6B) although
there were no differences with the treatment for anthracene where PAH were the only carbon
source
PAHs (100)
PAHsGlucose (50)Glucose (100)
18
20
22
24
26
28
Carbon source
b
c
a
A
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-2
4x10-2
6x10-2
8x10-2
1x10-1
B
c
bb
b
b
a
k B (h
-1)
Figure 7 (A) Cell density increments of the consortium C2PL05 with the treatments PAHs (100)
PAHsglucose (5050) and glucose (100) Error bars show the standard error (B) Differences
between treatments (PAHs (100) and PAHs glucose (5050) ) and PAHs in the
biodegradation kinetic constant (kB) The letters show differences between groups (p lt 005 SNK)
and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
63
Discussion
It is important to highlight that the increments of the cell density is a parameter that brings
together all the microbial community whereas the biotic degradation constant is specific for
the PAH degrading microorganisms For that reason when the effect of the factors studied
on CDI and kB yielded opposite results the latter always prevailed since PAH degradation
efficiency is the main goal of the present optimisation study
With regard to the CNP molar ratio some authors consider that low ratios might limit
the bacterial growth (Leys et al 2005) although others show that high molar ratios such as
100101 are optimum for hydrocarbon polluted soils (Flathman et al 1994 Bouchez et al
1995 Eweis et al 1998) However in agreement with Leys et al (2005) our results
confirmed that the most effective molar ratio was the highest (1002116) This result
suggests that the supply of the inorganic nutrients during the PAH biodegradation process
may be needed by the microbial metabolism In addition the form used to supply these
nutrients can affect the metabolism of the microorganism (Carmichael amp Pfaender 1997) and
limit the amount of carbon that bacteria can assimilate limiting in turn the biodegradation
extent Our results showed that nitrate (sodium nitrate) as nitrogen source improved PAH
biodegradation as compared to ammonium This is likely due to the fact that nitrate is more
soluble and available for microorganisms than ammonium which has adsorbent properties
(Schlessinger 1991) The iron is other essential compound to stimulate the microbial activity
on PAH degradation (Dinkla amp Janssen 2003 Santos et al 2008)
On one hand iron acts as a cofactor of enzymes catalysing PAH oxidation (Dinkla amp
Janssen 2003) but it is also related with the production of biosurfactants (Santos et al
2008) These compounds are naturally produced by genera such as Pseudomonas and
Bacillus (Wei et al 2003) increasing the PAH solubility and therefore their bioavailability In
agreement with previous works (Dinkla amp Janssen 2003 Santos et al 2008) our results
confirmed that the addition of iron in a concentration of 01 mmoll-1 makes the
biodegradation more effective Santos et al (2008) stated that there is a limit concentration
above which the growth is inhibited due to toxic effects According to these authors our
results showed lower degradation and growth with the concentration 02 mmoll-1 since this
concentration may be saturating for these microorganisms However opposite to previous
works (Dinkla amp Janssen 2003 Santos et al 2008) the most effective iron form was
Fe2(SO4)3 for the PAH biodegradation likely due to the higher solubility which makes it more
available for the microorganism
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
64
The addition of easy assimilated carbon forms such as glucose for the PAH
degrading process can result in an increment in the total number of bacteria (Wong et al
2001) because PAH degrader population can use multiple carbon sources simultaneously
(Herwijnen et al 2006) However this increment in the microbial biomass was previously
considered (Wong et al 2001) because the utilization of the new carbon source may
increase the lag phase delaying the bacterial growth (Maier et al 2000) Our results
confirmed that PAH degradation was more efficient with the addition of an easy assimilated
carbon source probably because the augmentation of the total heterotrophic population also
enhanced the PAH degrading community Our consortium showed a longer lag phase during
the treatment with glucose than that observed during the treatment with PAH as only carbon
source (data not shown) These results are consistent with a consortium completely adapted
to PAH biodegradation and its enzymatic system requires some adaptation time to start
assimilating the new carbon source (Maier et al 2000)
Depending on the type of soil and the type of PAH to degrade the optimum pH range
can be very variable (Dibble amp Bartha 1979) Some acid resistant gram-positive bacteria
such as Mycobacterium sp show better PAH degradation capabilities under acid condition
because and low pH seems to render the mycobacterial more permeable to hydrophobic
substrates (Kim et al 2005) However other microorganisms belonging to Pseudomonas
genus prefer neutral pH conditions In agreement with previous works (ie Dibble amp Bartha
1979) our results confirmed that neutral pH is optimum for the biodegradation PAH
In summary the current work has shown that the optimization of environmental
parameters may significantly improve the PAH biodegradation process It is also important to
underline that the statistical analysis of data and the combined study of the bacterial growth
and the kinetics of the degradation process provide an accurate interpretation of the
optimisation results Concluding for an optimum bioremediation process is very important to
perform these previous bioassays to decrease the process development time and so the
associated costs
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Master en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
65
References
Alexander M 1994 Biodegradation and Biorremediation Academic Press New York
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse bacteria Int Biodeter
Biodegr 63 913-922
Bossert I amp Bartha R 1984 The fate of petroleum in soil ecosystems In Atlas RM (ed)
Petroleum microbiology Macmillan New York pp441-4473
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Carmichael LM amp Pfaender KF 1997 The effects of inorganic and organic supplements on
the microbial degradation of phenanthrene and pyrene in soils Biodegradation 8 1-
13
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge Appl Environ Microbiol 37 729-739
Dinkla EJT amp Janssen DB 2003 Simultaneous growth on citrate reduces the effects of
iron limitation during toluene degradation in Pseudomonas Microb Ecol 45 97-107
Eweis JB Ergas SJ Chang PY amp Schroeder ED 1998 Bioremediation Principles
McGraw-Hill Boston pp 136-236
Flathman PE Jerger DE amp Exner JH1994 Biorremediation-Field Experiences Lewis
Publishers Boca Raton pp 81-106 383-490
Gallego JL Garciacutea MJ Llamas JF Belloch C Pelaez AI amp Sanchez J 2007
Biodegradation of oil tank botton sludge using microbial consortia Biodegradation 18
269-281
Hall TA 1999 Bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 41 95-98
Heitkamp MA amp Cerniglia CE 1988 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from sediment below an Oil Field Appl Environ Microbiol 54
1612-1614
Kim YH Freeman JP Moody JD Engesse KH amp Cerniglia CE 2005 Effects of pH on
the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1
Appl Environ Microbiol 67 275-285
Kwok Chen-Ko amp Loh Kai-Che 2003 Effects of Singapore soil type on bioavalability of
nutrients in soil bioremediation Adv Environ Res 7 889-900
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
66
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Luning Prak DJ amp Pritchard PH 2002 Solubilization of polycyclic aromatic hydrocarbon
mixtures in micelar non-ionic surfactant solution Water Res 36 3463-3472
Maier MR Pepper LI amp Gerba PC 2000 Enviromental Microbiology Academic Press
Elsevier
Molina MC Gonzalez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz L 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Denaturing gradient gel
electrophoresis of PCR-amplified 16S Rdna a new molecular approach to analyse the
genetic diversity of mixed microbial communities In Akkermans ADL van Elsas JD
de Bruijn FJ (eds) Molecular microbial ecology manual Kluwer Academic Publishers
Dordrecht pp 1-23
Rolling-Wilfred FM Milner M Jones DM Lee K Daniel F Swanell-Richard JP amp Head
IM 2002 Robust hydrocarbon degradation and dynamic of bacterial communities
during nutrients-enhanced oil spillbiorremediation Appl Environ Microbiol 68 5537-
5548
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation an surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Vintildeas M Sabateacute J Guasp C Lalucat J y Solanas AM 2005 Culture-dependent and
independent aproaches establish the complexity of a PAH degrading microbial
consortium Can J Microbiol 51 897-909
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacillus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK Ma KK amp Fang M 2001 Isolation and optimization of
PAH-degradative bacteria from contaminated soil for PAH bioremediation Water Air
Soil Poll 13 1-13
Zaidi BR amp ImamSH 1999 Factors affecting microbial degradation of polycyclic aromatic
hydrocarbon phenanthrene in caribbean coastal water Mar Pollut Bull 38 738-749
Capiacutetulo
Aceptado en Water Air amp Soil Pollution (Febrero 2012)
Simarro R Gonzaacutelez N Bautista LF Molina MC amp Schiavi E
Evaluation of the influence of multiple environmental factors on the biodegradation
of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal
experimental design
Evaluacioacuten de la influencia de muacuteltiples factores ambientales en la biodegradacioacuten de dibenzofurano
fenantreno y pireno por un consorcio bacteriano usando un disentildeo experimental ortogonal
1b
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
69
Abstract
For a bioremediation process to be effective we suggest to perform preliminary studies in
laboratory to describe and characterize physicochemical and biological parameters (type and
concentration of nutrients type and number of microorganisms temperature) of the
environment concerned We consider that these studies should be done by taking into
account the simultaneous interaction between different factors By knowing the response
capacity to pollutants it is possible to select and modify the right experimental conditions to
enhance bioremediation
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
71
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic compounds composed of two
or more aromatics rings High molecular weight PAH (HMW-PAH) with four (ie pyrene) or
more aromatics rings and other heterocyclic aromatic compounds as dibenzofuran both with
high molecular mass are often more difficult to biodegrade that other low molecular weight
PAH (LMW-PAH) due to their lower solubility and biodegradability Many of them have toxic
mutagenic and carcinogenic properties and the effects of PAH as naphthalene or
phenanthrene in animals and humans their toxicity and carcinogenic activity has been
reported and well documented (Sudip et al 2002) In addition PAH are bioaccumulated in
the environment and trophic chains properties that increase with the numbers of rings There
is a natural degradation carried out by microorganism able to use PAH as carbon source
which represents a considerable portion of the bacterial communities present in polluted soils
(Heitkamp amp Cerniglia 1998) However this natural biodegradation may be affected by
environmental factors which optimization allows us to achieve a more efficient process
Temperature is a key factor in the physicochemical properties of PAH as well as in the
metabolism of the microorganisms Although it has been shown that biodegradation of PAH
is possible even at temperatures lower than 5 ordmC (Eriksson et al 2001) it is usually more
efficient at mild temperatures (15-25 ordmC) (Mohn amp Stewart 2000) The carbon nitrogen and
phosphorus (CNP) molar ratio is another important factor in biodegradation process
because affect the dynamics of the bacterial metabolisms changing the PAH conversion
rates and growth of PAH-degrading species (Leys et al 2004) The form in which these
essential nutrients are supplied affects the bioavailability for the microorganism being more
soluble and efficient the oxidated forms (such as nitrates) than reduced forms (such as
ammonium) (Schlessinger 1991)
Surfactants are compounds used to increase the PAH solubility although both
positive (Boochan et al 1998 Jin et al 2007) and negative effects (Boochan et al 1998
Laha amp Luthy 1992) on the biodegradation process has been reported The nature of the
effect depends on several factors such as the type and concentration of surfactant due to
the toxic properties of some of them (Jin et al 2007) and the increasing of toxicity of PAH
produced by increasing their solubility (Thibault et al 1996) Another factor considered is the
inoculum size related to the diversity and effectiveness of the biodegradation because in a
diluted inoculum the minority microorganisms which likely have an important role in the
biodegradation process can be removed (Szaboacute et al 2007) Moreover it has been
reported (Szaboacute et al 2007) that the addition of a readily metabolized carbon source (ie
glucose) improves the PAH degradation possibly due to the increased biomass although in
72
others cases (Wong et al 2000) this better bacterial growth reduced significantly PAH
degradation
We consider that the study of the individual effect of abiotic factors on the
biodegradation capacity of the microbial consortium is incomplete because the effect of one
factor can be influenced by other factors In this work the combination between factors was
optimized by an orthogonal experimental design fraction of the full factorial combination of
the selected environmental factors
Hence our two mains goals are to determine the optimal conditions for the
biodegradation of low (phenanthrene and dibenzophurane) and high (pyrene) molecular
weight PAH by a bacterial degrading consortium (C2PL05) and the study of the influence of
the factors (temperature CNP molar ratio type of nitrogen and iron source iron source
concentration carbon source surfactant concentration and inoculums dilution) in the
biodegradation In order to achieve these objectives we realized an orthogonal experimental
design to take into account all combination between eight factors temperature CNP molar
ratio nitrogen and iron source iron concentration addition of glucose surfactant
concentration and inoculum dilution at three and two levels
Material and methods
Chemicals and media
Dibenzofuran phenanthrene and pyrene (gt99 purity) were purchased from Sigma-Aldrich
Steinheim Germany) Stock mix of the three PAH was prepared by dissolving the necessary
amount in n-hexane (Fluka Steinheim Germany) In previously work (Bautista et al 2009)
we tested that the optimal surfactant for the consortium was the biodegradable and non
toxicTween-80 (Sigma-Aldrich Steinheim Germany) Bushnell-Haas Broth medium (BHB)
was purchased from Panreac (Barcelona Spain) and its original composition (02 g l-1
MgSO4middot7H2O 002 g l-1 CaCl2 2H2O 1 g l-1 KHPO4 1 g l-1 K2HPO4 1 g l-1 NH4NO3 005 g l-1
FeCl3) was modified according to the treatment (see Table 1)
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
73
Table 1 Experimental design
Treatment T
(ordmC) CNP (molar)
N source
Fe
source
Iron source concentration
(mM)
Glucose PAH ()
Surfactant concentration
Inoculum dilution
1 30 100505 (NH4)2SO3 Fe2(SO4)3 02 0100 CMC 10-3
2 20 1002116 (NH4)2SO3 FeNO3 005 0100 + 20CMC 10-2
3 25 100101 NaNO3 FeNO3 02 0100 + 20CMC 10-1
4 20 100505 NaNO3 Fe2(SO4)3 02 5050 + 20CMC 10-2
5 25 100505 NH4NO3 FeNO3 01 5050 CMC 10-2
6 30 100101 NH4NO3 Fe2(SO4)3 005 8020 + 20CMC 10-2
7 30 100101 NaNO3 FeCl3 01 0100 CMC 10-2
8 20 100505 NaNO3 FeCl3 005 8020 CMC 10-1
9 25 1002116 (NH4)2SO3 FeCl3 02 8020 CMC 10-2
10 20 1002116 NH4NO3 Fe2(SO4)3 01 0100 CMC 10-1
11 20 100101 NH4NO3 FeNO3 02 8020 CMC 10-3
12 25 100101 (NH4)2SO3 Fe2(SO4)3 005 5050 CMC 10-1
13 25 1002116 NaNO3 Fe2(SO4)3 01 8020 + 20CMC 10-3
14 30 1002116 NH4NO3 FeCl3 02 5050 + 20CMC 10-1
15 25 100505 NH4NO3 FeCl3 005 0100 + 20CMC 10-3
16 30 1002116 NaNO3 FeNO3 005 5050 CMC 10-3
17 30 100505 (NH4)2SO3 FeNO3 01 8020 + 20CMC 10-1
18 20 100101 (NH4)2SO3 FeCl3 01 5050 + 20CMC 10-3
Bacterial consortium
PAH-degrading consortium C2PL05 was isolated from a soil in a petrochemical complex in
Puertollano (Spain) and was identified and described in Molina et al (2009) All strains of
the consortium C2PL05 isolated by culture-dependent techniques were γ-Proteobacteria
and the strains presents belong to the genera Enterobacter Pseudomonas and
Stenotrophomonas (Molina et al 2009) In addition the diversity of the enriched microbial
consortium was characterised by a non culture-dependent molecular technique such as
denaturing gradient gel electrophoresis (DGGE) following the procedure described
elsewhere (Molina et al 2009) using the primers 341F-GC and 907R (GC clamp 5acute-CGC
CCG CCG CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995)
Experimental design
An orthogonal design form of L18 (37) (21) selected from the module of Statistica (Version 60)
was used to do the multi-factor combination A total of 18 experiments each in triplicate
were carried out in 100 ml Erlenmeyers flask with a total volume of 50 ml of Bushnell-Haas
Broth medium (BHB) (Panreac Barcelona Spain) with an original composition modified
74
according to the treatments requirements (see Table 1) The replicates were incubated in an
orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA) at 150 rpm under dark
conditions but prior to inoculate the consortium the flasks were shaken overnight to
equilibrate and solubilize most of the PAH In Table 1 shows a summary of environmental
conditions and incubation of each treatment Tween-80 concentration was 0012 mM the
critical micellar concentration (CMC) 100 of PAH was equivalent to 03 g l-1 (01 g l-1 of
each PAH) The initial cell concentration of the inoculum consortium was determined by the
most probably number (MPN) method (Wrenn amp Venosa 1983) The number of heterotrophic
microorganisms (315x106 cell ml-1) was measured with Luria Base broth (LB Panreac
Barcelona Spain) with glucose as carbon source and the PAH degrading microorganisms of
the consortium (695x105 cell ml-1) with BHB with PAH mix as carbon source
Cell density
Bacterial density during the PAH degrading process was monitored at 0 15 24 39 48 63
72 87 95 and 159 h by the increase in absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) Throughout the cell growth curve we
calculated the average of the cell densities increments (CDI) applying the equation 1
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and i
corresponds to each sample or sampling time The increments were normalized by
the initial absorbance measurements to correct the effect of the inoculum dilution
PAH extraction and analysis
At the end of each experiment (159 hours) PAH were extracted with dichloromethane and
the residue precipitated was dissolved in 1 ml of acetonitrile for high performance liquid
chromatography (HPLC) analysis using a ProStar 230 HPLC system (Varian Palo Alto CA
USA) with a reversed phase C18 column following the method previously described (Bautista
et al 2009) The residual concentration of each PAH was calculated from a standard curve
based on peak area at a wavelength of 254 nm The average percentage of phenanthrene
pyrene and dibenzofuran and average percentage of total PAH degradation (PD) for each
treatment are shown in Table 2
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
75
Statistical analyses
The effect of the individual parameters on the CDI and on the PD were analysed by a
parametric one-way analysis of variance (ANOVA) The variances were checked for
homogeneity by the Cochranacutes test Students-Newman-Keuls (SNK) test was used to
discriminate among different variables after significant F-test When data were not strictly
parametric Kruskal-Wallis test and Tukey-type multiple comparison test were used
The orthogonal design to determine the optimal conditions for PAH biodegradation is
an alternative to the full factorial test which is impractical when many factors are considered
simultaneously (Chen et al 2008) However the orthogonal test allows a much lower
combination of factors and levels to test the effect of interacting factors
Results and discussion
The consortium C2PL05 degrade phenanthrene pyrene and dibenfuran efficiently in 159 h
(Table 2) and also other PAH as naphthalene and anthracene (Molina et al 2009) The
study of the influence of each factor in the total PD (Figure 1) showed that only the carbon
source influenced in this parameter significantly (Table 3) Results concerning to carbon
source showed that PD were higher when PAH were added as only carbon source (100 of
PAH) The reason why the PD did not show statistical significance between treatments
except for the relative concentration of PAH-glucose may be due to significant changes
produced in PD at earlier times when PAH were still present in the cultivation media
However the carbon source incubation temperature and inoculum dilution were factors that
significantly influenced CDI (Table 3 Figure 2)
76
Table 2 Final percentage degradation of
phenanthrene (Phe) pyrene (pyr) and dibenzofuran
(Dib) and total percentage degradation (total PD) for
each treatment
percentage degradation Treatment Phe Pyr Dib Total PD
1 965 883 864 904 2 969 950 833 917 3 966 895 845 902 4 972 915 921 872 5 969 904 950 882 6 982 935 995 852 7 964 883 859 902 8 977 953 964 823 9 976 936 984 825 10 970 910 895 925 11 979 968 986 888 12 966 889 920 850 13 978 930 993 835 14 966 897 943 871 15 963 881 898 914 16 963 886 951 867 17 977 954 986 861 18 976 930 967 915
The conditions corresponding to listed treatments
are presented in Table 1
100
50
5
100
101
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
82
84
86
88
90
92 T (ordmC)
aa
a
aa
aa
aa
a
Tot
al P
D (
)
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
(SO
4)3
a
a
0acute05 0acute1
0acute2
Fe source
a
a
a
0 -
100
50 -
50
80 -
20
C Fe (mM)
a
b
c
CM
C
+ 2
0 C
MC
Gluc-PAHs
aa
10^-
1
10^-
2
10^-
3DilutionCMC
aa
a
Figure 1 Graphical analysis of average values of total percentage degradation (PD) under
different treatments and levels of the factors () represent the average of the total PD of the
treatments of each level Letters (a b and c) show differences between groups
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
77
Table 3 Analysis of variance (ANOVA) summary for the increments of cell density (CDI) and the total
percentage degradation (PD) of each factor MS is the mean of squares and df degrees of freedom
ANOVA of CDI ANOVA of total PD
Factor df MS F-value p-value df MS F-value p-value
T (ordmC) Error
2 056 1889 2 22 183 ns
51 002 51 12
Molar ratio CNP Error
2 003 069 ns 2 22 183 ns
51 005 51 12
N source Error
2 001 007 ns 2 214 177 ns 51 005 51 121
Fe source Error
2 003 066 ns 2 89 071 ns
51 005 51 126
Fe concentration Error
2 007 146 ns 2 118 095 ns 51 005 51 124
Glucose-PAH Error
2 024 584 2 1802
3085 51 004 51 395
8
CMC Error
1 001 027 ns 1 89 071 ns
52 005 52 125
Inoculum Dilutionb Error
2 331 a 2 113 091 ns 54 6614 51 125
a H-value obtained of Kruskal-Wallis test used for non parametric data Chi-square = 28 Overall
median = 044
p-value lt 001
p-value lt 0001
100
50
5
100
100
1
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
16
17
18
19
20
21
a
a
aa
a
aa
a
c
bCD
I
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
SO
4
Fe source
a
a
0acute05 0acute1
0acute2
C Fe (mM)
a
a
a
0-10
0
50-5
0
80-2
0
Gluc-PAH
a
b
c
CM
C
+ 2
0 C
MC
CMC
aa
10^-
1
10^-
2
10^-
3
00
05
10
15
20
25
30
35C
DI n
orm
aliz
ed
DilutionT (ordmC)
b
a
a
Figure 2 Graphical analysis of average values of cell density increments (CDI) and normalized cell
density increments (CDI normalized) of different treatments and levels of the factors () represent the
average of the CDI or CDI normalized of the treatments of each level Letters (a b and c) show
differences between groups
78
The temperature range considered in the present study might not affect the
biodegradation process since it is considered narrow by some authors (Wong et al 2000)
Nevertheless we observed significant differences in the process at different temperatures
showing an optimum at 25 ordmC for our microbial consortium growth (Figure 2) whereas when
consortium was incubated at 20 ordmC and 30 ordmC microorganisms remained in lag phase These
results were in agreement with the fact that respiration increases exponentially with
temperature (Q10 relationship) (Lloyd amp Taylor 1994) but increasing or decreasing
temperature beyond the optimal value will cause a reduction in microbial respiration We
suggest that moderate fluctuation of temperatures affect microbial growth rate but not
degradation rates because degrading population is able to degrade PAH efficiently in a
temperature range between 20-30 ordmC (Sartoros et al 2005)
The nutrient requirements for microorganisms increase during the biodegradation
process so a low CNP molar ratio can result in a reduced of the metabolic activity of the
degrader microorganisms and thus reduce their potential degrader (Leys et al 2004)
According to this author CNP ratios above 100101 provide enough nutrients to metabolize
the pollutants However our results showed that the CNP ratios supplied to the cultures
even the ratio 100505 did not affect the CDI and total PD This results indicate that the
consortium C2PL05 is able to degrade PAH even under low nutrients conditions due to its
high adaptation to the hard conditions of a chronically contaminated soil The results
concerning the addition of different nitrogen and iron sources did not show significant
difference in CDI and total PD Other works (Schelessinger 1991 Santos et al 2008) have
suggested that the addition of nitrogen in form of nitrates (Schelessinger 1991) and the iron
in form of sulphates or chlorides (Santos et al 2008) is more effective due to their high
solubility
The addition of readily biodegradable carbon source as glucose to a polluted
environment is considered an alternative to promote biodegradation The easy assimilation of
this compound result in an increase in total biomass (heterotrophic and PAH degrader
microorganisms) of the microbial population thereby increasing the degradation capacity of
the community Piruvate are a carbon source that promote the growth of certain degrading
strains as Pseudomonas putida (Lee et al 2003) whereas salicylate induces the synthesis
and activation of degradative enzymes (Chen amp Aitken 1999) Similarly to previous results
observed by Wong et al (2000) in the present study the addition of glucose to the cultures
had significant effects in total PD and CDI (Figure 1 Figure 2) Although the consortium
C2PL05 showed a significantly better growth with 80 of glucose the difference between
treatments (0100 5050 8020 of glucosePAH) showed that PD was higher when PAH
were added as only carbon source Previously it has been described that after a change in
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
79
the type of carbon source supplied to PAH-degrader microorganisms an adaptation period
for the enzymatic system was required reducing the mineralization rate of pollutants (Wong
et al 2000 Maier 2009 Simarro et al 2010) As glucose was added as additional carbon
source our results show an increase in CDI although the PD values decrease significantly
This indicated that glucose enhance the overall growth of consortium but decrease the
biodegradation rate of PAH-degrader population due to the adaptation of the corresponding
enzymatic system So in this case the addition of a readily carbon source retards the
biodegradation process The addition of surfactant to the culture media at concentration
above their CMC is essential to increase PAH degradation rate (Pantsyrnaya et al 2011)
However Yuan et al (2000) reported negative effects when the surfactant was added at
concentration above the CMC because the excess of micelles around PAH reduces their
bioavailability (Mulligan et al 2001) However our results showed that PD and CDI were not
affected by concentrations largely beyond the CMC Some non biodegradable surfactants
can be toxic to bacteria and therefore do not improve the biodegradation process (Bautista et
al 2009) Tween-80 was the optimal surfactant for the strains of the consortium C2PL05
(Bautista et al 2009) However the optimal type of surfactant is determined by the type of
degrading strains involved in the process (Bautista et al 2009) In addition it is important to
consider the possible use of surfactant as a carbon source by the strains preferentially to
PAHs which would reduce the rates of biodegradation (Kim amp Weber 2003)
Further dilution of the inoculum represents the elimination of minority species which
could result in a decrease in the degradation ability of the consortium if the eliminated
species represented an important role in the biodegradation process (Szaboacute et al 2007)
Our results concerning the inoculum concentration showed that this factor significantly
influenced in CDI but had no effect on total PD indicating that the degrading ability of the
consortium has not been altered by the dilution of the same In Gonzalez et al (2011) the
evolution and bacterial succession of the consortium C2PL05 by culture-dependent
techniques are described All of these identified strains were efficient in degradation of PAH
(Bautista et al 2009) but Enterobacter sp was dominant at the beginning of the degradation
process whereas Stenotrophomonas sp and Pseudomonas sp were less abundant In
addition DGGE fingerprint pattern studied and described in Molina et al (2009) showed a
low microbial diversity of the consortium C2PL05 typical of an enriched consortium from
chronically contaminated soil (Vintildeas et al 2005) The results present in this work suggest
that in cultures inoculated with the highest dilution of the consortium (10-3) the less abundant
microorganisms were eliminated reducing the competition for the dominant species which
can grow vigorously
80
The influence of some environmental factors on the biodegradation of PAH can
undermine the effectiveness of the process In this study the combination of all factors
simultaneously by an orthogonal design has allowed to establish considering the interactions
between them the most influential parameters in biodegradation process Finally we
conclude that the only determining factor in biodegradation by consortium C2PL05 is the
carbon source Although cell growth is affected by temperature carbon source and inoculum
dilution these factors not condition the effectiveness of degradation Therefore the optimal
condition for a more efficient degradation by consortium C2PL05 is that the carbon source is
only PAH
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Maacutester en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
81
References
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Boochan S Britz ML amp Stanley GA 1998 Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophila
Biotechnol Bioeng 59 482-494
Chen S-H amp Aitken MD 1999 Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
EnvironSci Technol 33 435ndash439
Chen J Wong MH Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAHs) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in Artic Tundra soil Appl EnvironMicrobiol 67 5107-
5112
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438-9446
Heitkamp MA amp Cerniglia CE 1998 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from Sediment below an oil field Appl EnvironMicrobiol 54
1612-1614
Jin D Jiang X Jing X amp Ou Z 2007 Effects of concenrtration head group and structure of
surfactants on the biodegradation of phenanthrene J Hazard Mater 144 215-221
Kim HS amp Weber WJ 2003 Preferential surfactant utilization by a PAH-degrading strain
effects on micellar solubilization phenomena Environ Sci Technol 37 3574-3580
Laha S amp Luthy RG 1992 Effect of non-ionic surfactants on the solubilization and
mineralization of phenanthrene in soil-water systems Biotechnol Bioeng 40 1367-
1380
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegradation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Leys MN Bastiaens L Verstraete W amp Springael D 2004 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Lloyd J amp Taylor JA 1994 On the temperature dependence of soil respiration Funct Ecol
8 315-323
82
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mulligan CN Young RN amp Gibbs BF 2001 Surfactant enhanced remediation of
contaminated soil a review Eng Geol 60 371-380
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Molecular microbial ecology manual
(Eds Akkermans ADL van Elsas JD Bruijn FJ) Kluwer Academic Publishers
Dordrecht pp 1-23
Pantsyrnaya T Blanchard F Delaunay S Georgen JL Geacuteudon E Guseva E amp Boudrant
J 2011 Effect of surfactants dispersion and temperature on solubility and
biodegradation of phenanthrene in aqueous media Chemosphere 83 29-33
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation and surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Sartoros C Yerushalmi L Beroacuten L amp Guiot S 2005 Effects of surfactant and temperature
on biotransformation kinetics of anthracene and pyrene Chemistry 61 1042-1050
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Sudipt KS Om VS amp Rakesh KJ 2002 Polycyclic aromatic hydrocarbons environmental
pollution and bioremediation Trends Biotechnol 20 243ndash248
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquatic Microbl Ecol 47 1-10
Thibault SL Anderson M amp Frankenberger WTJr 1996 Influence of surfactant on pyrene
desorption and degradation in soils Appl Environ Microbiol 62 283-287
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Poll 139 1-13
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
83
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon degrading bacteria by most-probably-number (MPN) Can J Microbiol
4 252-258
Yuan SY Wei SH amp Chang BV 2000 Biodegradation of polycyclic aromatic
hydrocarbons by a mixed culture Chemosphere 41 1463-1468
Capiacutetulo
Publicado en Bioresource Technology (2011) 102 9438-9446
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA
Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process
Efecto de los surfactantes en la biodegradacioacuten de HAP por un consorcio bacteriano y dinaacutemica de la comunidad
bacteriana durante el proceso
2
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
87
Abstract
The aim of this work was to evaluate the effect of a non-biodegradable (Tergitol NP-10) and
a biodegradable (Tween-80) surfactant on growth degradation rate and microbial dynamics
of a polycyclic aromatic hydrocarbon (PAHs) degrading consortium (C2PL05) from a
petroleum polluted soil applying cultivable and non cultivable techniques Growth and
degradation rate were significantly lower with Tergitol NP-10 than that with Tween-80
Toxicity did not show any significant reduction with Tergitol NP-10 whereas with Tween-80
toxicity was almost depleted (30) after 40 days Regarding to the cultured bacteria
Pseudomonas and Stenotrophomonas groups were dominant during PAH degradation with
Tergitol NP-10 whereas Enterobacter and Stenotrophomonas were dominant with Tween-80
DGGE analyses (PRIMER and MDS) showed that bacteria composition was more similar
between treatments when PAHs were consumed than when PAHs concentration was still
high Community changes between treatments were a consequence of Pseudomonas sp
Sphingomonas sp Sphingobium sp and Agromonas sp
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
89
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic pollutants composed of two
or more fused aromatic rings produced by natural and anthropogenic sources Besides
being toxic carcinogenic and mutagenic compounds the semi-volatile properties of some
PAH make them highly mobile throughout the environment (air soil and water) In addition
PAH have a high trophic transfer and biomagnification within the ecosystems due to the
lipophilic nature and the low water solubility that decreases with molecular weight (Clements
et al 1994) The importance of preventing PAH contamination and the need to remove PAH
from the environment has been recognized institutionally by the Unites States Environmental
Protection Agency (US-EPA) which has proposed 16 PAH as priority pollutants including
naphthalene phenanthrene and anthracene Currently governmental agencies scientist and
engineers have focused their efforts to identify the best methods to remove transform or
isolate these pollutants through a variety of physical chemical and biological processes
Most of these techniques involve expensive manipulation of the pollutant transferring the
problem from one site or phase to another (ie to the atmosphere in the case of cremation)
(Haritash amp Kausshik 2009) However microbial degradation is one of the most important
processes that PAH may undergo compared to others such as photolysis and volatilization
Therefore bioremediation can be an important alternative to transform PAH to less or not
hazardous forms with less input of chemicals energy and time (Haritash amp Kaushik 2009)
Most of the contaminated sites are characterized by the presence of complex mixtures
of pollutants Microorganisms are very sensitive to low concentrations of contaminants and
respond rapidly to environment perturbations (Andreoni et al 2004) Therefore microbial
communities chronically exposed to PAH tend to be dominated by those organisms capable
of use PAH as carbon and energy source (Gallego et al 2007) Even in areas previously
unpolluted there is a proportion of microbial community composed by PAH degrading
bacteria able to degrade PAH (Surridge et al 2009) These microbial communities subjected
to a polluted stress tend to be less diverse depending on the complexity of the composition
and the time of exposure (MacNaughton et al 1999) The biodegradation of hazardous
compounds by bacteria fungi and algae has been widely studied and the success of the
process will be due in part to the ability of the microbes to degrade all the complex pollutant
mixture However most of the PAH degradation studies reported in the literature have used
versatile single strains or have constructed an artificial microbial consortium showing ability
to grow with PAH as only carbon source by mixing together several known strains (Ghazali et
al 2004) Nevertheless pure cultures and synthetic microbial consortia do not represent the
natural behaviour of microbes in the environment since the cooperation among the new
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
90
species is altered In addition changes in microbial communities during pollutant
biotransformation processes are still not deeply studied Microbial diversity in soil
ecosystems can reach values up to 10 billion microorganisms per gram and possibly
thousands of different species although less than 10 can be culturables (Torsvik amp Ovreas
2002) Therefore additional information on biodiversity ecology dynamics and richness of
the degrading microbial community can be obtained by non-culturable techniques such as
DGGE In addition small bacteria cells are not culturable whereas large cells are supposed
to account 80 of the total bacterial volume (Nannipieri et al 2003) Therefore despite their
low proportion culturable bacteria can provide essential information about the structure and
functioning of the microbial communities With the view focused on the final bioremediation
culture-dependent techniques are necessary to obtain microorganisms with the desired
catabolic traits for bioaugmentation processes in polluted soils The PAH degradation is
limited by their low aqueous solubility but surfactants which are amphypatic molecules
enhance the solubility of hydrophobic compounds (Kolomytseva et al 2009) Previous works
(Bautista et al 2009) have shown that efficiency of a consortium named C2PL05 composed
by PAH degrading bacteria was significantly higher using surfactants
One of the main goals of the current work was to understand if culturable and non
culturable techniques are complementary to cover the full richness of a soil microbial
consortium A second purpose of the study was to describe the effect of different surfactants
(biodegradable and non-biodegradable) on growth rate PAH degradation rate and toxicity
reduction of a bacterial consortium (C2PL05) The microbial consortium C2PL05 was
isolated from a soil chronically exposed to petroleum products collected from a
petrochemical complex Finally the work is also aimed to describe the microbial dynamics
along the biodegradation process as a function of the surfactant used to increase the
bioavailability of the PAH
Material and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all 99 purity) were purchased from Sigmandash
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) Reagent grade
dichloromethane and n-hexane were supplied by Scharlau Chemie (Barcelona Spain)
Surfactants (Tween-80 and Tergitol NP-10) used were supplied by Sigma-Aldrich (Steinheim
Alemania) Bushnell-Haas Broth medium (BHB) was purchased from Panreac (Barcelona
Spain) and its composition is 02 g l-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 10 gmiddotl-1 KHPO4
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
91
10 gmiddotl-1 K2HPO4 10 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 Luria-Bertani media (LB) glucose and
phosphate buffer saline (PBS) were purchased from Panreac (Barcelona Spain)
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1 g of sieved soil (lt2 mm) was resuspended in
10 ml of PBS and incubated during 12 h in an orbital shaker (Innova 40 New Brunswick
Scientific Edison NJ USA) at 150 rpm and 25 ordmC under dark conditions After that 15 ml of
the supernatant was inoculated in 50 ml of BHB broth (pH 70) containing 1 wt Tween-80
as surfactant and naphthalene phenanthrene and anthracene (each at 250 mg l-1) as carbon
source Then the culture was incubated at 150 rpm and 25 ordmC under dark conditions until the
exponential phase was completed This was confirmed by monitoring the cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK) Then the consortium was stored at 4 ordmC to
stop growth At the beginning of each experiment 500 μl of the stored consortium (asymp 16 AU)
was inoculated in Erlenmeyer flasks
Experimental design and treatments conditions
To evaluate the influence of Tween-80 and Tergitol NP-10 (biodegradable and non-
biodegradable surfactant respectively) on the degrading capacity of the consortium C2PL05
as well as the evolution of its microbial community two different treatments each in triplicate
were carried out The replicates were performed in 100 ml Erlenmeyer flasks with 50 ml of
BHB medium (pH 70) Tween-80 or Tergitol NP-10 as surfactants (1 vv) a mixture of
naphthalene phenanthrene and anthracene in n-hexane (final concentration 500 mgmiddotl-1) and
500 microl of the C2PL05 consortium (88middot108 heterotrophic cellsmiddotml-1 and 44middot107 PAH degrading
cellsmiddotml-1 for the treatments with Tween-80 73middot105 heterotrophic cellsmiddotml-1 and 24middot103 PAH
degrading cellsmiddotml-1 for treatment with Tergitol NP-10) The replicates were incubated in an
orbital shaker (Innova 40) at 150 rpm and 25 ordmC under dark conditions during 45 days
Previously to inoculate the consortium the Erlenmeyer flasks were shaked overnight to
reach the solubility equilibrium of PAH and to allow the complete evaporation of n-hexane
Samples vigorously shaking to ensure homogeneity were withdrawn twice a day for 45 days
except for the initial 24 hours where the sampling frequency was higher Cell growth PAH
(soluble and precipitated) toxicity and number of heterotrophic and PAH degrading cells
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
92
were measures in all samples To study the dynamic of the microbial consortium through
cultivable and non-cultivable methods samples were withdrawn at 0 15 and 30 days
Bacterial growth MPN and toxicity assays
Bacterial growth was monitored by changes in the absorbance of the culture media at 600
nm using a Spectronic Genesys spectrophotometer According to the Monod equation
(Equation 1) the specific growth rate micro is essentially equal to micromax when substrate limitation
is avoided
SK
S
S
max
(Equation 1)
Therefore from the above optical density data the maximum specific growth rate (micromax)
was estimated as the logarithmized slope of the exponential phase applying the following
equation (Equation 2)
Xdt
dX (Equation 2)
where micromax is the maximum specific growth rate Ks is the half-saturation constant S
is the substrate concentration X is the cell density t is time and micro is the specific
growth rate In order to evaluate the ability of the consortium to growth with
surfactants as only carbon source two parallel treatments were carried out at the
same conditions than the two treatments above described but in absence of PAH
Heterotrophic and PAH-degrading population from the consortium C2PL05 were
enumerated during the PAH degrading process comparing the effect of Tergitol NP-10 and
Tween-80 as surfactants The estimation was performed by using a miniaturized MPN
technique in 96-well microtiter plates with eight replicate wells per dilution Total
heterotrophic microbial population was enumerated in 180 μl of Luria Bertani (LB) medium
with glucose (15 gmiddotl-1) and 20 microl of the microbial consortium PHA-degrading population were
counted in BHB medium (180 microl including the surfactant) 20 microl of a mixture of phenanthrene
anthracene and naphthalene in hexane (each at a final concentration of 500 mgmiddotl-1) and 20 microl
of the microbial consortium in each well The MPN scores were transformed into density
estimates accounting for their corresponding dilution factors
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
93
The toxicity was monitored during PAH degradation and estimations were carried out
using the Microtox assay with the bioluminescent bacterium Vibrio fischeri Three controls
considered as 0 inhibition were prepared with the photobacterium and 2 NaCl (vv) and
three blanks as 100 inhibition containing only 2 NaCl (vv) Samples were salted with
NaCl (2 vv final concentration) and the toxicity was expressed as the percentage of the V
fischeri inhibition after 15 min of incubation at 15 ordmC To study the toxicity of the medium
caused by PAH when the surfactants were not added toxicity evolution was measured from
a treatment with PAH as carbon source and degrading consortia but without surfactant under
same conditions previously described
PAH monitoring
In order to compare the effect of the surfactant on the PAH depletion rate naphthalene
phenanthrene and anthracene concentrations in the culture media were analysed using a
reversed-phase C18 column (Luna C18(2) 75 cm length x 46 mm ID 3 microm particle size
Phenomenex Torrance CA USA) following the method described elsewhere (Bautista et
al 2009) The concentration of each PAH was calculated from a standard curve based on
peak area at 254 nm The apparent first-order kinetic constant (kB) due to biotic processes
was calculated by applying Equation 3
iBiiAii
i CkCkdt
dCr (Equation 3)
where C is the PAH concentration kA is the apparent first-order kinetic constant due to
abiotic processes kB is the apparent first-order kinetic constant due to biological
processes t is the time elapsed and the subscript i corresponds to each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40) at 150 rpm and 25ordmC under dark
conditions PAH concentration in the control experiments were analyzed using the HPLC
system described previously The values of kA for each PAH were calculated by applying Eq
2 considering kB asymp 0 since no bacterial consortium was inoculated The amount of
precipitated and bioadsorbed PAH was measured after centrifugation of the samples Then
dichloromethane was added to the pellet and this extraction was repeated three times and
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
94
the fractions pooled The solvent was evaporated using a nitrogen flow and the extract was
dissolved into a known volume of acetonitrile for HPLC analysis
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
Samples from cultures of the bacterial consortium C2PL05 during the PAH degrading
process were collected to identify the effect of the surfactants (Tergitol NP-10 and Tween-80)
To get about 20-30 colonies isolated at each collecting time samples of each treatment were
streaked onto Petri plates with BHB medium and purified agar and were sprayed with a
mixture of naphthalene phenanthrene and anthracene in n-hexane (final concentration 500
mgl-1) as carbon source The Petri plates were incubated at 25 ordmC under dark conditions
The isolated colonies were transferred onto LB agar-glucose plates in order to increase
microbial biomass for DNA extraction and stored in 50 glycerol (vv) at -80 ordmC In total 91
degrading colonies from the treatment with Tween-80 and 83 degrading colonies from the
treatment with Tergitol NP-10 were isolated
Total DNA was extracted using Microbial DNA isolation kit (MoBio Laboratories
Solano Beach CA USA) to perform the molecular identification of the PAH-degrader
isolated cultured (DIC) Amplification of the 16S rRNA coding region of the DNA was
performed as described by Vintildeas et al (2005) using the primers 16F27 (5rsquo-
AGAGTTTGATCMTGGCTCAG-3rsquo) and 16R1488 (5rsquo-TTACCTTGTTACGACTTCAGG-3rsquo) and
sequenced using the same primers Sequences were edited and assembled using
ChromasPro software version 142 (Technelysium Pty Ltd Tewantin Australia)
All of the 16S rRNA gene sequences were edited and assembled by using BioEdit
software version 487 BLAST search (Madden et al 1996) was used to find nearly identical
sequences for the 16S rRNA sequences determined Sequences were aligned using the Q-
INS-i algorithm (Katoh amp Toh 2008) of the multiple sequence alignment software MAFFT
version 6611 aligning sequences in a single step Sequence data obtained and 34
sequences downloaded from GenBank were used to perform the phylogenetic trees
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates by using PAUP
version 40B10 Maximum parsimony (MP) was also analyzed using PAUP 40B10 as is
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
95
described in Molina et al (2009) Sequences of Aquifex piruphilus were used as out-group
according to previous phylogenetic affiliations (Vintildeas et al 2005)
Denaturing gradient gel electrophoresis from microbial consortium during PAH degrading
process
Non culture dependent molecular techniques such as denaturing gradient gel
electrophoresis (DGGE) were performed to know the effect of the surfactant on the total
biodiversity of the microbial consortium C2PL05 during the PAH degradation process and
compared with the initial composition of the consortium The V3 to V5 variable regions of the
16S rRNA gene were amplified using the primers set 16S 518F and 16S 338R-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primers 338R-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded onto a 10
(wtvol) polyacrilamide gels that was 075 mm tick with a denaturing gradient of 35-65
(100 denaturant contained 7 M urea and 40 formamide) DGGE was performed in 1xTAE
buffer (20 M Tris-acetate 100 mM Na2EDTA pH 74) using a DGGE 2401 system (CBS
Scientific Co Del Mar CA USA) at 80 V and 60 ordmC for 16 h Gels were stained for 45 min in
1xTAE buffer containing Syber-Gold (500 μlmiddotl-1) and viewed under UV light Predominant
bands in DGGE gel were excised with a sterile razor blade and diluted in 50 μl of deionized
water overnight at 4ordmC Due to impossibility of reamplified bands DNA of the bands was
cloned in the pGEM-T Easy Vector (Promega Madison WI) Sequence of this PAH-degrader
uncultured bacterium (DUB) were edited and assembled as described above and included in
the matrix to perform the phylogenetic tree as described previously using the identification
code DUB
Statistical analyses
The maximum specific growth rate (micromax) and the kinetic constant of PAH biodegradation (kB)
were evaluated by both one and two-way analysis of variance (ANOVA) using Statistica 60
software (Statsoft Inc Tulsa OK USA) to determine differences between PAH (naphthalene
phenanthrene and anthracene) and surfactants (Tween-80 and Tergitol NP-10) Prior to
analyses Cochranrsquos C-test was used to check the assumption of homogeneity of variances
Student-Newman-Keuls test (SNK) was used to discriminate among different treatments after
significant F-test Differences in microbial assemblages were graphically evaluated for each
factor combination (surfactant and time) with non-metric multidimensional scaling (MDS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
96
using PRIMER software SIMPER method was used to identify the percent contribution of
each band to the dissimilarity or similarity in microbial assemblages between and within
combination of factors Based on Viejo (2009) bands were considered ldquohighly influentialrdquo if
they contributed to the first 70 of cumulative percentage of average dissimilaritysimilarity
betweenwithin combination of factors
Results and discussion
Bacterial growth and toxicity media during biodegradation of PAH
Since some surfactants can be used as carbon sources cell growth of the consortium was
measured with surfactant and PAH and only with surfactant without PAH to test the ability of
consortium to degrade and grow with both surfactants (Figure 1A) The microbial consortium
C2PL05 growth was significantly lower with Tergitol NP-10 than that reached with Tween-80
which showed the best cell growth with a maximum density (Figure 1A) In addition the
growth curve with PAH and Tergitol NP-10 showed a longer latent phase (36 hours) than
with PAH and Tween-80 (lt 12 hours) The specific growth rate (micromax) of the consortium
C2PL05 was significantly higher (Table 1A) with Tween-80 than that with Tergitol NP-10 The
results showed that Tween-80 was biodegradable for consortium C2PL05 since that
surfactant was used as the only carbon source (Figure 1A) Finally when using Tergitol NP-
10 as the only carbon source growth was not observed so that this surfactant was not
considered biodegradable for the consortium
Toxicity test (bioluminescence inhibition in Vibrio fischeri) indicates that high values
observed during the PAH degrading process with Tergitol NP-10 is caused at the initial time
by both PAH and surfactant (Figure 1B) However when PAH are totally consumed (40-45
days) toxicity still remained high and constant which means that toxicity is only due to the
Tergitol NP-10 (Figure 1B) The toxicity of PAH + biodegradable surfactant (Tween-80)
treatment decreased as the PAH and the surfactant were consumed and was almost
depleted (30) after 40 days of cultivation The toxicity showed a slight increment at the
beginning of the degradation process (Figure 1B) as a consequence of the potential
accumulation of intermediate PAH degradation products (Molina et al 2009)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
97
00
02
04
06
08
10
12
14
16
18
0 5 10 15 20 25 30 35 40 45
30
40
50
60
70
80
90
100
Tox
icity
(
)
Time (day)
B
A
Abs
orba
nce 60
0 nm
(A
U)
Figure 1 (A) Cell density of the consortium C2PL05 with PAH and Tween-80 () with
Tween-80 () with PAH and Tergitol NP-10() and with Tergitol NP-10 () (B)
Toxicity of the cultivation media during degradation of PAH by the consortium C2PL05
grown with Tween-80 () Tergitol NP-10 () and of the control experiment PAHs
without surfactants ()
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
98
The residual total concentration of three PAH of the treatments with surfactants and
the treatments without any surfactants added is shown in Figure 2 The consortium was not
able to consume the PAH when surfactants were not added PAH biodegradation by the
consortium C2PL05 was higher and faster (15 days) with Tween-80 than with Tergitol NP-10
(40 days) In all cases when surfactant was used no significant amount of PAH were
detected in precipitated or bioadsorbed form at the end of each experiment which means
that all final residual PAHs were soluble
0 5 10 15 20 25 30 35 40 45
0
10
20
30
40
50
60
70
80
90
100
Res
idua
l con
cent
ratio
n of
PA
Hs
()
Time (days)
Figure 2 Residual total PAH concentration (wt) in the treatment with Tween-80
() Tergitol NP-10 () and without surfactant ()
According to previous works (Bautista et al 2009 Molina et al 2009) these results
confirm that this consortium is adapted to grow with PAH as only carbon source and can
degrade PAH efficiently when surfactant is added According to control experiments (PAH
without consortium C2PL05) phenathrene and anthracene concentration was not affected by
any abiotic process (kA asymp 0 h-1) in the case of naphthalene some degree of abiotic depletion
was measured during the controls yielding an apparent first-order abiotic rate constant of
27middot10-3 plusmn 7middot10-5 h-1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the treatments so this not influence in the high
biodegradation rate of naphthalene for Tween-80 treatments The biotic depletion rate (kB) of
the three PAH was significantly higher for Tween-80 than that calculated for Tergitol NP-10
(Table 1B) There were no significant differences between PAH for Tergitol NP-10 (2 x 10-3 plusmn
4 x 10-4) whereas in the case of Tween-80 the value of kB for naphthalene (3 x 10-2 plusmn 6 x 10-4)
was higher than that for phenanthrene and anthracene (1 x 10-2 plusmn 4 x 10-4)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
99
Table 1 Analysis of variance (ANOVA) for the effects of surfactants on the specific
growth rate micromax (A) and for the effects of the surfactants and PAH on the biotic
degradation rate kB (B) of the C2PL05 consortium SS is the sum of squares and df
the degrees of freedom
Effect (A) SS df F-value p-value
Surfactant 16 1 782 0001
Error 0021 2
Effect (B) SS df F-value p-value
PAH 15middot10-4 2 779 0001
Surfactant 82middot10-4 1 4042 0001
PAH x Surfactant 12middot10-4 2 624 0001
Error 203middot10-7 12
Molecular characterization of the cultured bacteria of the consortium C2PL05 and dynamics
during the PAH degradation
The identification of cultured microorganisms and their phylogenetic relationships are keys to
understand the biodegradation and ecological processes in the microbial consortia From the
consortium C2PL05 grown with Tween-80 91 strains were isolated and sequenced From
them 7 different genotypes of PAH-degrading cultures (DIC-1 JA DIC-2 JA DIC-5 JA DIC-6
JA DIC-7 JA DIC-8JA and DIC-9JA) were identified by 16S rRNA For the treatment with
Tergitol NP-10 83 strains were isolated and sequenced and 6 different genotypes were
identified (DIC-1 RS DIC-2 RS DIC-3 RS DIC-4 RS DIC-5 RS and DIC-6 JA) One of the
isolated cultures from Tergitol NP-10 showed an identical sequence to one of the strains
grown with Tween-80 therefore the previous code (DIC-6JA) was kept Table 2 show a
summary of the PAH-degrader cultures identification The aligned matrix contained 1576
unambiguous nucleotide position characters with 424 parsimony-informative Parsimony
analysis of the data matrix yielded 10 parsimonious trees with CI = 0609 and RI = 0873 In
the parsimonic consensus tree 758 of the clades were strongly supported by boostrap
values higher or equal to 70 (Figure 3) All cultivable strains identified were γ-
proteobacteria (gram-negative) and were located in three clades Pseudomonas clade
Enterobacter clade and Stenotrophomonas clade These results are consistent with those of
Vintildeas et al (2005) who observed a strong dominance of gram negative bacteria in PAH
contaminated soil during the bioremediation process In Pseudomonas clade (Figure 3) DIC
are located in three clearly groups So DIC-2RS and DIC-3RS were grouped with P
frederiksbergensis which has been previously described in polluted soils (ie Holtze et al
2006) showing ability to reduce the oxidative stress generated during the PAH degrading
process DIC-1JA DIC-2JA (Tween-80) and DIC-1RS (Tergitol NP-10) were nested in very
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
100
solid group characterized by the presence of the type strain P koreensis previously studied
as an agricultural soil species (Kwon et al 2003) and DIC-5RS was located in P putida
group well known by their capacity to degrade high molecular weight PAH (Samantha et al
2002) to produce surfactants (Kruijt et al 2009) and to resist high temperature and salinity
(Egamberdieva amp Kucharova 2009) So several species of Pseudomonas (ie P putida P
fluorescens) have been widely studied in bioremediation (Molina et al 2009) and the present
results confirmed that it was the most representative group with the non biodegraded
surfactant treatment DIC-7JA DIC-8JA and DIC-9JA (Tween-80) which were identified as E
cloacae (Table 2) belonged to the Enterobacter clade with a strongly statistic support (Figure
3) In this clade DIC-4RS (Tergitol NP-10) is genetically related with E ludwigii which has
been recently described as relevant medical species (Hoffman et al 2005) but completely
unknown his PAH degrading capacity Enterobacter genus has been traditionally studied by
its animal gut symbiotic function but rarely recognized as a soil PAH degrading group
(Toledo et al 2006) In this phylogenetic tree E cloacae and E ludwiggi were not resolved
This result is according to Roggenkamp (2007) who consider necessary to use more
molecular markers within Enterobacter taxonomical group in order to contrast the
phylogenetic relationships In addition Enterobacter genera may not be a monophyletic
group (Kampfer et al 2005) Therefore more phylogenetic studies need to be done to clarify
the species concept within this group Finally DIC-5JA (Tween-80) and DIC-6JA isolated
from experiments using both surfactants (Tween-80 and Tergitol NP) are clearly belong to
type strain Stenotrophomonas clade genetically close to S maltophiliaT (Table 2) which has
been described as PAH-degrader (Zocca et al 2004)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
101
Figure 3 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) from the consortium C2PL05 with Tergitol NP (DIC-1JA ndash DIC-9JA)
and Tween-80 (DIC-1RS ndash DIC-5RS) and PAH-degrader uncultured bacteria (DUB) obtained from
DGGE of the consortium with both surfactant at 0 15 and 30 days of the process Boostrap values of
neighbourjoining and parsimonus higher than 50 are showed on the branch of the tree (NJMP) No
incongruence between parsimony and neighbour joining topology were detected Pseudomonas
genus has been designated as P Pantoea genus as Pa Sphingobium as S and Sphingomonas as
Sp Xantomonas as X and Xyxella as Xy T= type strain
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
102
Table 2 Bacteria identification and percentage of similarity from the GenBank data base Degrading
uncultured bacteria (DUB) form DGGE bands and degrading isolates cultured (DIC)
Colonies identified by cultivable techniques
DIC simil Mayor relationship with bacteria
of GenBank(acc No) Phylogenetic group
DIC-1RSb 980 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ)
DIC-2RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-3RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-4RS b 990 Enterobacter ludwigii (AJ853891) Enterobacter cloacae (EU733519)
Enterobacteriaceae (γ)
DIC-5RS b 990 Pseudomonas putida (EU046322) Pseudomonadaceae (γ) DIC-6JA-6RS c 1000 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-1JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-2JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-5JA a 9964 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-7JA a 9985 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-8JA a 9993 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-9JA a 100 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ)
Identification by non-cultivable techniques
DUB Band
simil Mayor relationship with bacteria
of GenBank (acc No) Phylogenetic group
DUB-1RS a 1 970 Uncultured Nitrobacteria sp (AM990004) Caulobacteraceae (α) DUB-2RS b 21 980 Bradyrhizobium sp (HQ171485) Bradyrhizobiaceae (α) DUB-3RS b 24 940 Uncultured bacterium (AY939443) -- DUB-4RS b 24 100 Uncultured Pseudomonas sp (HM561497) Pseudomonadaceae (γ) DUB-10RSb 28 980 Uncultured Sphingomonas sp (HM438638) Sphingomonadaceae(α) DUB-11RSa 28 960 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-6RS b 29 980 Pseudomonas stutzeri (HQ130335) Pseudomonadaceae (γ) DUB-8RS b 29 980 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-5RS b 29 990 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-7RS b 29 980 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-9RS b 30 970 Bacterium (AJ295668) --
a DIC or DUB belonging to treatments with Tween-80 b DIC or DUB belonging to treatments with Tergitol NP-10 c DIC or DUB belonging to treatments with Tween-80 and Tergitol NP-10
With respect to the dynamics of the microorganisms isolated from the microbial
consortium C2PL05 (Figure 4) Pseudomonas (DIC-1RS DIC-2RS and DIC-5RS Figure 4A
4B) with a percentage around 60 and Stenotrophomonas (only DIC-6JA Figure 4A and
4D) with presence of 90 were dominant groups during the PAH degrading process with
Tergitol NP-10 at 0 and 30 days in the case of Pseudomonas and at 15 days in the case of
Stenothrophomonas Enterobacter (DIC-4RS Figure 4A 4D) only was present at the end of
the process with a percentage around 40 With Tergitol NP-10 Pseudomonas sp group
was dominant coincident with the highest relative contribution of PAH degrading bacteria to
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
103
total heterotrophic bacteria at the beginning (33 of contribution) and at the end of the
degradation process (41) However Enterobacter (DIC-7JA DIC-8JA and DIC-9JA Figure
4E and 4H) with a maximum presence of 98 at 0 days and Stenotrophomonas (DIC-6JA
Figure 4E and 4G) with a maximum presence of 85 at the end of the process were
dominant with the biodegradable Tween-80 Thus Enterobacter sp seems to start the PAH
degradation process and Stenotrophomonas to finish it but at 15 days three groups coexist
within a contribution ranging 20 to 50 (Figure 4E) Therefore in agreement with other
authors (Colores et al 2000) the results of the present work confirm changes in the
bacterial (cultured and non-cultured) consortium succession during the PAH degrading
process driven by surfactant effects According to Allen et al (1999) the diversity of the
bacteria cellular walls may explain the different tolerance to grow depending on the
surfactant used Previous works (Piskonen amp Itaumlvaara 2004) have shown the capacity of
some bacteria to use both surfactants (Tergitol NP-10 and Tween-80) as carbon sources
However in agreement with recent studies (Bautista et al 2009) the present work confirms
that Tergitol NP-10 is not degradable by the consortium C2PL05 These results showed a
drastic change of the consortium composition after the addition of surfactant
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
104
0 15 30
0102030405060708090
100
102030405060708090
100
D
C
B
A
0 15 30
F DIC-1JA DIC-2JA
E
G DIC-6JA DIC-5JA
0 15 30
H
Time (day)
DIC-7JA DIC-8JA DIC-9JA
Pse
udom
onas
ribot
ypes
(
)
DIC-1RS DIC-2RS DIC-3RS DIC-5RS
102030405060708090
100
Ste
notr
opho
mon
as
ribot
ypes
(
)
DIC-6JA
0 15 30
102030405060708090
100
Ent
erob
acte
r rib
otyp
es (
)
DIC-4RS
Time (days)
Tot
al s
trai
ns (
)
Figure 4 (A) Dynamics of the microbial consortium C2PL05 during PAH degradation process with
Tergitol NP-10 and (E) with Tween-80 as surfactants Isolated and identified genus were
Pseudomonas () Stenotrophomonas () and Enterobacter () Dynamics and succession of
the (B) Pseudomonas (C) Stenotrophomonas and (D) Enterobacter ribotypes with Tergitol NP-10
as surfactant Dynamics and succession of the (F) Pseudomonas (G) Stenotrophomonas and (H)
Enterobacter ribotypes
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
105
Biodiversity and evolution of the non-cultivable bacteria of the consortium during PAH
degradation
The most influential DGGE bands to similarity 70 of contribution according to the results of
PRIMER analyses were cloned and identified allowing to know the bands and species
responsible of similarities and dissimilarities SIMPER procedure (Clarke 1993) was used to
identify the percentage contribution () that each band made to the measures of the Bray-
Curtis similarity between treatments at each surfactant (Tween-80 and Tergitol-NP) and time
(initial time after 15 and 30 days) Bands were selected as lsquoimportantrsquo to be identified if they
contributed to the first 70 of cumulative percentage of average similarity between
treatments Summary of the identification process are shown in Table 2 Phylogenetic
relationship of these degrading uncultured bacteria was included in the previous
parsymonious tree (Figure 3) In total 11 uncultured bacteria were identified DUB-4RS
DUB-6RS DUB-8RS and DUB-11RS were located in the Pseudomonas clade but these
uncultured bacteria were no grouped with a particular species of the genus DUB-5RS DUB-
7RS were identified as Sphingobium sp and DUB-10RS as Sphingomonas sp and located
in the Sphingobium and Sphingomonas clade respectivelly DUB-2RS was nested in
Bradyrhizobium clade because was identified as Bradyrhizobium sp and this clade was
supported by the type strain B japonicum In the same way DUB-1RS identified as
Uncultured Nitrobacteria was located in the Nitrobacteria clade belonged to N
hamadeniensis type strain Finally DUB-3RS and DUB-9RS were not identified with a
particular genus so they were located in a clade composed by uncultured bacteria The
phylogenetic relationship of these degrading uncultured bacteria allows expanding
knowledge about the consortium composition and process development Some of them
belong to α-proteobacteria DUB-5RS and DUB-7RS were related to Sphingobium group and
DUB-10RS with Sphingomonas clade thought this relationship should be confirmed
considering the low boostrap values Sphingomonas is a genus frequently isolated as PAH
degrader (Jing et al 2007) and important in the degradation of phenanthrene metabolites
(Tao et al 2007) Similarly Sphingobium sp has been described as PAH degrader
specifically in phenanthrene degradation process (Jing et al 2007) DUB-2RS belonged to
Bradyrhizobiaceae phylogenetic group and although Bradyrhizobium are genera barely
described as PAH degrading bacteria some studies based on PAH degradation by chemical
oxidation and biodegradation process have described that this plant-associated bacteria are
involved in the degradation of extracting agent used in PAH biodegradation techniques in
soils (Rafin et al 2009) DUB-1RS is a genotype related to Nitrobacteria clade However
Nitrobacteria has not been described as PAH degrader but this bacteria transform nitrites in
nitrates from the oxidation of nitrites (Modrogan et al 2010) and it is likely involved in the
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
106
nitrites oxidation process when the bioavailability of PAH in the media are low and so it is
not toxic for this bacteria Finally DUB-8RS DUB-6RS and DUB-11RS showed a high
similitude with Pseudomonas strain though the phylogenetic relationship with Pseudomonas
clade of DUB-11RS should be confirmed
Analysis of DGGE gel (Figure 5) showed that treatment with Tergitol NP-10 had very
few changes during biodegradation process whereas when the consortium was grown with
the biodegradable surfactant Tween-80 more changes were observed Similarity (Table 3)
between treatments were compared and analyzed by type of surfactant (Tween-80 vs
Tergitol NP-10) or by sampling time (15 days vs 30 days) The MDS analysis (Table 3)
showed the lowest values of Bray Curtis similarity coefficient between the consortium at
initial time (T0 not exposed to PAH and surfactants) with the PAH and Tween-80 after 15
days (16) and 30 days (7) However the similarity of T0 with PAH and Tergitol NP-10 after 15
days (22) and 30 days (26) was much higher Similarity between time treatments (15 and 30
days) within Tergitol NP-10 (56) was higher than with Tween-80 (32) The similarity within
treatments with Tween-80 was mainly due to the bands 1 and 29 (Table 3 Uncultured
Nitrobacteria and Sphingobium and Pseudomonas respectively see Table 2) whereas the
similarity within Tergitol NP-10 treatment was due to bands 1 and 30 (Table 3 Uncultured
Nitrobacteria and Uncultured bacteria respectively see Table 2)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
107
Figure 5 Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen fragments
from the consortium C2PL05 with initial inoculum (lane 1) with Tween-80 at 15 (lane 2) and 30 (lane 4)
days with Tergitol NP-10 at 15 (lane 3) and 30 (lane 5) days and molecular weight markers (lane 0)
According to PRIMER analysis similar bands between treatments (15 and 30 days) with Tergitol NP-
10 () and between treatments (15 and 30 days) with Tween-80 () are shown
1 Uncultured Nitrobacteria sp(DUB-1RS) 21 Bradyrhizobium sp (DUB-2RS) 24 Uncultured bacterium (DUB-3RS)
Uncultured Pseudomonas (DUB-4RS) 28 Uncultured Sphingomonas sp (DUB-10RS)
Pseudomonas sp (DUB-11RS) 29 Pseudomonas stutzeri (DUB-6RS) Pseudomonas sp
(DUB-8RS) Sphingobium sp(DUB-5RS DUB-7RS)
30 Uncultured Bacterium (DUB-9RS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
108
Table 3 Bands contributing to approximately the first 70 of cumulative percentage
of average similarity () Bands were grouped by surfactant and time
Band Tween-80 TergitolNP-10 15 days 30 days 1 3828 2105 2707 3014 29 2969 1509
30 2469 19
24 881 3447
27 845
21 516
Cumulative similarity () 3168 4479 4479 3391 Cloning was not possible
The genera identified in this work have been previously described as capable to
degrade the three PAH completely and efficiently with a reduction of the toxicity (Bautista et
al 2009) In the case of the treatment with Tween-80 the lower biodiversity may be caused
by a few dominant species of these genera driven during the PAH degradation process by
antagonist and synergic bacterial interactions and not by differences in the functional
capacities However when consortium grows with a non-biodegradable surfactant there is
higher biodiversity of species and interaction because the activity of various functional
groups can be required to deal the unfavorable environmental conditions
Conclusions
The choice of surfactants to increase bioavailability of pollutants is critical for in situ
bioremediation because toxicity can persist when surfactants are not biodegraded
Nevertheless surfactants affect the dynamics of microbial populations in a stable PAH-
degrading consortium From the application point of view the combination of culturable and
non culturable identification techniques may let to optimize the bioremediation process For
bioaugmentation processes culturable tools help to select the more appropriate bacteria
allowing growing enough biomass before adding to the environment However for
biostimulation process it is important to know the complete consortium composition to
enhance their natural activities
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
109
Acknowledgment
Authors are deeply indebted to Raquel Sanz Laura Saacutenchez and Laura Garciacutea and for their
support during the development of the experiments Authors also gratefully acknowledged
the financial support from the Spanish Ministry of Environment (Research project 1320062-
11) and Fundacioacuten Alfonso Martiacuten Escudero Authors also thank Repsol-YPF for providing
the soil samples This work is framed within the Official Maacutester en Ciencia y Tecnologiacutea
Ambiental from Universidad Rey Juan Carlos
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
110
References
Allen CRC Boyd DR Hempenstall F Larkin MJ amp Sharma D 1999 Contrasting effects
of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons
to cis-dihydrodiols by soil bacteria Appl Environ Microbiol 65 1335-1339
Andreoni V Cavalca L Rao MA Nocerino G Bernasconi S DellrsquoAmico E Colombo M
amp Gianfreda L 2004 Bacterial communities and enzyme activities of PAH polluted
soils Chemosphere 57 401-412
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 30 1ndash10
Clements WH Oris JT amp Wissing TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Lepomis macrochirus
Archiv Environ Contam Toxicol 26 261ndash266
Colores GM Macur RE Ward DM amp Inskeep WP 2000 Molecular analysis of
surfactant-driven microbial population shifts in hydrcarbon-contaminated soil Appl
Environ Microbiol 66 2959-2964
Egamberdieva D A amp Kucharova Z 2009 Selection for root colonising bacteria stimulating
wheat growth in saline soils Biol Fert Soils 45 563ndash571
Gallego RJS Garciacutea-Martiacutenez MJ Llamas JF Belloch C Pelaacuteez AI amp Saacutenchez J
2007 Biodegradation of oil tank bottom sludge using microbial consortia
Biodegradation 18 269ndash281
Ghazali FM Rahman RNZA Salleh AB amp Basri M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hydrocarbons (PAH) A review J Hazard Mater 169 1-15
Hoffmann H Stindl S Stumpf A Mehlen A Monget D Heesemann J Schleifer KH amp
Roggenkamp A 2005 Description of Enterobacter ludwigii sp Nov a novel
Enterobacter species of clinical relevance Syst Appl Microbiol 28 206ndash212
Holtze MS Nielsen P Ekelund F Rasmussen LD amp Johnsen K 2006 Mercury affects
the distribution of culturable species of Pseudomonas Appl Soil Ecol 31 228ndash238
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor R 1969 Evolution of protein molecules in Mammalian protein
metabolism (H Munro ed) Academic Press New York
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
111
Katoh K amp Toh H 2008 Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMC Bioinformatics 9 paper
212
Kampfer P Ruppel S amp Remus R 2005 Enterobacter radicincitans sp Nov a plant
growth promoting species of the family Enterobactriaceae Syst Appl Microbiol 28
213ndash221
Kolomytseva MP Randazzo D Baskunov BP Scozzafava A Briganti F amp Ludmila A
2009 Role of surfactants in optimizing fluorene assimilation and intermediate
formation by Rhodococcus rhodochrous VKM B-2469 Bioresource Technol 100
839-844
Kruijt M Tran H amp Raaijmakers JM 2009 Functional genetic and chemical
characterization of biosurfactants produced by plant growth-promoting Pseudomonas
putida J Appl Microbiol 107 546-556
Kwon SW Jong WS Kim S Park IC Yoon SH Park DH Lim CK amp Go SJ 2003
Pseudomonas koreensis sp Nov Pseudomonas umsongensis sp Nov and
Pseudomonas jinjuensis sp Nov novel species from farm soils in Korea Int J Syst
Evol Microbiol 53 21ndash27
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang Y amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Modrogan C Diaconu E Orbulet OD amp Miron AR 2010 Forecasting Study for Nitrate Ion
Removal Using Reactive Barriers Rev Chim 6 580-584
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions Eur J Soil Sci 54 655-670
Piskonen R amp Itaumlvaara M 2004 Evaluation of chemical pretreatment of contaminated soil
for improved PAH bioremediation Appl Microbiol Biotechnol 65 627-634
Rafin C Veignie E Fayeulle A amp Surpateanu G 2009 Benzo[a]pyrene degradation using
simultaneously combined chemical oxidation biotreatment with Fusarium solani and
cyclodextrins Bioresource Technol 100 3157-3160
Roggenkamp A 2007 Phylogenetic analysis of enteric species of the family
Enterobacteriaceae using the oric-iocus Syst Appl Microbiol 30 180-188
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
112
Samantha SK Singh OV amp Jain RK 2002 Polycyclic aromatic hydrocarbons
environmental pollution and bioremediation Trends Biotechnol 20 243-248
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil in Singh
A Kuhad RC Ward OP (Eds) Adv Appl Biorem p 103-121 Springer Berlin
Tao X-Q Lu G-N Dang Z Yi X-Y amp Yang C 2007 Isolation of ohenanthrene-degrading
bacteria and characterization of phenanthrene metabolites Worl J Biotechnol 23
647-6554
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities Syst Appl Microbiol 29 244ndash252
Torsvik V amp Ovreas L 2002 Microbial diversity and function in soil from genes to
ecosystems Curr Opin Microbiol 5 240ndash245
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Mar Eco- Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Zocca C Gregori SD VisentiniF amp Vallini G 2004 Biodiversity amongst cultivable
polycyclic aromatic hydrocarbon-transforming bacteria isolated from an abandoned
industrial site FEMS Microbiol Lett 238 375-382
Capiacutetulo
Enviado a FEMS Microbiology Ecology en Diciembre 2012
Simarro R Gonzaacutelez N Bautista LF amp Molina MC
High molecular weight PAH biodegradation by a wood degrading
bacterial consortium at low temperatures
Biodegradacioacuten de hidrocarburos de alto peso molecular por un consorcio bacteriano
degradador de madera a bajas temperaturas
3
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
115
Abstract
The aim of this work was to evaluate the ability of two bacterial consortia (C2PL05 and
BOS08) extracted from very different environments to degrade low (naphthalene
phenanthrene anthracene) and high (pyrene and perylene) molecular weight polycyclic
aromatic hydrocarbons (PAH) at high (15-25ordmC) and low (5-15ordmC) temperature ranges
C2PL05 was isolated from a soil in an area chronically and heavily contaminated with
petroleum hydrocarbons and BOS08 from decomposing wood in an unpolluted forest free of
PAH Bacterial consortia were described by cultivable and no-cultivable techniques (DGGE)
PAH-degrading bacterial population measured by most probable number (MPN)
enumeration increased during the exponential phase Toxicity estimated by MicrotoxTM
method was reduced to low levels and the final PAH depletion determined by high-
performance liquid chromatography (HPLC) confirmed the high degree of low and high
molecular weight PAH degradation capacity of both consortia The PAH degrading capacity
was also confirmed at low temperatures and specially by consortium BOS08 where strains
of Acinetobacter sp Pseudomonas sp Ralstonia sp and Microbacterium sp were identified
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
117
Introcuduction
Polycyclic aromatic hydrocarbons (PAH) constitute a diverse class of organic compounds
formed by two or more aromatic rings in several structural configurations having
carcinogenic mutagenic and toxic properties Therefore environment contamination by PAH
is currently a problem of concern and it has been shown that bioremediation is the most
efficient practice retrieving the original conditions of the ecosystem (Haritash amp Kaushik
2009) However the high molecular weight PAH (HMW-PAH) such as pyrene
benzo[a]pyrene or benzo[b]fluoranthene are generally recalcitrant and resistant to microbial
attack due to their low solubility and bioavailability Therefore these compounds are highly
persistent in the environment and bioaccumulated in organisms (Lafortune et al 2009)
Studies on PAH biodegradation with less than three rings have been the subject of many
reviews (ie Sutherland et al 1995) However there is a lack of knowledge about the
HMWndashPAH biodegradation (Kanaly amp Harayama 2000)
Microbial communities play an important role in the biological removal of pollutants in
soils (MacNaughton et al 1999) Therefore changes in environmental condition may alter
species diversity of the soil microbiota and their metabolic rates (Margesin amp Schinner
2001) In areas chronically polluted by PAH there are abundant bacteria able to degrade
those toxic contaminants by using them as sole carbon and energy sources (Taketani et al
2010) Recent works (Tian et al 2008 Surridge et al 2009 Couling et al 2010) have
reported the potential ability to degrade PAH by microorganisms apparently not previously
exposed to those toxic compounds This is extensively known for lignin degrading white rot-
fungi that produce a set of extracellular enzymes such as oxidases and peroxidases (Wong
2009) with low substrate specificity that expand their oxidative action beyond lignin being
capable to degrade other complex phenolic compounds and PAH (ie Canet et al 2001)
Although less extensively than in fungus PAH degradation capacity have been also reported
in this type of environment in bacteria belonged to genera Pseudomonas (Zimmermann
1990 McMahon et al 2007) However according to Couling et al (2010) the wide-spread
capacity to degrade PAH by microbial communities even from unpolluted soils can be
explained by the fact that PAH are ubiquitously distributed by natural process throughout the
environment at low concentration enough for bacteria to develop degrading capacity
Regardless of these issues there are some abiotic factors such as temperature that
may greatly influence biodegradation process It has been shown (Mohn amp Stewart 2000)
that although biodegradation of PAH is more efficient in the range 20-30 ordmC it can be carried
out even in colder (lt5 ordmC) environments (Eriksson et al 2001) At low temperature diffusion
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
118
and solution rates and so bioavailability of PAH decreases (Haritash amp Kaushik 2009)
Simultaneously the microbial metabolism is slowed-down increasing the lag period (Atlas amp
Bartha 1972 Eriksson et al 2001) However and according to the hypothesis that
degrading microorganisms are present in most of ecosystems there are degrading bacteria
adapted to low temperatures (Yakimov et al 2003 Brakstad amp Bonaunet 2006) that can
express degrading capacity So the study of biodegradation at low temperatures is important
since the temperature of more than 90 of the seawater volume is below 5 ordmC In addition
PAH and anthropic discharges sometimes have occurred and may occur in sea water (Bode
et al 2006 Soriano et al 2006) or in cold and even extreme environments such as in
Alaska (Bence et al 1996)
The main goal of this work was to study the effect of low temperature on HMW-PAH
degradation rate by two different consortia isolated from two different environments one from
decay wood in an unpolluted forest (consortium BOS08) and other from a polluted soil
exposed to hydrocarbons The purpose of the present work was also to describe the
microbial dynamics along the biodegradation process as a function of temperature and type
of consortium used
Materials and methods
Chemicals and media
Naphthalene phenanthrene anthracene pyrene and perylene (all gt99 purity) purchased
from Sigma-Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) were prepared
in a stock solution in n-hexane (Fluka Steinheim Germany) to get a final concentration of
002 gl-1 for naphthalene phenanthrene and anthracene 001 gl-1 for pyrene and 0005 gl -1
for perylene Tween-80 purchased from Sigma-Aldrich was added according to previously
work (Bautista et al 2009) Composition of optimized Bushnell Haas Broth medium (BHB)
(Simarro et al 2010) was 02 g l -1 MgSO4middot7H2O 002 g l -1 CaCl2 2H2O 0088 g l -1 KHPO4
0088 g l -1 K2HPO4 209 g l -1 NaNO3 0015 g l -1 Fe2(SO4)3
Physicochemical characterization of soils and isolation of bacterial consortia
Consortia C2PL05 was isolated from a permanently polluted soil from a petroleum refinery
(Ciudad Real Spain) with a range of environmental temperatures from 10 ordmC in winter to 25
ordmC in summer The consortium BOS08 was extracted from dead wood in a pristine Atlantic
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
119
forest in Fragas do Eume Galicia Spain (latitude 43ordm 4175acute north longitude 8ordm 0683acute west)
with oaks as the dominant flora species and with a range of temperatures of 10 ordmC in winter
and 18 ordmC in summer To obtain the microbial consortia sieved soil and the wood sample
were suspended in PBS (110) and stirred overnight at 25 ordmC Then 15 ml of each extract
was inoculated in 50 ml of BHB (pH 70) with Tween-80 1 (vv) as surfactant and
naphthalene phenanthrene anthracene pyrene and perylene (each at 500 mg l -1) as carbon
sources Each culture were incubated in an orbital shaker at 150 rpm 25 ordmC and dark
conditions until the exponential phase was completed (asymp 5 days) monitoring cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK)
Sieved (lt2 mm) river sand was used as substrate Prior to use it was burned at 550
ordmC in a furnace to remove organic matter and microorganisms Water holding capacity (WHC)
of the river sand was measured following the method described by Wilke (2005)
Experimental design and treatments conditions
15 microcosms (triplicates by five different incubation times) were performed with consortium
C2PL05 at high temperature range (H) 16 hours with light at 25 ordmC followed by 8 hours in
the dark at 15 ordmC Another 15 microcosms with consortium C2PL05 were incubated at low
temperature range (L) 16 hours with light at 15 ordmC followed by 8 hours in the dark at 5 ordmC
The same experiments were performed with consortium BOS08 Microcosms were incubated
in suitable chambers equipped with temperature lightdarkness cycle and humidity (60)
control systems Each microcosms contained 90 g of sterilized sand 18 ml of BHB (60 of
WHC) with Tween-80 1 (vv) 2 ml of PAH stock solution in n-hexane (final amount of PAH
per tray of 20 mg of naphthalene 20 mg of phenanthrene 20 mg of anthracene 10 mg of
pyrene and 5 mg of perylene) and 35 ml of bacterial consortium (0088 AU = 275x104
cellsmiddotml -1 for C2PL05 and 0051 AU = 286 x 104 cellsmiddotml-1 for BOS08)
Bacterial growth MPN and toxicity assays
Bacterial density during the PAH degrading process was monitored at 0 11 33 66 101 and
137 days by changes in the absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) From the absorbance data the
intrinsic growth rate in the exponential phase was calculated by applying Equation 1
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
120
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time Increments were normalized by
absorbance measurements at initial time (day 0) to correct the inoculum dilution effect
Heterotrophic and PAH-degrading population from the consortia were estimated by a
miniaturized most probably number technique (MPN) in 96-well microtiter plates with eight
replicate wells per dilution (Wrenn amp Venosa 1996) Total heterotrophic microbial population
was estimated in 180 μl of Luria Bertani (LB) medium with glucose (15 gl -1) and 20 microl of the
microbial consortium PAH-degrading population in the inoculum was estimated in 180 microl of
BHB medium containing Tween-80 (1 vv) 10 microl of PAH stock mix solution as only carbon
source (n-hexane was allowed to evaporate prior to inoculation) and 20 microl of the microbial
consortium in each well
Toxicity during the PAH degradation was also monitored through screening analysis of
the samples following the MicrotoxTM method with the luminescent bacterium Vibrio fischeri
following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15 ordmC
Monitoring of PAH biodegradation
To confirm that consortium BOS08 was not previously exposed to PAH samples were
extracted with acetone and n-hexane according to Joslashrgensen et al (2005) and the
identification was performed by GC-MS analysis of the extract A gas chromatograph (model
CP3800 Varian Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary
column (15 m length 025 mm ID 025 μm film thickness) was coupled to a quadruple
mass-spectrometer detector (Model 1200L Varian) The stationary phase was composed by
phenyl (5) and dimethylpolysiloxane (95) as carried gas ice in the mobile phase
Temperature gradient program used was initial temperature of 80 ordmC for 2 min temperature
increase to 300 ordmC at the rate of 1 ordmC min-1 final temperature of 300 ordmC for 15 min with a
final duration of the method of 39 min In addition total petroleum hydrocarbons (TPH) in
both soils were extracted and quantified as is described previously
PAH from microcosms were extracted and analyzed at initial and final time to estimate
the total percentage of PAH depletion by gas cromatography using the gas cromatograph
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
121
equiped and protocol described previuosly For this 100 g of soil from each replicate were
dried overnight at room temperature and PAH were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inyect 05 μl in
the FDI chromatograph
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
To identify cultivable microorganisms samples from each microcosm were collected at zero
33 and 101 days of the biodegradation process To extract the microorganisms 15 g of soil
were suspended in PBS (110) and incubated overnight in an orbital shaker at 150 rpm
maintaining the same temperature and light conditions than during the incubation process
To get about 10 PAH-degrading colonies isolated 100 ml of the supernatant were placed
onto Petri plates with BHB medium and purified agar and were sprayed with a stock mix
solution of naphthalene phenanthrene anthracene pyrene and perylene (final concentration
500 mgL-1) as carbon source and incubated at the same temperature conditions
Total DNA of the PAH-degrading isolated cultures (DIC) was extracted using Microbial
DNA kit (MoBio Laboratories Solano Beach CA USA) and amplified using primers 16S F27
and 16S R1488 (Lane et al 1991) according to the ExTaq HS DNA polymerase protocol
(Molina et al 2009) Sequences were edited and assembled using ChromasPro software
version 142 (Technelysium Pty Ltd Tewantin Australia) to check for reading errors and
when possible resolving ambiguities BLAST search (Madden et al 1996 available at URL
httpncbinlmnihgovBLAST) was used to find nearly identical sequences for the 16S
rRNA sequences determined Sequences were aligned using the Q-INS-i algorithm (Katoh amp
Toh 2008a) of the multiple sequence alignment software MAFFT version 6611 (Katoh amp
Toh 2008b) aligning sequences in a single step
All identified sequence (by culture and no-culture techniques) and more similar
sequences downloaded from GenBank were used to perform the phylogenetic tree
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates using PAUP
40B10 (Swofford 2003) In addition maximum parsimony (MP) was also analyzed (Molina
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
122
et al 2009) Sequences of Aquifex piruphilus and Hydrogenobacter hydrogenophylus were
used as out-group
Denaturing gradient gel electrophoresis (DGGE) from microbial consortia during PAH
degrading process
A non culture-dependent molecular techniques as DGGE was performed to know the effect
of the temperature on total biodiversity of both microbial consortia during the PAH
degradation process by comparing the treatment at zero 33 and 101 day with the initial
composition of the consortia Total DNA was extracted from 025 g of the samples using
Microbial Power DNA isolation kit (MoBio Laboratories Solano Beach CA USA) and
amplified using the primers set 16S 338F-GC and 16S 518R according to ExTaq HS DNA
polymerase protocol (Promega Corp Madison WI USA) PCR product was loaded onto a
10 (wv) polyacrilamide gel with a denaturing gradient from 35 to 65 denaturant Gel
were stained with Syber-Gold and viewed under UV light and predominant bands in DGGE
gel were excised Due to impossibility to reamplify bands DNA of the bands was cloned in
the pGEM-T Easy Vector (Promega Madison WI) PAH-degrader uncultured bacterium
(DUB) were edited and assembled as described above and included in the matrix to perform
the phylogenetic tree Images of DGGE were digitalized and processed using the UN-Scan-It
gel analysis software version 60 (Silk Scientific US)
To identifiy the presence of fungi in the consortium BOS08 during the process total
DNA was extracted from the samples using Microbial Power DNA isolation kit (MoBio
Laboratories Solano Beach CA USA) and amplified with the primers set 18S ITS1F and
ITS4 according to Quiagen Multiplex PCR kit protocol DNA of Clitocybe metachroa was
extracted using DNeasy Plant Mini Kit (Quiagen) from the mushroom for use as PCR
positive PCR products were visualized under UV light on an agarose gel (1 ) using Syber-
Gold as intercalating agent
Statistical analysis
In order to evaluate the effects of inocula type and temperature on the final percentage of
PAH depletion and on the intrinsic growth rate (μ) bifactorial analysis of variance (ANOVA)
were used The variances were checked for homogeneity by the Cochranacutes test Student-
Newman-Keuls (SNK) test was used to discriminate among different treatments after
significant F-test representing this difference by letters in the graphs Data were considered
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
123
significant when p-value was lt 005 All tests were done with the software Statistica 60 for
Windows Differences in microbial assemblages were graphically evaluated for each factor
combination (time type of consortium and temperature) with a non-metric multidimensional
scaling (MDS) using PRIMER software (Clarke 1993) SIMPER method was used to identify
the percent contribution of each band from DGGE to the dissimilarity or similarity in microbial
assemblages between and within combination of factors Based on Viejo (2009) bands were
considered ldquohighly influentialrdquo if they contributed to the first 60 of cumulative percentage of
average dissimilaritysimilarity betweenwithin combination of factors
Results
Hydrocarbons in soils
Figure 1 shows GC-MS analysis of the extracted hydrocarbons from samples where both
consortia were isolated Soil samples where C2PL05 consortium was isolated contained 64
wt of total petroleum hydrocarbons (TPH) However no traces of PAH or any other
petroleum hydrocarbons were detected within samples where BOS08 consortium was
obtained
0 5 10 15 20 25 30 35
BO S08
C 2PL05
tim e (m in)
Figure 1 GC-MS total ion chromatogram from solvent extracted hydrocarbons in soils where
consortia C2PL05 and BOS08 were isolated
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
124
Cell growth intrinsic growth MPN and toxicity assays
Figure 2 (A B) shows the growth of both microbial consortia during PAH biodegradation
process Lag phases were absent and long exponential phases (until day 66 approximately)
were observed in all treatments except with the C2PL05 consortium at low temperature
(finished at day 11) In general higher cell densities were achieved in those microcosms
incubated in the higher temperature range Despite similar cell densities reached with both
consortia and both temperature levels the values of the intrinsic growth rate (μ) during the
exponential phase (Table 1) showed significant differences between consortia and
temperatures of incubation but not in their interaction (Table 2A) Differences between
treatments showed that the highest μ was obtained at high temperatures (25 ordmC-15 ordmC) and
with BOS08 consortium
Figure 2 (C D) showed that the initial number of PAH-degrading bacteria were at least
one order of magnitude lower than heterotrophic bacteria in both consortia The highest
heterotrophic bacteria concentration was reached after 33 days of incubation approximately
to a final value of 108- 109 cells g-1 soil (four orders of magnitude above the initial values)
The highest contribution of PAH-degrading bacteria to total heterotrophic bacteria was
observed at 33 days of incubation No differences were observed between temperature
ranges From 33 days both type of populations started to decrease but PAH-degrading
bacteria of consortia increased again at 101 days reaching values at the end of the process
similar to the initial ones
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
125
0 11 33 66 101 137
005
010
015
020
025
030
035
0 11 33 66 101 137
0 33 101 137102
103
104
105
106
107
108
109
0 33 101 137Time (day)Time (day)
Time (day)
Abs
orba
nce 6
00nm
(A
U)
Time (day)
DC
BA
cell
g so
il
Figure 2 Cell growth of consortia C2PL05 (A) and BOS08 (B) at high () and low () temperature
range during PAH biodegradation and MPN for consortia C2PL05 (C) and BOS08 (D) of heterotrophic
(squares) and PAH-degrading (circles) cultivated at high (filled symbols) and low (empty symbols)
temperature range
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
126
Table 1 Intrinsic growth rate (μ) and biodegradation percentage of phenanthrene (Phe) anthracene
(Ant) pyrene (Pyr) perilene (Per) and total PAH (Tot) at final time for consortia C2PL05 and BOS08 at
high (H) and low (L) temperature range Superscript letters (a to c) show differences between groups
(plt005 SNK) and plusmn SD the standard deviation
μ
Treatment d-1x10-3 plusmnSD x10-3
C2PL05 H 158 b 09 C2PL05 L 105 a 17
BOS08 H 241 c 17
BOS08 L 189 b 12
PAH biodegradation ()
Treatment Phe plusmn SD Ant plusmn SD Pyr plusmn SD Per plusmn SD Total plusmn SD
C2PL05 H 954 plusmn 04 993 plusmn 01 270 plusmn 62 986 plusmn 01 989 c plusmn 04
C2PL05 L 801 plusmn 61 459 plusmn 158 470 plusmn 118 538 plusmn 190 543 a plusmn 109
BOS08 H 938 plusmn 27 993 plusmn 04 472 plusmn 130 864 plusmn 61 866 bc plusmn 60
BOS08 L 940 plusmn 31 579 plusmn 31 542 plusmn 102 691 plusmn 137 677 ab plusmn 77
Table 2 Analysis of variance (ANOVA) of the effects on μ (A) total PAH biodegradation (B) and
biodegradation of pyrene and perilene (C) SS is the sum of squares and df the degree of freedoms
Factor df SS F
p-value
A) μ
Temperature a 1 36 x 10-3 5931 Consortium b 1 83 x 10-5 136
Temperature x Consortium 1 20 x 10-4 343 ns
Error 8 49 x 10-5 0001
B) Total PAH biodegradation ()
Treatment c 3 3526 73
Error 8 1281
C) Biodegradation of pyrene and perilene ()
Treatment c 3 11249 11 ns
PAH d 1 85098 251
Treatment x PAH 3 31949 31 ns
Error 16 54225
a high (15-25ordmC) or low (5-15ordmC) temperature range b consortium C2PL05 or BOS08 c C2PL05 at
high and temperature range or BOS08 at high and low temperature range d naphthalene
phenanthrene anthracene pyrene and perylene p lt 005 p lt 001 p lt 0001
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
127
With regard to toxicity values (Figure 3) complete detoxification were achieved at the
end of each treatment except for consortium C2PL05 (percentage of toxicity 40) incubated
at low temperature (Figure 3A) When consortium BOS08 was incubated at low temperature
there was a time period between 11 and 66 days that toxicity increased (Figure 3B)
0 11 33 66 101 137
0
20
40
60
80
100
0 11 33 66 101 137
BA
Time (day)
Tox
icity
(
)
Time (day)
Figure 3 Toxicity of microcosms with consortium C2PL05 (A) and BOS08 (B) incubated at high ()
and low () temperature range during PAH biodegradation process
Biodegradation of PAH
PAH biodegradation results are shown in Table 1 PAH depletion showed significantly
differences (Table 2B) within the consortium C2PL05 with highest values at high temperature
and the lowest at low temperature (Table 1) Those differences were not observed within the
BOS08 consortium and PAH depletion showed average values between values of C2PL05
depletion Regarding each individual PAH naphthalene was completely degraded at final
time 80 of phenanthrene was depleted in all treatments and anthracene and perylene
were further reduced at high (gt85) rather than low temperature (gt50) However pyrene
was significantly less consumed by the consortia than perylene (Table 1 and Table 2C)
Phylogenetic analyses
Phylogenetic relationships of the degrading isolated cultures and degrading uncultured
bacteria are shown in Figure 4 The aligned matrix contains 1349 unambiguous nucleotide
position characters with 505 parsimony-informative and 173 characters excluded Parsimony
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
128
analysis of the data matrix yielded 87 parsimonious trees with CI = 0756 RI = 0945 and a
length of 1096 Figure 4 also shows the topology of the neighbour joining tree
Inconsistencies were not found when analysing boostrap values of neighbour joining (NJ)
and maximum parsimony (MP)
Figure 4 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) and degrading uncultured bacteria (DUB) obtained from DGGE of the
consortia and cultivable identification process at day 0 33 and Boostrap values of neighbour joining
(NJ) and parsimonious (MP) are showed on the branch of the tree (NJMP) No incongruence between
parsimony and neighbour joining topology were detected Pseudomonas genus has been designated
as P Psychrobacter genus as Ps Acinetobacter as A and Ralstonia as R T= type strain
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
129
DIC-46-RS (Rhodococcus sp) DIC-47RS (Bacillus psychrodurans) and DUB-25RS
(Microbacterium sp) were not included in the phylogenetic tree due to their high phylogenetic
distance with most of the DIC and DUB Phylogenetic tree was composed by bacteria
belonged to γ- and β-Proteobacteria Group of γ- Proteobacteria was composed by
Acinetobacter clade Psychrobacter clade and Pseudomonas clade whereas β-
Proteobacteria group was only composed by Ralstonia clade Within Acinetobacter clade
although the identity approximation (BLAST option Genbank) reported A johnsonii and A
haemolyicus such as the species closest to some of the DIC and DUB the incorporation of
the types strains in the phylogenetic tree species do not showed a clear monophyletic group
Thus and as a restriction molecular identification of these strains (Table 3) was exclusively
restricted to genus level that is Actinobacter sp A similar criteria was taken for
Pseudomonas clade where molecular identifications carry out through BLAST were not
supported by the monophyletic hypothesis when type strains were included in the analysis
Psycrobacter clade sister group of Acinetobacter clade are represented by Psychrobacter
urativorans type strain (DQ143924T) in which DIC-14RS and DIC-23RS are nested β-
Proteobacteria is only composed by Ralstonia clade confirmed by RinsidiosaT (FJ772078T)
although DICs included in this clade are more related with the strain Ralsonia sp AF488779
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
130
Table 3 Identification and similarity () to bacteria from GenBank of cultivable strains
and DGGE bands (non-cultivable bacteria)
Days Consortium Temperature Strains Molecular Identification
(genera) 33
C2PL05
15 ordmC-5 ordmC
DIC-7RS DIC-8RS DIC-9RS DIC-11RS DIC-10RS DIC-12RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-13RS DIC-14RS DIC-15RS DIC-46RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Psychrobacter urativorans Pseudomonas sp Rhodococcus sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-16RS DIC-17RS DIC-18RS DIC-19RS DIC-20RS DIC-21RS DIC-22RS DUB-25RS DUB-26RS
Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-23RS DIC-47RS DUB-22RS DUB-23RS DUB-24RS DUB-25RS DUB-26RS
Psychrobacter urativorans Bacillus psychrodurans Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
101
C2PL05
15ordmC-5ordmC
DIC-24RS DIC-25RS DIC-26RS DIC-27RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-28RS DIC-29RS DIC-30RS DIC-31RS DIC-32RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-33RS DIC-34RS DIC-35RS DIC-36RS DIC-37RS DIC-38RS DIC-39RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
131
25 ordmC-15 ordmC
DIC-40RS DIC-41RS DIC-42RS DIC-43RS DIC-44RS DIC-45RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
Diversity and evolution of cultivated and uncultivated bacteria and dynamics during PAH
biodegradation
PCR analysis to identify fungal DNA in BOS08 was negative for the initial period of the
biodegradation process at both temperatures ranges Fungal DNA was only positive at high
temperatures and the end of the biodegradation process (101 and 137 days)
A minimum of 10 colonies were isolated and molecularly identified from the four
treatments at days 33 and 101 by cultivated methods The most influential bands of DGGE
to 60 of contribution to similarity (Figure 5 Table 4) according to the results of PRIMER
analysis were cloned and identified with the except of bands 2 4 27 and 36 that were not
cloned after several attempts likely due to DNA degradation The results of the identification
by cultivated and uncultivated methods (Table 3 Figure 5) show that different strains of
Acinetobacter (DUB-26RS uncultured Acinetobacter sp) and Microbacterium bands 24
(DUB-26RS uncultured Acinetobacter sp) and 22 (DUB-25RS Microbaterium sp)
respectively were always present in both consortia (Figure 5) both at high and low
temperatures However it should be also noted that Rhodococcus sp strains are unique to
C2PL05 consortium whereas Ralstonia sp and Bacillus sp were only found in BOS08
consortium being all of the above DIC strains (Table 3) In depth analysis of the community
of microorganisms through DGGE fingerprints and further identification of the bands allowed
to establish those bands responsible for the similarities between treatments (Table 4) and the
most influential factor MDS (Figure 6) shows that both time and temperature have and
important effects on C2PL05 microbial diversity whereas only time had effect on BOS08
consortium Both consortia tend to equal their microbial compositions as the exposed time
increase (Figure 6) The highest average of similarity (5327 ) was observed at day 101
being bands 36 4 (unidentified) and 24 (DUB-26RS Acinetobacter sp) responsible for that
similarity The lowest similarity (3543 ) was observed within the consortium C2PL05 (Table
4) being the high abundance of the band 20 (DUB-24RS Pseudomonas sp) and the lack of
the band 22 (DUB-25R Microbacterium sp) responsible of the dissimilarity Concluding it
can be observed that bands 20 (DUB-24RS Pseudomonas sp) 22 (DUB-25R
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
132
Microbacterium sp) 24 (DUB-26RS Acinetobacter sp) 36 and 4 (both unidentified) were
the most responsible for the similarity or dissimilarity between bacterial communities of
different treatments Another band showing lower contribution to these percentages but yet
cloned was band 12 from which two genotypes were identified (DUB-22RS and DUB-23RS)
as Pseudomonas sp Regarding to identification of DIC strains (Table 3) Rhodococcus sp
was exclusive of C2PL05 consortium and Ralstonia sp and Bacillus sp were only found in
BOS08 consortium
Table 4 Bands contribution to 60 similarity primer between treatments grouped by time type
of bacterial consortium and incubation temperature Average similarity of the groups determine
by SIMPER method
Time (day) Consortium Temperature
Band DUB 0 33 101 C2PL0 BOS0 High Low
22 DUB-25RS 2855 2789 2581 20 DUB-24RS 2993 2521 1797 2366
36 Unidentified 3546 1029 210
4 Unidentified 2855 1120 2362 1755 2315 175
27 Unidentified 139
2 Unidentified 1198
24 DUB-26RS 929
Cumulative similarity () 5710 5781 5595 6081 6134 5710 524Average similarity () 4433 4070 5327 3543 4660 4433 405
Unidentified bands from DGGE after several attempts to clone
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
133
Figure 5 Denaturant gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen
fragments from the consortium C2PL05 (line 1 to 5) and consortium BOS08 (line 6 to 10) Line 0
contains the molecular weight markers lines 1 and 6 correspond to initial time lines 2 and 7 to
high temperature range at day 33 lines 3 and 8 to high temperature range at day 101 lines 4
and 9 to low temperature range at day 33 and lines 5 and 10 to low temperature range at day
101
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
134
Figure 6 Multidimensional scaling (MDS) plot showing the similarity
between consortia BOS08 (BO) and C2PL05 (C2) incubated at low
(superscript L) and high (superscript H) temperature at day 0 33 and
101(subscripts 0 1 and 2 respectively)
Discussion
PAH degradation capability of bacterial consortia
Consortium BOS08 was isolated from a pristine soil since hydrocarbons and especially PAH
were not detected Opposite results were observed for samples where consortium C2PL05
was extracted with a large amount (64 wt) of petroleum compounds (ltC40) measured
However both consortia proved to be able to efficiently degrade HMW-PAH even at low
temperature range (5-15 ordmC) However both consortia have shown lower pyrene than
perylene depletion rates despite the former has lower molecular size and higher aqueous
solubility and bioavailability and lower hydrophobicity Previous work (Alves et al 2005)
have reported that UV and visible light can activate the chemical structure of some PAH
inducing changes in toxicity However whereas these authors classified phototoxicity of
pyrene and perylene as positive other phototoxic classifications (Mekenyan et al 1994)
consider pyrene as extremely toxic and perylene as moderately toxic So the high toxicity
level of pyrene due to phototoxic effect may explain the lower depletion rates of pyrene
opposite to that expected from their physicochemical properties above mentioned
Contrary to previous works (Spain amp ven Veld 1983 Jhonsen amp Karlson 2005) the
consortium BOS08 has not needed the pre-exposure to PAH to induce microbial adaptation
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
135
and consequently degradation of those pollutants In agreement with previous works
(Margesin amp Schinner 2001) our results have showed that the addition of PAH to the forest
consortium BOS08 was rapidly followed by an initial increase of PAH degrading bacteria
Considering the origin of consortium BOS08 extracted from a soil rich in organic matter and
decaying wood is possible that biodegradation process may be associated with wood
degrading bacteria and fungi However results confirmed that initial conditions when PAH
concentration was high fungi were not present Fungi appeared just at the end of the
biodegradation process (101 and 137 days) and only at high temperature when high PAH
concentration was already depleted and toxicity was low These results therefore confirm
that biodegradation process was mainly carried out by bacteria when PAH concentration and
toxicity were high
PAH degradation ability is a general characteristic present in some microbial
communities when community is exposed to PAH (Macleod amp Semple 2002 Jhonsen amp
Karlson 2005 Tian et al 2008) Microbial consortia were obtained from highly different
levels of contamination However although high differences were observed at the initial
microbial composition of both consortia they share some strains (Microbacterium sp and
Acinetobacter sp) The lower diversity found within the C2PL05 consortium (more details in
Molina et al 2009) obtained from a chronically and heavily polluted area with petroleum
hydrocarbons is typical of aged soils exposed to PAH These pollutants drive the selection of
specific bacteria that are able to degrade them (Vintildeas et al 2005)
Most of the identified species by DGGE (culture-independent rRNA approaches) in this
work were γ-proteobacteria (Pseudomonas and Acinetobacter) except DUB-26RS 98
similar to Microbacterium sp belonging to Actinobacteria phylum In agreement with previous
works (Harayama et al 2004) identification results retrieved by culture-dependent methods
showed some differences from those identified by the culture-independent rRNA
approaches DIC identified by culturable techniques belonged to a greater extend to
Proteobacteria phylum γ-Proteobacteria (Pseudomonas Pshycrobacter Acinetobacter) and
β-Proteobacteria (Ralstonia) Only two cultivable strains DIC-46RS and DIC-47RS identified
as Rhodococcus sp and Bacillus psychrodurans belonged to Actinobacteria and Firmicutes
phylum respectively Genera as Bacillus Pseudomonas and Ralstonia were identified within
the consortium BOS08 obtained from decaying wood in a pristine forest These genera are
typical from decomposing wood systems and have been previously mentioned as important
aerobic cellulose-degrading bacteria such as Bacillus sp (Lynd et al 2002) or degraders of
the highly oxidized oxalate (Pseudomonas sp Ralstonia sp) which is released by white-rot
fungi during degradation of lignocellulose (Dutton amp Evans 1996) Lignin is one of the most
slowly degraded components of dead plants and the major contributor to the formation of
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
136
humus as it decomposes The breakdown of lignin is mediated by extracellular enzymes
such as laccase lignin peroxidise and manganese peroxidase (Hatakka 1994 Hatakka
2001) The lack of specificity and the high oxidant activity of these enzymes make them able
to degrade different components as PAH (ie Pickard 1999) For this reason Bacillus
Pseudomonas and particularly Ralstonia identified within the consortium BOS08 and
typical from decomposing wood systems have been also previously identified as degrader of
aromatic compounds (Zhuang et al 2002 Chauhan et al 2008 Luo et al 2009) While
many eukaryotic laccases have been identified and studied laccase activity has been
reported in relatively few bacteria these include some strains identified in our decomposing
wood consortium BOS08 such as Ralstonia sp and Bacillus sp and others like Azospirillum
lipoferum Marinomonas mediterranea Amycolatopsis sp Streptomyces coelicolor
Arthrobacter cholorophenolicus and Rhodococcus opacus (McMahon et al 2007 Dawkar et
al 2009 Brown et al 2011)
HMW-PAH degradation at low temperatures
In the last 10 years research in regard to HMW-PAH biodegradation has been carried out
mainly through single bacterial strains or artificial microbial consortia and at optimal
temperatures (Kanaly amp Harayama 2000 Kanaly amp Harayama 2010) However there is a
lack of knowledge focused on HMW-PAH biodegradation at difficult conditions such as low
temperatures by full microbial consortia Temperature is a key factor in physicochemical
properties of PAH and in the control of PAH biodegradation metabolism in microorganisms
The diffusion rate of PAH into the aqueous phase increases with temperature and so PAH
bioavailability (Haritash amp Kaushik 2009) and PAH metabolism rate (Leahy amp Colwell 1990)
In agreement with previous results (Eriksson et al 2001) PAH biodegradation rates were
significantly higher at moderate temperatures (15-25 ordmC) because metabolic activity
diffusion and mass transfer was facilitated However there are also microorganisms with
capacity to efficiently degrade HMW-PAH even at lower temperatures (Margesin et al 2002)
as microorganisms present at both consortia (BOS08 and C2PL05)
Genera as Acinetobacter and Pseudomonas identified from both consortia growing at
low temperature have been previously reported as typical strains from cold and petroleum-
contaminated sites being capable to grow using solely hydrocarbons (MacCormack amp Fraile
1997 Eriksson et al 2003 Margesin et al 2003) According to previously works that
considered this genera as cold-tolerant (Margesin et al 2003 Ma et al 2006) our results
showed that they grow and efficiently degrade HMW-PAH at low temperature range (5-15 ordmC)
but with significantly lower rates than those at higher temperature In addition whereas time
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
137
was an influence factor in bacterial communities distribution temperature only affected to
C2PL05 consortium Possibly these results can be related with the environmental
temperature of the sites where consortia were extracted Whereas bacterial community of
BOS08 are adapted to temperatures below 20 ordmC all year C2PL05 consortium is adapted to
a range with maximum temperatures above 20 ordmC Hence although this consortium had cold-
tolerant species that degrade at low temperatures their probably less proportion than in the
BOS08 consortium resulted in differences between percentages of PAH depletion and
evolution of the bacterial community in function of temperature Therefore the cold-adapted
microorganisms are important for the in-situ biodegradation in cold environments
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (Projects 11-37320053-
B and 0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
138
References
amp Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int Biodet
Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bode A Gonzaacutelez N Lorenzo J Valencia J Varela MM amp Varela M 2006 Enhanced
bacterioplankton activity after the Prestige oil spill off Galicia NW Spain Aquatic
Microb Ecol 43 33-41
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0ndash5degC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Brown ME Walker MC Nakashige TG Iavarone AT amp Chang M 2011 Discovery and
characterization of heme enzymes from unsequenced bacteria Application to microbial
lignin degradation J Am Chem Soc 4518006-18009
Canet R Birnstingl JG Malcolm DG Lopez-Real JM amp Beck AJ 2001 Biodegradation
of polycyclic aromatic hydrocarbons (PAH) by native microflora and combinations of
white-rot fungi in a coal-tar contaminated soil Bioresource Technol 76113-117
Chauhan A Fazlurrahman Oakeshot JG amp Jain RK 2008 Bacterial metabolism of
polycyclic aromatic hydrocarbons strategies for bioremediation Indian J Microbiol 48
95-113
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158 3411-
3420
Dawkar VV Jadhav UU Telke AA amp Govindwar SP 2009 Peroxidase from Bacillus sp
VUS and its role in the decolorization of textile dyes Biotechnol Bioprocess Eng 14
361-368
Dutton MV amp Evans CS 1996 Oxalate production by fungi its role in pathogenicity and
ecology in the soil environment Can J Microbiol 42 881ndash895
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
139
Eriksson M Jong-Ok Ka amp Mohn WW 2001 Effects of low temperature and freeze-thaw
cycles on hydrocarbon biodegradation in Arctic Tundra soil Appl Environ Microbiol
675107-5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Harayama S Kasai Y amp Hara A 2004 Microbial communities in oil-contaminated seawater
Curr Opin Biotechnol 15 205-214
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycoilyclic aromatic
hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microb Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M Steinbuchel A(eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Johonsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-
does it depend on PAH exposure Microb Ecol 50 488ndash495
Joslashrgensen KS Jaumlrvinen O Sainio P Salminen J amp Suortti AM 2005 Quantification of
soil contamination In Margesin R Schinner F (eds) Manual of soil analysis
monitoring and assessing soil bioremediation Springer Berlin pp 97-119
Kanaly RA amp Harayama S 2000 Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059ndash2067
Kanaly RA amp Harayama S 2010 Advances in the field of high-molecular-weight polycyclic
aromatic hydrocarbon biodegradation by bacteria Microb Biotechnol 3 136ndash164
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Lafortune I Juteau P Deacuteziel E Leacutepine F Beaudet R amp Villemur R 2009 Bacterial
diversity of a consortium degrading high-molecular-weight polycyclic aromatic
hydrocarbons in a two-liquid phase biosystem Microb Ecol 57 455-468
Lane DJ 1991 16S23S sequencing In E Stackebrandt and M Goodfellow (ed) Nucleic
acid techniques in bacterial systematic John Wiley amp Sons Chischester UK
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environments
Microbiol Rev 54 305-315
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
140
Luo YR Tian Y Huang X Yan CL Hong HS Lin GH amp Zheng TL 2009 Analysis of
community structure of a microbial consortium capable of degrading benzo(a)pyrene
by DGGE Marine Poll Bull 58 1159-1163
Lynd LR Weimer PJ van Zyl WH amp Pretorius IS 2002 Microbial cellulose utilization
fundamentals and biotechnology Microbiol Mol Biol Rev 66 506ndash577
MacCormack WP amp Fraile ER 1997 Characterization of a hydrocarbon degrading
psychrotrophic Antarctic bacterium Antarct Sci 9 150-155
Macleod CJA amp Semple KT 2002 The adaptation of two similar soils to pyrene catabolism
Environ Pollut 119357-364
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Madden TL Tatusov RL Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts Extremophiles
7451ndash458
McMahon AM Doyle EM Brooksm S amp OacuteConnor KE 2007 Biochemical
charcaterization of the coexisting tyrosinase and laccase in the soil bacterium
Pseudomonas putida F6 Enzyme Microb Tech 401435-1441
Mekenyan OG Ankly GT Veith GD amp Call DJ 1994 QSAR for photoinduced toxicity I
Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere
28 567
Microbics Corporation 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mohn WW amp Stewart GR 2000 Limiting factors for hydrocarbon biodegradation at low
temperature in Artic soils Soil Biol Biochem 321161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Pickard MA Roman R Tinoco R Vazquez-Duhalt R 1999 Polycyclic aromatic
hydrocarbon metabolism by white rot fungi and oxidation by Coriolopsis gallica UAMH
8260 laccase Appl Environ Microbiol 65 3805-3809
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
141
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Soriano JA Vintildeas L Franco MA Gonzaacutelez JJ Ortiz L Bayona JM amp Albaigeacutes J 2006
Spatial and temporal trends of petroleum hydrocarbons in wild mussels from the
Galician coast (NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-
90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil In Singh
A Kuhad RC Ward OP (eds) Adv Appl Biorem 103-121 Springer Berliacuten
Sutherland JB Rafii F Khan AA amp Cerniglia CE 1995 Mechanisms of polycyclic
aromatic hydrocarbon degradation p 269ndash306 In L Y Young and C E Cerniglia
(ed) Microbial transformation and degradation of toxic organic chemicals Wiley-Liss
New York NY
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of Xiamen
China Marine Pollut Bull 56 1184-1191
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-95
Wong WSD 2009 Structure and action of ligninolytic enzymes Appl Biochem Biotechnol
157 174-209
Wrenn BA amp Venosa AD 1996 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
142
Yakimov MM Giuliano L Gentile G Crisafi E Chernikova TN Abraham W-R Luumlnsdorf
H Timmis KN amp Golyshin PN 2003 Oleispira antarctica gen nov sp nov a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water Int J
System Evol Microbiol 53779-785
Zhuang W-Q Tay J-H Maszenan AM amp Tay STL 2002 Bacillus naphthovorans spnov
from oil contaminated tropical marine sediments and its role in naphthalene
biodegradation ApplMicrobiol Biotechnol 58547-553
Zimmermann W 1990 Degradation of lignin by bacteria J Biotechnol 13119-130
Proteobacteria
Capiacutetulo
Manuscrito ineacutedito
Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez M amp Peacuterez L
Assessment the efficient of bioremediation techniques (biostimulation bioaugmentation
and natural attenuation) in a creosote polluted soil change in bacterial community
Evaluacioacuten de la eficacia de teacutecnicas de biorremediacioacuten (bioestimulacioacuten bioaumento y
atenuacioacuten natural) en un suelo contaminado con creosota cambios en la comunidad bacteriana
4
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
145
Abstract
The aim of the present work was to assess different bioremediation treatments
(bioaugmentation bioestimulation combination of both and natural attenuation) applied to a
creosote polluted soil with a purpose of determine the most effective technique in removal of
pollutant Toxicity microbial respiration degradation of creosote and PAH (antharcene
phenathrene and pyrene) as well as evolution of bacterial communities by non culture-
dependent molecular technique DGGE were analyzed Results showed that creosote was
degraded through time without significant differences between treatments but PAH were
better degraded by treatment with biostimulation Low temperatures at which the process
was developed negatively conditioned the degradation rates and microbial metabolism as
show our results DGGE results revealed that biostimulated treatment displayed the highest
microbial biodiversity However at the end of the bioremediation process no treatment
showed a similar community to autochthonous consortium The degrader uncultured bacteria
identified belonged to Pseudomonas Sphingomonas Flexibacter all of them involved in
degradation process Particularly interesting was the identification of two uncultured bacteria
belonged to genera Pantoea and Balneimonas did not previously describe as such
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
147
Introduction
Creosote is a persistent chemical compound derived from burning carbons as coal between
900-1200 ordmC and has been used as a wood preservative It is composed of approximately
85 polycyclic aromatic hydrocarbons (PAH) 10 phenolic compounds and 5 nitrogen
and sulfur PAH are a class of fused-aromatic compounds toxic mutagenic bioaccumulative
and persistent in the environment and so the United State Environmental Protection Agency
(US EPA) considered that the removal of these compounds is important and priority Against
physical and chemical methods bioremediation is the most effective versatile and
economical technique to eliminate PAH Microbial degradation is the main process in natural
decontamination and in the biological removal of pollutants in soils chronically contaminated
(MacNaughton et al 1999) in which degrading-bacteria are abundant (Taketani et al
2010) However recently works have reported (Tian et al 2008 Couling et al 2010) the
potential ability to degrade PAH of microorganisms from soils apparently not exposed
previously to those toxic compounds The technique based on this degradation capacity of
indigenous bacteria is the natural attenuation This technique avoid damage in the habitat
(Dowty et al 2001) allowing to retrieve the original conditions of the ecosystem converting
the toxic compounds into harmless (Kaplan amp Kitts 2004 Haritash amp Kaushik 2009)
However this method require a long period or time to remove the toxic components because
the number of degrading microorganisms in soils only represents about 10 of the total
population (Yu et al 2005a) Many of the bioremediation studies are focused on the
bioaugmentation which consist in the inoculation of allochthonous degrading
microorganisms (ie Atagana 2006) However bioaugmentation is a complicate technique
to study because a negative or positive effect depends on the interaction between the
inocula and the indigenous population due to the competition for resources mainly nutrients
(Yu et al 2005b) Other bioremediation techniques as biostimulation consist in to empower
the degrading capacity of the indigenous community by the addition of nutrients to avoid
metabolic limitations (ie Vintildeas et al 2005)
However inconsistent results have been reported with all these previuos treatments
Previous studies have shown that biodegradation rates can be increased (Mills et al 2004)
and have no effect influenced negatively with biostimulation (Yu et al 2005a Chen et al
2008) Similar enhance of biodegradation rates (Atagana et al 2006) and not significant
differences (Vintildeas et al 2005 Yu et al 2005b) have been described with bioaugmentation
It is necessary taking in to account that each contaminated site can respond in a different
way (Vintildeas et al 2005) therefore to carry out an in situ bioremediation process it will be
necessary to design a laboratory-scale assays to determine what technique is more efficient
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
148
on the biodegradation process and the effect on the microbial diversity In addition
previously works (Gonzalez et al 2011) showed that although PAH were completely
consumed by microorganisms toxicity values remained above the threshold of the non-
toxicity Although most of the work not perform toxicity assays these are necessary to
determine effectiveness of a biodegradation The main goal of the present study is to
determine through a laboratory-scale assays the most effective bioremediation technique in
decontamination of creosote contaminated soil evaluating changes in bacterial community
and the toxicity values
Materials and methods
Chemical media and inoculated consortium
The fraction of creosote used in this study was composed of 26 of PAH (naphthalene
05 phenanthrene 51 anthracene 122 pyrene 31 dibenzofurane 13 and
acenaphthene47) Creosote was diluted in acetonitrile (purchased form Sigma Aldrich
Steinheim Germany) in a stock solution of a final concentration of 0439 gmiddotml-1 containing
0117 g PAHmiddotml-1 The culture mediums LuriandashBertani (LB) and Bushnell-Haas Broth (BHB)
were purchased from Panreac (Barcelona Spain) Biostimulated treatments were amended
with BHB as inorganic nutrients source which composition was optimized for PAH-degrading
consortium (C2PL05 consortium) in a previously work (Simarro et al 2010) with the optimum
composition 02 gmiddotlminus1 MgSO4 7H2O 002 gmiddotlminus1 CaCl2 2H2O 0281 gmiddotlminus1 KHPO4 0281 gmiddotlminus1
K2HPO4 002 gmiddotlminus1 NH4NO3 0195 gmiddotlminus1 Fe2(SO4)3 According to Bautista et al(2009) Tween-
80 was the optimal surfactant for PAH biodegradation by bacteria and was added in a critical
micellar concentration (CMC) of 300 μlmiddotml-1 (0012 mM) Bioaugmented treatments were
inoculated with the PAH-degrading consortium C2PL05 extracted from a permanently PAH
contaminated soil from a refinery in Ciudad Real (Spain) and previously identified and
described in Molina et al(2009)
Experimental design
Five different treatments in microcosms designated as T1 to T5 (see Table 1) were carried
out each in duplicate for five sampling times zero 6 40 145 and 176 days from December
2009 to May 2010 In total 40 microcosms containing 550g of natural soil samples collected
from an uncontaminated area of Rey Juan Carlos University in Madrid (Spain) were carried
out The soil obtained from the first top 20 cm and sieved by 2 mm was located in plastic
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
149
trays and randomly arranged outdoor in terrace and protected with a plastic to avoid the rain
and snow on them Each tray except the treatment T1 contained 56 ml of a creosote
solution in n-hexano (0439 g ml-1) with final amount of creosote per tray of 25 g
Microcosms were maintained at 40 of water holding capacity (WHC) considered as
optimum during bioremediation process (Vintildeas et al 2005) For biostimulation microcosms
samples were hydrated with the required amount of the optimum BHB while in treatment no
biostimulated samples were hydrated with only mili-Q water Bioaugmented treatments were
inoculated with 5ml of the consortium C2PL05 (2015x107 plusmn 427x106 cellsmiddotg soil-1 of
heterotrophic microorganisms and 177x105 plusmn 101x105 cellsmiddotg soil-1 of creosote-degrading
microorganisms)
Table 1 Summary of the treatment conditions
Code Treatments Conditions
T1 Untreated soil (control) Uncontaminated soil
T2 Natural attenuation Contaminated soil with 56 ml creosote moistened 40WHC
with 1054 ml mili-Q water
T3 Biostimulation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1104 ml BHB
T4 Bioaugmentation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml mili-Q water 5 ml consortium
C2PL05
T5 Biostimulation
+ Bioaugmentation
Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml BHB inoculated with 5 ml
Characterization of soil and environmental conditions
The water holding capacity (WHC) was measured following the method described by Wilke
(2005) and the water content was calculated through the difference between the wet and dry
weigh after drying at 60ordmC during 1 hour pH was measured using a GLP 21 micro pHmeter
(Crison Barceona Spain) resuspending 1 g of the soil in mili-Q water (110) and incubating it
in an orbital shaker at 150 rpm at 25 ordmC during 1 h Temperature which the experiments were
developed was recorded on a temperature loggers (Tidbit Loggers Onset Computer
Pocasset Mass) located in the site
Total heterotrophic microorganisms (HM) and creosote-degrading microorganisms
(C-DM) of the microbial population of the natural soil was counted using a miniaturized most
probable number technique (MPN) in 96-well microtiter plates with eight replicates per
dilution (Wrenn amp Venosa 1996) The number of cells was calculated with Most Probable
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
150
Number Calculator software Version 404 (Klee 1993)To extract the microorganisms from
the soil 1 g of soil was resuspended in 10 ml of phosphate buffer saline (PBS) and was
shaker at 150 rpm at 25 ordmC during 24 h The HM were determined in 180 μl of LB medium
with glucose (15 gl-1) and C-DM were counted in 180 μl of BHB medium with 10 μl of
creosote stock solution as carbon source
Respiration and toxicity assays
To measure the respiration during the experiments 10 g of soil moistened with 232 ml of
mili-Q water (to maintain a water capacity of 40 WHC) was incubated in duplicate in a
desiccator during 14 days at 25ordmC Replicates contained 14 ml of NaOH 02 M to absorb the
CO2 produced by microorganisms The vials were periodically replaced and checked
calorimetrically with HCl (01M) and phenolphthalein as indicator The test was doing with
BaCl2 (01 M) in excess to ensure the precipitation of carbonates The numbers of moles of
CO2 produced were calculated as a difference between initial moles of NaOH in the
replicates and moles of NaOH checked with HCl (moles of NaOH free)
The toxicity evolution during the PAH degradation was also monitored through a short
screening of the samples with the Microtox TM method with the luminescent bacterium Vibrio
fischeri following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15ordmC
Monitoring the removal of creosote and polycyclic aromatic hydrocarbons
Organic compounds were extracted and analyzed from the microcosms samples at 0 6 40
145 and 176 days by gas chromatography-mass spectrometry (GC-MS) to estimate the
creosote and percentage of PAH depletion A gas cromatograph (model CP3800 Varian
Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary column (15 m
length 025 mm ID 025 μm film thickness) was coupled to a quadruple mass-spectrometer
detector (Model 1200L Varian) The stationary phase was composed by phenyl (5) and
dimethylpolysiloxane (95) as carried gas ice in the mobile phase Temperature gradient
program used was initial temperature of 80 ordmC for 2 min temperature increase to 300 ordmC at
the rate of 1ordmC min-1 final temperature of 300 ordmC for 15 min with a final duration of the
method of 39 min Organic compounds were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inject 05 μl in
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
151
the FDI chromatograph The concentration of each PAH and creosote was calculated from
the chromatograph of the standard curves
DNA extraction molecular and phylogenetic analysis for characterization of the total
microbial population in the microcosms
Non culture-dependent molecular techniques as denaturing gradient gel electrophoresis
(DGGE) was performed to identify non-culture microorganisms and to compared the
biodiversity between treatments and its evolution at 145 and 176 days of the process Total
community DNA was extracted from 25 g of the soil samples using Microbial Power Soil
DNA isolation kit (MoBio Laboratories Solano Beach CA USA) In total suitable yields of
high molecular-weight DNA (5-20 μgg of soil-1) were obtained The V3 to V5 variable regions
of the 16S rRNA gene were amplified using the primers set 16S 518R and 16S 338F-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primer 338F-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded on to a 10
(wtvol) polyacrylamide gels that was 075mm tick and the denaturing gradients used ranged
from 35 to 65 denaturant (more details in Gonzalez et al 2011) Gel were stained with
Syber-Gold and viewed under UV light and predominant bands were excised and diluted in
50μl of mili-Q water Due to impossibility of reamplified bands DNA of the bands was cloned
in the pGEM-T Easy Vector (Promega Madison WI) Plasmids were purified using the High
Pure plasmid Isolation Kit (Roche) and sequenced using the internal primers 338F and 518R
Creosote-degrader uncultured bacterium (DUB) were edited and assembled using version
487 of the BioEdit program (Hall 1999) BLAST search (Madden et al 1996) was used to
find nearly identical sequences for the 16S rRNA sequences determined All DUB identified
sequence and 25 similar sequences downloaded from GenBank were used to perform the
phylogenetic tree Sequences were aligned using the Q-INS-i algorithm (Katoh amp Toh 2008a)
of the multiple sequence alignment software MAFFT version 6611 (Katoh amp Toh 2008b)
aligning sequences in a single step Sequence divergence was computed in terms of the
number of nucleotide differences per site between of sequences according to the Jukes and
Cantor algorithm (1969) The distance matrix for all pair wise sequence combinations was
analyzed with the neighbour-joining method (NJ) of phylogenetic tree construction with 1000
bootstrap replicates by using version PAUP 40B10 (Swofford 2003) In addition maximum
parsimony (MP) was also analyzed (Molina et al 2009) Sequences of Sphirochatea
americans belonged to Sphirochaetes phylum were used as out-group (Gupta amp Griffiths
2002) Images of DGGE were digitalized and DGGE bands were processed using the UN-
Scan-It gel analysis software version 60 (Silk Scientific US)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
152
Statistical analysis
In order to evaluate the effects of treatments on intrinsic growth rate (μ) toxicity degradation
of organic compounds and respiration analysis of variance (ANOVA) were used The
variances were checked for homogeneity by the Cochranacutes test Student-Newman-Keuls
(SNK) test was used to discriminate among different treatments after significant F-test
representing these differences by letters in the graphs Data were considered significant
when p-value was lt 005 All tests were done with the software Statistica 60 for Windows
Differences in microbial assemblages by biostimulation by bioaugmentation and by time
(145 and 176 days) were graphically evaluated with a non-metric multidimensional scaling
(MDS) using PRIMER software (Clarke 1993) The previous period to 145 days was
considered a period of cold conditions and the time from 145 to 176 days a period of higher
temperatures SIMPER method was used to identify the percent contribution of each band to
the similarity in microbial assemblages between factors Bands were considered ldquohighly
influentialrdquo if they contributed to the first 60 of cumulative percentage of average similarity
betweenwithin combination of factors In addition Shannon index (Hacute) was calculated from
DGGE bands applying equation 2 to estimate the ecological diversity of each treatment at
136 and 145 days
Equation 2
where pi is the proportion in the gel of the band i with respect to the total of all bands
detected calculated as coefficient between band intensity and total intensity of all
bands (Baek et al 2007)
Results
Physical chemical and biological characteristics of the natural soil used for the treatments
pH of the soil was slightly basic 84 and the water content of the soil was 10 although the
soil had a high WHC (521) possibly due to their sandy character Initial proportion of C-DM
from natural soil represented only 088 of the total heterotrophic population with a number
of microorganisms two order of magnitude higher (201 x 107 plusmn 427 x 106 cells g soil-1)
Figure 1 shows that the evolution of the monthly average temperature observed during the
experiment and the last 30 years Average temperature decreased progressively from
October to January from 16 ordmC to a minimum average of 6 ordmC starting to increase
progressively to reach a mean value of 21 ordmC in June
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
153
October
November
DecemberJanuary
FebruaryMarch
April MayJune
468
10121416182022
0 day
40 day
145 day
176 day
6 dayT
empe
ratu
re (
ordmC)
Month
Figure 1 evolution of the normal values of temperature (square) and evolution of
the monthly average temperature observed (circle) during the experiment
Respiration of the microbial population
Table 2A shows the ANOVA results concerning to the accumulated values of CO2 produced
for each treatment in each time period (from 0- to 6 days from 40 to 145 days and from 145
to 176 days) Due to interval time was the only significant factor (Table 2A) differences in
percentage of accumulative CO2 by sampling times (6 40 145 and 176 days) were analyzed
and showed in Figure 2 Differences between sampling times showed that the accumulated
percentage of CO2 was significantly higher at 176 days than at other time
6 40 145 17600
10x10-4
20x10-4
30x10-4
40x10-4
50x10-4
a a
b
aCO
2 mol
esg
of
soil
Time (days)
Figure 2 accumulated CO2 issue at 6 40 145 and 176 days Error bars show the
standard deviation and the letters show significant differences between groups
(plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
154
Toxicity assays
Changes on the toxicity during the creosote degradation process (Figure 3A) showed that all
treatments had a similar evolution T1 (uncontaminated) was not toxic (lt20 ) but toxicity of
treatments with creosote increased constantly from initial value of 26 to a values higher
than 50 Only during last period of time (145 to 176 days) toxicity started to decrease
slightly Despite similar toxicity values reached with the treatments interaction between time
periods (0 to 6 days 40 to 145 days and 145 to 176 days) and treatments showed significant
differences (Table 2B) Differences between groups by both significant factors (Figure 3B)
showed that toxicity of all treatments in first time period was significantly lower than in the
other periods Differences in toxicity between the two last periods were only significant for
treatment T4 in which toxicity increase progressively from the beginning
0 6 20 40 56 77 84 91 98 1051121251321411760
10
20
30
40
50
60
70
80
90
100 BA
Tox
icity
(
)
Time (days)T2 T3 T4 T5
c
c
c
b
c
bc
bcbc
aa
aa
Treatment
Figure 3 (A) evolution of the toxicity () of the treatment T1 (square) T2 (circle) T3 (triangle) T4
(inverted triangle) and T5 (rhombus) during the experiment (B) percentage of toxicity of the treatment
in the interval times 1 (black bars) from 0- to 6 days interval 2 (with bars) from 6 to 40 days and
interval 3 (gray bars) from 40 to 176 days Error bars show the standard deviation and letters
differences between groups
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
155
Biodegradation of creosote and polycyclic aromatic hydrocarbons
The results concerning the chromatography performed on the microcosms at 0 40 145 and
176 days are shown in Figure 4 Creosote depletion during first 40 days was very low
compared with the intensive degradation occurred from 40 to 145 days in which the greatest
amount of creosote was eliminated (asymp 60-80) In addition difference between residual
concentration of PAH at final time by type of PAH (phenanthrene anthracene and pyrene)
and treatment were analyzed (Table 2C) Both factor were significantly influential although
was not the interaction between them Differences by PAH (Figure 4B) showed that
anthracene degradation was significantly higher than other PAH and differences by
treatments (Figure 4C) showed that difference were only significant between treatment T3
and T2 lower in the treatment T3
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
156
T1 T2 T3 T4 T50000
0005
0010
0015
0020
0025
0030
0035
0040
g cr
eoso
te
g so
il
Phenanthrene Anthracene Pyrene0
102030405060708090
100
C
aab
abb
a
bb
B
A
Ave
rage
res
idua
l con
cenr
atio
n of
PA
H (
)
T2 T3 T4 T50
102030405060708090
100
Tot
al r
esid
ual c
once
ntra
tion
of
PA
H (
)
Figure 4 (A) creosote depletion during the experiment at sampling times 6 days (black
bars) 40 days (with bars) 145 days (grey bars) and 176 days ( ) (B) average residual
concentration at 176 days of the identified PAH (phenanthrene anthracene and pyrene)
and (B) average residual concentration of the identified PAH as a function of applied
treatment (C) Error bars show the standard error and the letters show significant
differences between groups (plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
157
Table 2 Analysis of variance (ANOVA) of the effects on the μ of the
heteroptrophic population (A) μ of the creosote degrading microorganisms (B)
accumulated value of CO2 (C) toxicity (D) and residual concentration of PAH (E) SS is
the sum of squares and df the degree of freedoms
Factor df SS F P
C) Accumulated value of CO2 (n=40) Time interval 3 65-5 3112
Treatment 4 60-6 202 ns
Interval x Treatment 12 11-5 134 ns
Error 20 14-5
D)Toxicity (n=24) Time interval 2 907133 11075
Treatment 3 12090 098 ns
Interval x Treatment 6 122138 497
Error 12 49143
E) Residual concentration of the PAH (n=24) Treatment 3 95148 548
PAH 2 168113 1452
Treatment x PAH 6 17847 051 ns
Error 12 69486
p-value lt 005
p-value lt 001
p-value lt 0001
Diversity and evolution of the uncultivated bacteria and dynamics during the PAH
degradation
The effects of different treatments on the structure and dynamics of the bacterial community
at 145 days and 176 days were analyzed by DGGE (Figure 5) At 145 days 8 bands (3 4 10
810 16 17 26 and 27 see Figure 5) were cloned and 6 different genotypes (DUB 12-RS to
DUB-17RS) were identified whereas at 176 days 5 bands (4 112 113 22 and 26 see
Figure 5) and 6 different genotypes (DUB-12RS DUB-13RS DUB-18RS DUB-19RS DUB-
20RS and DUB-21RS) were identified Most influential bands considered as 60 of
contribution to similarity according to the results of PRIMER analysis is showed at the Table
3 Similarities between treatments at 145 and 176 days were compared and analyzed as a
function of the addition of nutrients (biostimulated vs no biostimulated treatments) and the
addition of degrading consortium C2PL05 (bioaugmentated vs no bioaugmentated
treatments) The addition of nutrients was the factor that best explained differences between
treatments and so results in Table 3 are as a function of the addition of nutrients At 145
days no-biostimulated treatments T1 T2 and T4 were only similar in 402 whereas
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
158
biostimulated treatments (T3 and T5) were 6567 (Table 3) The patter were slightly
opposite at 176 days where no-biostimulated treatments were more similar (7026 ) than
biostimulated treatments (average similarity 4384 ) In addition at 145 days (Figure 6A)
natural attenuation (T2) was the only similar treatment to microbial community from the
uncontaminated treatment (T1) However at 176 days (Figure 6B) bacterial communities
from all treatments were highly different to the treatment T1 and there was no defined group
In addition PRIMER analysis allowed us to estimate the Shannon diversity index (Hacute) for
each treatments at 145 and 176 days indicating that the bacterial diversity increased for the
treatments T1 (3328) T3 (4154) and T5 (3739) remarkably higher in the treatment T4
Table 3 Bands contribution to 60 similarity primer between treatments grouped by
treatments biostimulated and no biostimulated at 145 days and 176 days Average
similarity of the groups determined by SIMPER method
145 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
3 DUB-12RS
DUB-17RS 2875
16 DUB-17RS 1826
17 DUB-12RS
DUB-16RS 1414
18 Unidentified 3363
19 Unidentified 3363
Cumulative similarity () 6725 6115 Average similarity () 402 6567
176 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
11 Unidentified 2116 13 Unidentified 2078 1794
23 Unidentified 2225 2294
26 DUB-13RS 1296
Cumulative similarity () 6418 5383 Average similarity () 7026 4384
bands from DGGE unidentified after several attempts to clone
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
159
Figure 5 Denaturing gradient gel electrophoresis (DGGE) at 145 days (A) and 176 days (B) of PCR-
amplified 16S rDNA gen fragments from the consortium C2PL05 (lane B) control experiment (lane C)
treatment with natural attenuation T1 (lane T1)biostimulated treatment T2 (lane T2) bioaugmentated
treatment T3 (lane T3) bioaugmentated treatment T4 (lane T4) and biostimulated and
bioaugmentated treatment t5 (lane T5) Lane A is the molecular weigh marker Numbers are the
bands cloning
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
160
Figure 6 proximity analysis (MDS) based on the Bray-Curtis dissimilarity
matrix of each treatment from the bands obtained in DGGE at 145 days (A)
and 176 days (B)
Phylogenetic analyses
Phylogenetic relationships of the degrading uncultured bacteria are shown in Figure 7 The
aligned matrix contained 1373 unambiguous nucleotide position characters with 496
parsimony-informative Parsimony analysis of the data matrix yielded 87 parsimonious trees
with CI = 0671 RI = 0767 and a length of 1452 Figure 6 also shows the topology of the
maximum parsimony (MP) tree with the bootstrap values of the maximum parsimony and
neighbour joining analyses Inconsistencies were not found between parsimony and
neighbour joining (NJ) topology
Phylogenetic tree was composed by bacteria belonged to Proteobacteria (α- and γ-
Proteobacteria) and Bacteroidetes phylum From DUB-12RS to DUB-17RS were located in
the Pseudomonadaceae clade in which it can be observed five clearly species groups DUB-
13RS and DUB-15RS identified as Pseudomonas trivialensis (HM134251) and P poae
(HM640290) respectively were in an undifferentiated group supported by P trivialensis and
P poae type-strains DUB-14RS similar to P viridiflava (HM190224) formed a group
supported by P viridiflavaT (HM190229) DUB-12RS 98 similar to P fluorescens (GQ
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
161
496662) was grouped with P fluorescensT (D84013) DUB-16RS was identified as
uncultured Pseudomonas sp (HQ677222) and classified in an indefinite group Finally the
last group of the Pseudomonadaceae clade was formed by DUB17-RS 98 similar to P
parafulva (HQ406758) and grouped with P parafulvaT (D84015) DUB-21RS was nested in
the Enterobacteriaceae clade due to it was identified with 99 of similarity as Pantoea
Brenneri (HM163514) This clade is supported by types-strains of other species of Pantoea
as Pantoea agglomeransT (FJ613819) and other enteric bacteria as Enterobacter cloacaeT
(AJ251469) DUB nested in Enterobacteriaceae and Pseudomonadaceae clade were γ-
Proteobacteria In α-Proteobacteria class are included Rhizobiales and
Sphingomonadaceae clades In the first clade formed by uncultured Balneimonas and
Rihzobiales bacterium supported by Balneimonas floculansT was nested DUB-19-RS 99
similar to an uncultured Balneimonas strain (HM799006) In Sphingomonadaceae clade was
nested DUB-20RS identified as uncultured Sphingomonadales bacterium DUB-18RS was
similar in 99 to Uncultured Flexibacteriaceae bacterium and was nested in Cytophagaceae
clade belonging to Bacteroidetes phylum
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
162
Figure 7 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrading uncultured bacteria (DUB) obtained from DGGE of the treatments 145 and 176 days of the
process Boostrap values of neighbourjoining and parsimony higher than 50 are showed on the
branch of the tree (NJMP) No incongruence between parsimony and neighbour joining topology were
detected Pseudomonas genus has been designated as P Pantoea genus as Pa Balneimonas as B
and Bacteriovorax as Ba Hidrogenymonas as H Flexibacerium as F T= type strain
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
163
Discussion
The estimated time of experimentation (176 days) was considered adequate to the complete
bioremediation of the soil according to previous studies developed at low temperatures (15
ordmC ndash 5 ordmC) in which toxicity was reduced below 20 in 101 days and PAH were removed in
137 days above 60 (Simarro et al under review) However our results confirm that
toxicity evaluation of the samples is necessary to know the real status of the polluted soil
because despite creosote was degraded almost entirely (Figure 4A) at the end of the
experiment toxicity remained constant and high during the process (Figure 3A) Possibly the
low temperatures under which was developed the most of the experiment slowed the
biodegradation rates of creosote and its immediate products which may be the cause of
such toxicity In addtion the most removal of creosote (Figure 4A) and higher respiration
rates (Figure 2) occurred from 40 days when temperature began to increase Hence our
results according to other authors (Margesin et al 2002) show that biodegradation at low
temperatures is possible although with low biodegradation rates due to slowdown on the
diffusion rate PAH bioavailability and metabolisms rates (Haritash amp Kaushik 2009 Leahy amp
Colwell 1990)
As in a previously work (Margesin amp Schinner 2001) no significant differences were
observed between treatments in degradation of creosote The final percentage of creosote
depletion above 60 in all treatments including natural attenuation confirm that indigenous
community of the soil degrade creosote efficiently Concurring with these results high
number of creosote-degradaing microorganisms were enumerated in the natural soil at the
time in which the disturbance occurred There is much controversy over whether
preexposure to a pollutant is required for degradation (Johnsen amp Karlson 2005) or if it is a
characteristic intrinsically present in some species of the microbial community that is
expressed when community is exposed to a pollutant (Tian et al 2008 Spain amp van Veld
1983) According to Tian et al 2008) and similarly as in previuosly work in which a wood
degrading consotium from a free polluted soil degraded PAH efficiently bacterial consortium
from natural soil never preexposed to creosota was able to efficiently degrade the
contaminant
Traditionally is widely tested (Yachi amp Loreau 1999) and accepted that higher
diversity leads to greater protection against disturbances (Vilaacute 1998) because the
functionality is higher Bacterial diversity of the biostimulated treatments (T3 and T5) notably
increased during the biodegradation process and showed (T3) a significantly enhance of the
PAH depletion Hence the higher biodiversity of the biostimulated treatment could contribute
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
164
to the increased of PAH degradation Overall the soil microbial community was significantly
altered in the soil with the addition of creosote is evidenced by the reduction of the size or
diversity of the various population of the treatments precisely in treatments no biostimulated
Long-term exposure (175 days) of the soil community to a constant stress such as creosote
contamination could permanently change the community structure as it observed in DGGEN
AND mds Bioaugmentation (T4 and T5) not resulted in a significant increase of the reduction
of creosote or PAH possibly due to the high adaptability of the indigenous consortium to
degrade PAH The relationship between inoculated and autochthonous consortium largely
condition the results of bioaugmentation Some authors (ie Herwijnen et al2005 Andrenoi
amp Gianfreda 2007) purpose that this technique only has positive effects when indigenous
consortium is no capable to degrade The indigenous microbial community demonstrated
capacity to degrade creosote explains the ineffectiveness of bioaugmentation A study of the
bacterial communities during a bioremediation process is important because such as
demonstrate our results bioremediation techniques cause changes in microbial communities
Most of the DUB identified have been previously related with biodegradation process
of PAH creosote andor diesel 60 of the DUB identified (DUB-12RS to DUB17RS)
belonged to Pseudomonas genus widely studied in bioremediation (ie Ma et al 2006
Molina et al 2009) Our results showed that it was the unique representative group at 145
days and the most representative at 176 days of the biodegradation process However in
this work it has been identified some species of Pseudomonas grouped in P trivialis P poae
and P Viridiflava clades (DUB-13RS DUB-15RS and DUB-14RS respectively) less
commonly described in biodegradation process (ie Bogan et al 2003) α-Proteobacteria
class was composed by DUB-19RS (Uncultured balneimonas) and DUB-20RS (Uncultured
Sphingomonadales bacterium) DUB-18RS belonged to phylum Bacteroidetes previously
identified in degradation of high-molecular-mass organic matter in marine ecosystems in
petroleum degradation process at low temperatures and in PAH degradation during
bioremediation of creoste-contaminated soils (Cotrell amp Kiechman 2000a Brakstad et al
2006 Vintildeas et al 2005) Something important to emphasize is the identification of the
Pantoea brenneri (DUB-21RS Enterobacteriaceae clade) and an uncultured Balneimonas
bacteria (DUB-19RS Metylbacteriaceae Rhizobiales clade) as creosote degrader because
have not been previously described as such However very few reports have indicated the
ability to degrade PAH of some genera of the enteric bacteria group as Enterobacter (Molina
et al 2009) Klebsiella (Grant et al 1967) or Escherichia (Diaz et al 2001)
In conclusion temperature is a very influential factor in ex situ biodegradation process
that control biodegradation rates toxicity reduction availability of contaminant and bacterial
metabolisms and so is an important factor to take into account during bioremediation
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
165
process Biostimulation was the technique which more efficiently removed PAH compared
with natural attenuation In this work bioaugmentation not resulted in an increment of the
creosote depletion probably due to the ability of the indigenous consortium to degrade
Bioremediation techniques produce change in the bacterial communities which is important
to study to evaluate damage in the habitat and restore capability of the ecosystem
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
166
References
Andreoni V amp Gianfreda L 2007 Bioremediation and monitoring of aromatic-polluted
habitats Appl Microbiol Biotechnol 76 287-308
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Baek SH Kim KH Yin CR Jeon CO Im WT Kim KK amp Lee ST 2003 Isolation and
characterization of bacteria capable of degrading phenol and reducing nitrate under
low-oxygen conditions Curr Microbiol 47462-466
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Behrendt U Ulrich A amp Schumann P 2003 Fluorescent pseudomonas associated with the
phyllosphere of grasses Pseudomonas trivialis sp nov Pseudomonas poae sp nov
and Pseudomonas congelans sp nov Int J Syst Evol Microbiol 53 1461ndash1469
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0-5 ordmC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Bodour AA Wang JM Brusseau ML amp Maier RM 2003 Temporal changes in culturable
phenatrhene degraders in response to long-term exposure to phenantrhene in a soil
column system Environ Microbiol 5 888-895
Bogan BW Lahner LMamp Sullivan WR 2003 Degradation of straight-chain aliphatic and
high molecular weight polycyclic aromatic hydrocarbons by a strain of Mycobacterium
austroafricanum J Appl Microbiol 94 230-239
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Pollut Bull 57 695-702
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Austral Ecol 18 117-143
Cotrell MT amp Kirchman DL 2000 Natural assemblages of marine proteobacteria and
members of Cytophaga-Flavobacter cluster consuming low- and high molecular
weight dissolved organic matter Appl Environ Microbiol 66 1692-1697
Couling NR Towel MG Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158
3411-3420
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
167
Diaz E Fernandez A Prieto MA amp Garcia JL 2001 Bioremediation of aromatic
compounds by Eschericlia coli Microbiol Mol Biol Rev 65 523-569
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosm
simulation Marine Environ Res 52 195-211
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grant DJW 1967 Kinetic aspect of the growth of Klebsiella aerogenes with some
benzenoid carbon sources J Gen Microbiol 46 213-224
Hall TA 1999 bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 4195-98
Haritash AK Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJWuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kaplan CW Kitts CK 2004 Bacterial succession in a petroleum land treatment unit Appl
Environ Microbiol 70 1777-1786
Karen M amp Chistoserdov AY 2001 Phylogenetic analysis of the sucession of bacterial
communities in the Great South Bay (Long Island) Microb Ecol 35 85-95
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Klee AJ 1993 A computer program for the determination of the most probable number and
its confidence limits J Microbiol Methods 18 91-98
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Loacutepez Z Vila J Ortega-Calvo JJ amp Grifoll M 2008 Simultaneous biodegradation of
creosote-polycyclic aromatic hydrocarbons by a pyrene-degrading Mycobacterium
Appl Microbiol Biotechnol 78 165-172
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
168
MaY Wang L amp Shao Z 2006 Pseudomonas the dominant polycyclic aromatic
hydrocarbon-degrading bacteria isolated from Antarctic soils and the role of large
plasmids in horizontal gene transfer Environ Microbiol 8 455ndash465
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Methods
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
McConkey BJ Duxbury CL Dixon DG amp Greenberg BM 1997 Toxicity of a PAH
photooxidation product to the bacteria Photobacterium phosphoreum and the
duckweed Lemna gibba Effects of phenanthrene and its primary photoproduct
phenanthrenequinone Environ Toxicol Chem 16 892-899
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill App
Environ Microbiol 65 3566-3574
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2011 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Pollut 217 365-374Surridge
AKJ Wehner FC amp Cloete TE 2009 Bioremediation of polluted soil En Singh A
Kuhad RC Ward OP (eds) Adv Appl Biorem p103-121 Springer Berliacuten
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull 56 1184-1191
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
169
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol Progr Ser 390 55-65
Vilagrave M 1998 Efectos de la diversidad de especies en el funcionamiento de los ecosistemas
Orsis 13 105-117
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-97
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Yachi S amp Loreau M 1999 Biodiversity and ecosystem productivity in a fluctuating
environment The insurance hypothesis Proc Natl Acad Sci USA 96 1463-1468
Yu SH Ke L Wong YS amp Tam NFY 2005a Biodegradation of polycyclic aromatic
hydrocarbons (PAHs) by a consortium enrichment from mangrove sediments Environ
Int 32 149-154
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005b Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
bull Discusioacutengeneral
II
Discusioacuten general
173
Discusioacuten general
Temperatura y otros factores ambientales determinantes en un proceso de
biodegradacioacuten
El resultado final de la aplicacioacuten directa de teacutecnicas de biorremediacioacuten en un medio
contaminado estaacute fuertemente influenciado por los paraacutemetros ambientales Por este motivo
son numerosos los estudios (ej Chaicircneau et al 2005 Cheung amp Kinkle 2005 Leys et al
2005 Chen et al 2008) realizados para optimizar y en la medida de lo posible modificar
tanto los factores bioacuteticos como abioacuteticos Frecuentemente la optimizacioacuten se ha llevado a
cabo considerando exclusivamente un solo factor implicado por ejemplo la temperatura
(Torres et al 2005) la concentracioacuten de nutrientes y la relacioacuten CNP (Leys et al 2005) o
el tipo de nutrientes y los surfactantes adicionados (Cheung amp Kinkle 2005) Pocos son los
estudios en los que se valoran dos o tres factores conjuntamente (Kaumlstner et al 1998
Cheung amp Kinkle 2005) y menos auacuten en los que se combinan maacutes de cuatro paraacutemetros
variables Chen et al (2008) destacoacute la importancia de evaluar en el proceso de
optimizacioacuten tanto los efectos individuales como los derivados de la interaccioacuten entre
factores mediante un meacutetodo factorial completo La optimizacioacuten de un proceso de
biorremediacioacuten previo a la aplicacioacuten in situ es fundamental y un disentildeo ortogonal del
experimento va a permitir ademaacutes considerar los efectos sineacutergicos y antagoacutenicos
derivados de la interaccioacuten entre las variables bioacuteticas y abioacuteticas (Chen et al 2008) Los
resultados obtenidos en los dos trabajos de optimizacioacuten que componen el capiacutetulo 1
demuestran que los factores ambientales significativamente influyentes en la tasa de
biodegradacioacuten (kB) de HAP son diferentes cuando se fijan como constantes todos los
paraacutemetros excepto uno (capiacutetulo 1a) que cuando todos los paraacutemetros se consideran
variables y se combinan en un anaacutelisis ortogonal (capiacutetulo 1b) Sin embargo los resultados
obtenidos de un anaacutelisis factorial no invalidan la optimizacioacuten individual la cual es necesaria
y maacutes adecuada en casos en los que tan soacutelo interesa estudiar la influencia de un
determinado factor en el proceso de biodegradacioacuten En algunos casos determinados
paraacutemetros ambientales fijos e inamovibles (ej bajas temperaturas) dificultan el proceso de
biodegradacioacuten y mediante la optimizacioacuten individual y posterior modificacioacuten de otros
factores del medio (ej nutrientes fuente de carbono) se consigue aumentar la eficacia del
proceso Ademaacutes como resultado de la optimizacioacuten indiviadual de factores realizada en el
capiacutetulo 1a de la presente tesis se obtuvo un medio de crecimiento oacuteptimo (capiacutetulo 1) que
que se usoacute en ensayos y experimentos posteriores (capiacutetulos 3 y 4)
Discusioacuten general
174
Dada la elevada variabilidad de resultados que se pueden obtener en la eficacia de
biodegradacioacuten en funcioacuten de los factores ambientales y sus modificaciones proponemos
que los ensayos de optimizacioacuten del proceso para determinar las condiciones oacuteptimas del
mismo es fundamental para maximizar la eficacia (tiempo y costes) de la aplicacioacuten in situ
De entre todos los factores ambientales limitantes de la biodegradacioacuten de
hidrocarburos del petroacuteleo como son los HAP la temperatura es uno de los que maacutes
condiciona la eficacia del mismo (Chen et al 2008) En la presente tesis los procesos de
biodegradacioacuten realizados a bajas temperaturas (capiacutetulo 3 y 4) con el objetivo de evaluar la
influencia de este factor en la eficacia de degradacioacuten y en la comunidad bacteriana
muestran que la degradacioacuten del contaminante es menor a temperaturas inferiores a 15ordmC
(Margesin et al 2002) La notable ralentizacioacuten de las tasas de crecimiento bacteriano y
degradacioacuten a temperaturas bajas (capiacutetulos 3 y 4) fue debida a la menor solubilidad de los
HAP (Haritash amp Kaushik 2009) y al decrecimiento del metabolismo microbiano (Leahy amp
Colwell 1990) Los estudios centrados en la obtencioacuten de la temperatura oacuteptima durante los
procesos de degradacioacuten de HAP por un consorcio bacteriano (Capiacutetulos 1a 1b y 3) han
determinado que no existe un valor oacuteptimo sino maacutes bien un rango oacuteptimo que oscila entre
los 20ordmC y los 30ordmC Tal y como concreta Chen et al (2008) son las fluctuaciones amplias
de temperatura lo que dificulta el proceso de biodegradacioacuten Cuando el rango de variacioacuten
es estrecho y ademaacutes se encuentra dentro de los valores oacuteptimos la influencia es
significativamente despreciable (capiacutetulo 1b) Sin embargo hay que tener presente que
existen ecosistemas susceptibles de ser contaminados en zonas cuyas condiciones
climaacuteticas son extremas Histoacutericamente grandes desastres ecoloacutegicos se han producido en
aacutereas cuyas temperaturas medias estaacuten muy por debajo del rango oacuteptimo como es el caso
del petrolero Exxon Vadez en Alaska (Bence et al 1996) o el Prestige en Espantildea (Soriano
et al 2006) A pesar de la evidente importancia de este aspecto poco se sabe sin embargo
de la degradacioacuten de HAP a temperaturas friacuteas comprendidas entre los 5 ordmC-15 ordmC la cual
es posible gracias a la presencia de especies psicrotolerantes y psicroacutefilas (ldquocold-adaptedrdquo)
(Margesin amp Schinner 2001) Alguna de estas especies que han adquirido o que poseen
intriacutensecamente la capacidad para degradar hidrocarburos pertenecen a los geacuteneros
Pseudomonas Acinetobacter o Pshycrobacter (Eriksson et al 2003 Margesin et al 2003)
La identificacioacuten de estos geacuteneros en los consorcios bacterianos (C2PL05 y BOS08)
posiblemente ha sido determinante en los procesos de biodegradacioacuten a bajas temperaturas
(capiacutetulos 3 y 4) ya que aunque con menores tasas que a temperaturas altas la
biodegradacioacuten ha sido posible Estas especies son claves para el mantenimiento de dicha
comunidad ya que su actividad metaboacutelica durante periodos de bajas temperaturas o en
ambientes permanentemente friacuteos permite la mineralizacioacuten de los hidrocarburos y
subsecuente formacioacuten de otros compuestos maacutes sencillos y faacuteciles de degradar por el resto
Discusioacuten general
175
de las especies del consorcio o la comunidad (Pelz et al 1999) La utilizacioacuten de consorcios
bacterianos adaptados a climas friacuteos compuestos por especies con capacidad degradadora
puede ser una medida de actuacioacuten fundamental en aacutereas extremas Ademaacutes a partir de
estas cepas psicrotolerantes y psicroacutefilas se estaacuten aislando enzimas oxidativas capaces de
trabajar a bajas temperaturas con un importante potencial en procesos biotecnoloacutegicos
(Cavicchioli et al 2002)
Consorcios bacterianos durante un proceso de biodegradacioacuten factores que
determinan la sucesioacuten de especies
La sucesioacuten de especies en un consorcio durante un proceso de biodegradacioacuten depende
en gran medida de ciertas caracteriacutesticas celulares y metaboacutelicas de las especies que lo
componen sobre todo cuando la fuente de carbono son HAP de alto peso molecular
(Mueller et al 1997) Por ejemplo algunas especies de Pseudomonas (P aeruginosa
Soberon-Chavez et al 2005) tienen la capacidad de producir biosurfactantes para aumentar
la biodisponibilidad de HAP o bien como es el caso de las Gram-positivas la presencia de
una uacutenica membrana permite un transporte maacutes eficaz de los HAP al interior de la ceacutelula
(Mueller et al 1997) En la mayoriacutea de los casos las sustancias que se presentan como
recalcitrantes para una especie individual pueden metabolizarse a traveacutes de secuencias
cataboacutelicas complementarias que presentan las diferentes especies de un consorcio
(Fritsche 1985) De ahiacute que con los consorcios microbianos se puedan obtener tasas de
degradacioacuten mucho maacutes elevadas que con cepas individuales (Bautista et al 2009) Sin
embargo la estabilidad y eficacia de un consorcio bacteriano estaacuten determinadas por las
relaciones de supervivencia entre las especies que lo componen Un caso en el que las
asociaciones bacterianas son fundamentales son los procesos de biorremediacioacuten a bajas
temperaturas ya que tal y como Leahy amp Cowell (1990) exponen los consorcios bacterianos
cuentan con una capacidad enzimaacutetica maacutes amplia que especies aisladas y por tanto
mayor versatilidad y superioridad de supervivencia
Una modificacioacuten sobre el consorcio como es la dilucioacuten del mismo (capiacutetulo 1b)
puede afectar a las tasas de degradacioacuten finales precisamente porque modifican las
relaciones inicialmente establecidas entre las especies Igualmente este paraacutemetro puede
modificar el patroacuten de crecimiento sin que esto suponga un cambio significativo en la tasa de
degradacioacuten (capiacutetulo 1b) hecho que dependeraacute de la capacidad degradadora de la especie
favorecida (Szaboacute et al 2007) Por tanto la concentracioacuten del inoacuteculo introducido en un
medio contaminado puede condicionar la eficacia del proceso
Discusioacuten general
176
En los diferentes experimentos que componen los capiacutetulos de este proyecto doctoral
no se han realizado pruebas fisioloacutegicas para estudiar las rutas metaboacutelicas o la importancia
relativa del cometabolismo que condicionen la sucesioacuten o composicioacuten de especies de una
comunidad Sin embargo los anaacutelisis de la comunidad bacteriana a traveacutes de la
identificacioacuten de especies cultivables (capiacutetulos 2 y 3) y no cultivables (capiacutetulos 2 3 y 4)
mediante teacutecnicas moleculares indican que la comunidad bacteriana cambia y por tanto
existe una sucesioacuten y coexistencia determinada de especies en el tiempo Los resultados
obtenidos en el capiacutetulo 2 indican que las especies del consorcio cambian en funcioacuten de la
fuente de carbono disponible (HAP y subproductos de degradacioacuten de HAP) y la presencia
de determinados surfactantes (Tween-80 y HAP o solo HAP) por lo que eacutestos pueden ser
factores que intervienen en la sucesioacuten de especies en un consorcio En muchos procesos
de biodegradacioacuten es comuacuten la adicioacuten de ciertas fuentes de carbono para aumentar la
biomasa de los consorcios bacterianos o cepas concretas y acelerar por tanto el proceso de
biodegradacioacuten (Chen amp Aitken 1999 Lee et al 2003) Sin embargo dada la mencionada
influencia de la fuente de carbono sobre la composicioacuten de especies el resultado de esta
medida puede ser negativo en consorcios bacterianos en los que coexistan especies
degradadoras de una determinada fuente de carbono (ej HAP) con otras que no lo son
(capiacutetulo 1a y 1b) Este hecho es debido a que la adaptacioacuten a la nueva fuente de carbono
de los microorganismos degradadores de HAP se traduce en un aumento de la fase de
latencia y por tanto en un retraso de la tasa de degradacioacuten (Maier et al 2009) Este
fenoacutemeno se pudo observar con claridad cuando se suministroacute al consorcio degradador
C2PL05 glucosa como uacutenica fuente de carbono o en combinacioacuten con HAP (capiacutetulos 1a y
1b)
Nuevas especies bacterianas degradadoras de HAP
La identificacioacuten de especies en los numerosos trabajos de biodegradacioacuten realizados hasta
el momento verifican la existencia de una importante variedad de bacterias degradadoras
de HAP Sin embargo esto no implica que no haya taxa particularmente bien adaptados a
medios contaminados (Mueller et al 1997) y que frecuentemente esteacuten involucrados en
procesos de biodegradacioacuten Este es el caso de geacuteneros como Pseudomonas
Acinetobacter Sphingomonas y Stenothrophomonas identificados durante los ensayos que
componen los capiacutetulos 2 3 y 4 Ademaacutes de la identificacioacuten de especies pertenecientes a
estos geacuteneros ampliamente descritos en procesos de biodegradacioacuten (ej Pseudomonas
Sphingomonas Sphingobium Ralstonia Flexibacter Rhodococcus y Bacillus) cabe
destacar la importancia del aislamiento e identificacioacuten de secuencias englobadas en nuevos
geacuteneros degradadores ineacuteditos hasta el momento o cuya implicacioacuten en estos procesos es
Discusioacuten general
177
escasa Este es el caso de Enterobacter cloacae y E ludwigii (γ-Proteobacterias)
identificadas en el consorcio C2PL05 como degradadoras de HAP de bajo peso molecular
Incluso en un estudio previo (Bautista et al 2009) se ha determinado que la eficacia
degradadora de este geacutenero es mucho maacutes eficaz que otras especies degradadoras
frecuentemente descritas como Pseudomonas fluorescens o Stenotrophomonas maltophilia
Pantoea aglomerans (γ-Proteobacterias) es otra Enterobacteriaceae identificada por primera
vez como degradadora de (capiacutetulo 4) En escasas ocasiones (Toledo et al 2006) una
especie de la familia Enterobacteraceae ha sido identificada como degradadora de HAP o
de crudo (Zhang et al 2010) Asiacute mismo es la primera vez que bacterias Gram-positivas
pertenecientes a los geacuteneros Balneimonas sp (capiacutetulo 4) Bradyrhizobium sp y
Nitrobacteria sp (capiacutetulo 2) todas α-Proteobacterias y por otro lado el geacutenero
Microbacterium sp (Phylum Actinobacterias Capiacutetulo 3) se relacionan con procesos de
biodegradacioacuten de HAP y en procesos de mineralizacioacuten de sustancias recalcitrantes La
presencia de estos organismos debe quedar justificada por su capacidad degradadora dado
que han sido identificadas a partir de bandas de gran intensidad en DGGE teacutecnica que se
ha realizado con muestras procedentes de ensayos de biodegradacioacuten de HAP y creosota
(capiacutetulos 2 3 y 4) Es decir su mera presencia en el consorcio no parece justificable por
causas aleatorias sino maacutes bien por su implicacioacuten directa en los procesos metaboacutelicos
asociados a la degradacioacuten Por ejemplo el aislamiento e identificacioacuten en el capiacutetulo 2 de
especies del geacutenero Nitrobacteria podriacutea estar relacionada con la reduccioacuten de nitritos
presentes en el medio contaminado (capiacutetulo 2 Gonzaacutelez et al 2010)
Los resultados de identificacioacuten mediante teacutecnicas moleculares muestran la evidente
variedad de geacuteneros implicados en estos procesos La variabilidad observada fue mucho
menos intensa con las teacutecnicas moleculares dependientes de cultivo (capiacutetulo 2) ya que tan
solo entre un 1 y un 10 del total de bacterias del suelo son cultivables (Nannipieri et al
2003) Algunos autores (Menn et al 1993 Okpokwasili et al 1986) proponen que los genes
cataboacutelicos para la degradacioacuten de HAP probablemente se transmitan horizontalmente
mediante plaacutesmidos entre bacterias pertenecientes a grupos taxonoacutemicos muy diferentes
Mueller et al (1997) afirman que no es probable encontrar una clara relacioacuten entre grupos
taxonoacutemicos de bacterias y la produccioacuten de enzimas implicadas en la degradacioacuten de
hidrocarburos aromaacuteticos Por tanto no es extrantildeo que genes homoacutelogos (en este caso
degradativos) se expresen en bacterias que taxonoacutemicamente estaacuten muy poco relacionadas
(capiacutetulos 2 3 y 4) otorgando una alta variabilidad al conjunto de bacterias con capacidad
degradadora
Discusioacuten general
178
Preexposicioacuten a los HAP iquestes necesaria para una biodegradacioacuten eficaz HAP
Tradicionalmente algunos autores han sugerido que la preexposicioacuten de bacterias a un
determinado contaminante es necesaria para la adaptacioacuten y consecuente degradacioacuten
(Spain amp van Veld 1983) o para un aumento en la tasa del proceso (Haritash amp Kaushik
2009) Sin embargo autores como Johnsen amp Karlson (2005) se plantean si eacutesta es una
capacidad presente en las comunidades microbianas independientemente de su previa
exposicioacuten o si es una capacidad inducida por la exposicioacuten a elevados niveles de
contaminante Los procesos de biodegradacioacuten realizados con consorcios bacterianos
procedentes de zonas libres de contaminacioacuten por HAP (capiacutetulos 3 y 4) indican que eacutesta
es una capacidad intriacutenseca en las bacterias e independiente de la previa exposicioacuten y que
se manifiesta ante un periodo de contaminacioacuten Los geacuteneros identificados en el capiacutetulo 3
(Ralstonia Pseudomonas o Bacillus) son propios de sistemas con un alto contenido en
madera en descomposicioacuten en los que contribuyen a la degradacioacuten de lignocelulosa
celulosa y sus subproductos mediante enzimas oxidativas (Rastogi et al 2009) Las
enzimas lignoliacuteticas de los hongos saproacutefitos degradan compuestos con estructuras
quiacutemicas similares a la lignina como son los HAP (Hatakka 1994 2001 Barr amp Aust 1994
Meulenberg et al 1997) Por tanto las especies bacterianas con la bateriacutea enzimaacutetica para
degradar subproductos de lignina y celulosa pueden tambieacuten adaptarse y metabolizar HAP
(Tian et al 2008 Couling et al 2010) La capacidad degradadora de este tipo de
compuestos no solo se transmite de manera vertical sino que la transferencia horizontal de
genes puede ser tambien un factor determinante para la adquisicioacuten de esta capacidad entre
los microorganismos del consorcio o comunidad
Los resultados referentes a la alta capacidad degradativa que muestra el consorcio
BOS08 procedente de una zona limpia (capiacutetulo 3) gozan de una extraordinaria importancia
a nivel aplicado y ecoloacutegico La mayoriacutea de los trabajos que estudian el posible paralelismo
entre la degradacioacuten de lignina y la de compuestos aromaacuteticos se han llevado a cabo con
hongos maderables de la llamada ldquopodredumbre blancardquo El hecho de que un consorcio
bacteriano no adaptado a la degradacioacuten de HAP sea capaz de metabolizar eficazmente
HAP de alto peso molecular y ademaacutes disminuya la toxicidad del medio por debajo del
umbral de la toxicidad incluso a bajas temperaturas sin duda abre un campo de
investigacioacuten muy amplio dentro de la biorremediacioacuten Ecofisioloacutegicamente hablando
resultan tambieacuten de gran intereacutes estas espcies que han sido capaces de readaptar su
bateriacutea enzimaacutetica para metabolizar una fuente de carbono altamente recalcitrante y toacutexica
que no estaba presente en su medio natural
Discusioacuten general
179
Posibles actuaciones en un medio contaminado
Ante un caso de contaminacioacuten de un medio con HAP o sustancias que los contengan la
biorremediacioacuten resulta una de las teacutecnicas maacutes eficaces y respetuosas con el medio La
atenuacioacuten natural del contaminante por los microorganismos presentes en el propio medio
depende seguacuten Frosyth et al (1995) del tamantildeo de la poblacioacuten degradadora autoacutectona No
obstante los resultados obtenidos durante el proceso de biorremediacioacuten de un suelo
contaminado con creosota (capiacutetulo 4) indican que los resultados que puede ofrecer la
atenuacioacuten natural no dependen uacutenicamente del nuacutemero inicial de microorganismos
degradadores Las pruebas realizadas indicaron en el momento que se produjo la
contaminacioacuten la actividad degradadora era nula aunque tras un corto peridodo de
exposicioacuten al mismo comenzoacute la actividad de los microorganismos degradadores Esto
quiere decir que aunque en un primer momento la poblacioacuten degradadora sea miacutenima la
presencia del contaminante favorece su dominancia y hace patente su capacidad
degradadora Ademaacutes hay que tener en cuenta varias de las cuestiones abordadas en
apartados previos como son la rapidez y facilidad que tienen los microorganismos para
transferir esta capacidad incluso entre diferentes taxas (Menn et al 1993) o la alta
adaptabilidad a una nueva fuente de carbono Sin embargo la atenuacioacuten natural es una
teacutecnica muy ventajosa porque evita dantildeos en la comunidad bacteriana del medio a
diferencia de cualquier otra actuacioacuten que en menor o mayor medida modifican las
condiciones originales del ecosistema
Uno de los principales problemas de la biorremediacioacuten es el tiempo necesario para
la completa eliminacioacuten del contaminante del medio para lo cual se han desarrollado
estrategias de actuacioacuten con el uacutenico objetivo de acelerar y mejorar la eficacia del proceso
La bioestimulacioacuten tiene como principal objetivo potenciar la capacidad degradadora de los
microorganismos degradadores autoacutectonos mediante la adicioacuten de nutrientes inorgaacutenicos al
medio contaminado Sin embargo los resultados referentes a esta teacutecnica no son
concluyentes dada la elevada variabilidad de los mismo Los casos en los que la
bioestimulacioacuten favorece el proceso de biodegradacioacuten estaacuten estrechamente relacionados
con el impedimento de que los nutrientes se conviertan en un factor limitante para los
microorganismos ya que tal y como expone Leys et al (2005) los requerimientos de
nitroacutegeno y foacutesforo aumentan notablemente durante un episodio de contaminacioacuten Sin
embargo son numerosos los estudios que han obtenido resultados desfavorables con esta
teacutecnica debido a cuestiones relacionadas con altos iacutendices de salinidad (Braddock et al
1997) o tal y como se observa en el capiacutetulo 4 con los cambios que la bioestimulacioacuten
genera en la comunidad bacteriana que en muchos casos inducen a relaciones negativas
entre las especies de la comunidad debido a la competencia por los nutrientes (Rolling-
Discusioacuten general
180
Willfred et al 2002) Por otra parte la bioestimulacioacuten durante el proceso de
biorremediacioacuten del suelo contaminado con creosota (capiacutetulo 4) no favorecioacute
significativamente la biodegradacioacuten del contaminante Estos resultados se pueden atribuir a
una concentracioacuten de nutrientes suficientes en el medio o bien a la raacutepida y efectiva
capacidad degradativa de creosota que mostraron los microorganismos autoacutectonos
El bioaumento es una teacutecnica que pretende incrementar la eficacia del proceso de
biorremediacioacuten mediante el inoacuteculo a la poblacioacuten autoacutectona de una poblacioacuten
degradadora previamente definida como tal Sin embargo es un tratamiento complejo cuyos
resultados dependen de algo tan desconocido y variable como son las relaciones entre
especies y comunidades (Yu et al 2005) Por ello no hay gran nuacutemero de artiacuteculos en los
que se describan resultados favorables de esta teacutecnica pero podemos resumir que las
consecuencias del bioaumento dependen fundamentalmente de dos cuestiones Una de
ellas es que las relaciones de competencia que se establecen entre la comunidad
introducida y autoacutectona sean negativas para la poblacioacuten degradadora (Vintildeas et al 2005
Yu et al 2005) relaciones que principalmente estaacuten dirigidas por la competicioacuten por los
recursos (Yu et al 2005) La inexistencia de efectos significativos del bioaumento durante el
proceso de bodegradacioacuten de creosota (capiacutetulo 4) al igual que los descritos por Herwignen
et al (2005) indican que la presencia de una comunidad bacteriana autoacutectona con
capacidad degradadora o que se adapta raacutepidamente como es nuestro caso puede ser otra
de las cuestiones que hagan que el bioaumento no favorezca el proceso
Los ensayos de biorremediacioacuten realizados durante la presente tesis y los
consultados en las diferentes referencias bibliograficas nos llevan a concluir una vez maacutes
que los efectos de las diferentes teacutecnicas de biorremediacioacuten dependen de las condiciones
del medio contaminado y de la poblacioacuten bacteriana que alberga Por ello un estudio previo
que indique las caracteriacutesticas bioacuteticas (capacidad degradadora composicioacuten y evolucioacuten de
la comunidad bacteriana) y abioacuteticas (temperatura ambiente y caracteriacutesticas fisico-quiacutemicas
del suelo) del mismo asiacute como un breve ensayo a escala de laboratorio donde se apliquen
las diferentes teacutecnicas y seleccionando las maacutes adecuadas mejora en gran medida la
efectividad de la biorremediacioacuten in situ
Conclusiones generales
III
Conclusiones generales
183
Conclusiones generales
De los trabajos llevados a cabo en esta tesis doctoral se pueden extraer las siguientes
conclusiones generales
1 La optimizacioacuten de los factores abioacuteticos y bioacuteticos hace que el proceso de
biodegradacioacuten sea maacutes eficaz y permite modificarlo mediante estrategias de
biorremediacioacuten
2 Los factores que realmente influyen significativamente en un proceso se observan
mediante un estudio ortogonal de los mismos porque permite evaluar las
interacciones entre los factores seleccionados
3 No todos los ambientales son limitantes para la degradacioacuten de HAP Po ejemplo la
bioestimulacioacuten con nutrientes inorgaacutenicos no es efectiva en casos en los que la
cantidad de nutrientes en el medio es suficiente La adicioacuten de glucosa como fuente
adicional de carbono no es necesaria cuando el consorcio esta adaptado a los HAP
como fuente de carbono
4 Las actuaciones basadas en la adicioacuten de fuentes de carbono adicionales a los HAP
no son efectivas cuando los consorcios o cepas bacterianas estaacuten adaptadas a los
HAP porque esto supone un periodo de readaptacioacuten
5 La fuente de carbono disponible en cada momento durante un proceso de
biodegradacioacuten de HAP y otras sustancias en el medio como los surfactantes
condicionan la presencia de especies y por tanto la sucesioacuten de las mismas
6 La aparicioacuten de nuevas especies previamente no descritas como degradadoras
puede estar relacionada con la transferencia horizontal de genes degradativos que
en muchos casos ocurre entre grupos taxonoacutemicos poco relacionados lo que
ampliariacutea auacuten maacutes la expresioacuten de la capacidad degradativa en la comunidad
7 La identificacioacuten en un consorcio procedente de una zona limpia y rica en materia
orgaacutenica de especies fundamentales en sistemas de degradacioacuten de madera
sugiere que las enzimas oxidativas usadas por estas especies en la degradacioacuten de
subproductos de lignina y celulosa se emplean en la degradacioacuten de HAP Por tanto
Conclusiones generales
184
la previa exposicioacuten de los consorcios bacterianos o cepas individuales a un
contaminante no es necesaria cuando tienen una bateriacutea enzimaacutetica que se puede
adaptar y metabolizar el contaminante
8 El papel de las especies bacterianas adaptadas a la degradacioacuten de HAP en
ambientes friacuteos (Tordf lt 15ordmC) es fundamental para la biorremediacioacuten en climas
extremos Ademaacutes la actividad de estas especies en periodos de bajas temperaturas
permite el crecimiento de otras especies de la comunidad bacteriana a partir de los
subproductos de degradacioacuten
9 El bioaumento es una teacutecnica cuyos resultados estaacuten ampliamente influenciados por
las relaciones que se establecen entre la comunidad autoacutectona e introducida y soacutelo
se recomienda en aquellos casos en los que la comunidad autoacutectona no tenga
microorganismos degradadores o no sean capaces de desarrollar esta capacidad
Referencias bibliograacuteficas
IV
Referencias bibliograacuteficas
187
Referencias bibliograacuteficas
Aislabie J Foght J amp Saul D 2000 Aromatic hydrocarbon-degrading bacteria from soil near
Scott Base Antarctica Polar Biol 23 183-188
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Baek KH Yoon BD Kim BH Cho DH Lee IS Oh HM amp Kim HS 2007 Monitoring of
microbial diversity and activity during bioremediation of crude oil-contaminated soil
with different treatments J Microbiol Biotechnol 17 67-73
Barkay T amp Pritchart H 1988 Adaptation of aquatic microbial communities to pollutant
stress Microbiol Sci 5165-169
Barr DP amp Aust SD 1994 Mechanisms with rot fungi use to degrade pollutants Environ
Sci Technol 28 78A-87A
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Braddock JF Ruth ML Catterall PH Walworth JL amp McCarthynd KA 1997
Enhancement and inhibition of microbial activity in hydrocarbon contaminated arctic
soil implication for nutrients amended bioremediation Environ Sci Technol 31
2078-2084
Cavicchioli R Siddiqui KS Andrews D amp Sower KR 2002 Low temperature
extremophiles and their applications Curr Opin Biotechnol 13 253-261
Cerniglia1984 Microbial metabolism of polycyclic aromatic hydrocarbons Adv Appl
Microbiol 30 31-71
Cerniglia 1992 Biodegradation of polycyclic aromatic hydrocarbons Biodegradation 2-3
351-368
Referencias bibliograacuteficas
188
Chaicircneau CH Morel J Dupont J Bury E amp Oudot J 1999 Comparison of the fuel oil
biodegradation potential of hydrocarbon assimilating microorganisms isolated from a
temperate agricultural soil Sci Total Environ 227 237-247
Chaicircneau CH Rogeus G Yeacutepreacutemian C amp Outdot J 2005 Effects of nutrients
concentration on the biodegradation of crude oil and associated microbial
populations in the soil Soil Biol Biochem 37 1490-1497
Chauhan A Fazlurrahman Oakeshott JG amp Jain RK 2008 Bacterial metabolisms of
polycyclic aromatic hydrocarbons strategies for remediation Indian J Microbiol
4895-113
Chen S-H amp Aitken MD 1999Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
Environ Sci Technol 33 435ndash439
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of polycyclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Cheung P-Y amp Kinkle BK 2005 Effect of nutrients and surfactant on pyrene mineralization
and Mycobacterium spp populations in contaminated soil Soil Biol Biochem 37
1401-1405
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Clements WH Oris JT amp Wissin TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Leponis macrochirus
Arch Environ Contam Toxicol 26261-266
Colwell RR Mills AL Walker JD Garcia Tello P amp Campos V 1978 Microbial ecological
studies at the Metula spill in the Strait of Magellan J Fish Res Board Can 35573-
580
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Poll 158 3411-
3420
Das K amp Mukherjee AK 2006 Crude petroleum-oil biodegradation efficiency of Bacillus
subtillis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India Bioresour Technol 98 1339-1345
Delille D amp Pelletier E 2002 Natural attenuation of diesel-oil contamination in a subantartic
soil (Crozet island) Polar Biol 25 682-687
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge App Environ Mirobiol 37 729-739
Referencias bibliograacuteficas
189
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosms
simulation Marine Environ Res 52 195-211
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in artic tundra soil Appl Environ Microbiol 67 5107-
5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap
Evolution 39 783-791
Fiechter A 1992 Biosurfactants moving towards industrial application Trends Biotechnol
10 208-217
Fritsche JD 1985 Nature and significance of microbial cometabolism of xenobiotics J
Basic Bacteriol 25 603-619
Forsyth JV Tsao YM amp Bleam RD 1995 Biorremediation when is augmentation needed
In Hinchee RE Fredrickson J amp Alleman BC (Eds) Bioaugmentation for site
remediation Battelle Press Columbus pp 1-14
Ghazali FM Rahman RNZA Salleh AB amp Basr M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grimberg SJ Stringfellow WT amp Aitken MD 1996 Quantifying the biodegradation of
phenanthrene by Pseudomonas stutzeri P16 in the presence of a nonionic surfactant
Appl Environ Microbiol 62 2387-2392
Habe H amp Omori T 2003 Gentics of polycyclic aromatic hydrocarbon metabolisms in
diverse aerobic bacteria Biosci Biotechnol Biochem 67 225-243
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of polycyclic aromatic
hydrocarbons (PAHs) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microbial Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M amp Steinbuchel A (eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJ Wuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
Referencias bibliograacuteficas
190
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Internacional Agency for Research on Cancer 1972-1990 Monographs on the evaluation of
carcinogenics risks on human International Agency for Research on Cancer Lyons
France
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Johnsen AR Wick LY amp Harms H 2005 Principles of microbial PAH-degradation in soil
Environ Pollut 133 71-84
Johnsen AR Lipthay JR Sorensen SJ Ekelund F Christensen P Andersen O
Karlson U amp Jcobsen CS 2006 Microbial degradation of street dust polycyclic
aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil
Environ Microbiol 8535-545
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kanaly RA amp Harayama S 2000 Biodegradation of high molecular weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059-2067
Kaumlstner M Breueer-Jammali M amp Mahro B 1998 Impact of inoculation protocols salinity
and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil Appl Environ Microbiol 64 359-362
Kim Y H Freeman J P Moody J D Engesse K H amp Cerniglia C E 2005 Effects of pH
on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii
PYR-1 Appl Environ Microbiol 67 275ndash285
Koeber R Bayona JM amp Niessner R 1999 Determination of benzene[a]pyrene diones in
air particulates matter with liquid chromatography mass spectrometry Environ Sci
Technol 33 1552-1558
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Lee ML Novotny MV amp Bartle KD 1981 Analytical chemistry of polycyclic aromatic
hydrocarbons Academic Press Inc New York NY
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegrdation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Referencias bibliograacuteficas
191
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation by
Mycobacterium and Sphingomonas in soil Appl Microbiol Biotechnol 66 726-736
Lim LH Harrison RM amp Harrad S 1999 The contribution of traffic to atmospheric
concentration of polycyclic aromatic hydrocarbons Environ Sci Technol 33 3538-
3542
Liu Y Zhu L amp Shen X 2001 Polycyclic aromatic hydrocarbons in indoor and outdoor air of
Hangzhou China Environ Sci Technol 35 840-844
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Maliszewska-Kordybach B 1996 Polycyclic aromatic hydrocarbons in agricultural soils in
Poland preliminary proposals for criteria to evaluate the level of soil contamination
Appl Geochem 11 212-127
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts
Extremophiles 7451ndash458
Martiacuten Guirao L 2007 Aproximacioacuten ecotoxicoloacutegica a la contaminacioacuten por metales
pesados en la laguna costera del Mar Menor Tesis doctoral Universidad de Murcia
Murcia
Menn F-M Applegate BM amp Sayler GS 1993 NAH-plasmid mediated catabolisms of
anthracene and phenanthrene to naphtoic acids Appl Environ Microbiol 59 1938-
1942
Meulenberg R Rijnaarts HHM Doddema HJ amp Field A 1997 Partially oxidized polycyclic
aromatic hydrocarbons show an increased bioavailability and biodegradability FEMS
Microbiol 152 45-49
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Referencias bibliograacuteficas
192
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mueller JG Chapman PJ Blattman BO amp Pritchard PH 1990 Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis Appl
Environ Microbiol 56 1079-1086
Mueller JG Devereux R Santavy DL Lantz SE Willis SG amp Pritchard PH 1997
Phylogenetic and Physiological comparisions of PAH-degrading bacteria from
geographically diverse soils A van Leeuw J Microb 71 329-343
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions European J Soil Sci 54 655-670
Okpokwasili GC Somerville CC Grimes DJ amp Colwell RR 1986 Plasmid-associated
phenanthrene degradation by Chesapeake Bay sediment bacteria A Colloq Inst
Fran Rech Exploit Mer 3 601ndash610
Pelz O Tesar M Wittich RM Moore ERB Timmis KN Abraham WR 1999 Towards
elucidation of microbial community metabolic pathways unrevealing the network of
carbon sharing in a pollutant-degrading bacterial consortium by immunocapture and
isotopic ratio mass spectrometry Environ Microbiol 1167ndash174
Portaels F amp Pattyn SR 1982 Growth of mycobacteria in relation to the pH of the medium
Ann Microbiol 133 213-221
Puntus IF Filonov AE Akhmetov LI Karpov AV amp Boronin AM 2008 Phenanthrene
degradation by bacteria of the genera Pseudomonas and Burkholderia in model soil
systems Microbiology 77 7-15
Rastogi G Muppidi GL Gurram RN Adhikari A Bischoff KM Hughes SR Apel WA
Bang SS Dixon DJ amp Sani RK 2009 Isolation and characterization of cellulose-
degrading bacteria from the deep subsurface of the Homestake gold mine Lead
South Dakota USA J Ind Microbiol Biotechnol 36 585-598
Readman J W Fillmann G Tolosa I Bartocci J Villeneuve J -P Catinni C amp Mee L D
2002 Petroleum and PAH contamination of the Black Sea Marine Pollut Bull 44
48-62
Rolling Willfred FM Milner MG Jones DM Lee K Danniel F Swanell Richard JP amp
Head IM 2002 Robust hydrocarbons degradation and dynamics of bacterial
communities during nutrients-enhanced oil spill bioremediation Appl Environ
Microbiol 68 5537-5548
Rosenberg E amp Ron EZ 1999 High ndash and low- molecular mass microbial surfactant Appl
Microiol Biotechnol 52 154-162
Referencias bibliograacuteficas
193
Santos E C Jacques R J S Bento F M Peralba M-C R Selbach PA Saacute E L S
Camargo FAO 2008 Anthracene biodegradation and surface activity by an iron-
stimulated Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Shuttleworth KL amp Cerniglia E 1995 Environmental aspect of PAH biodegradation Appl
Biochem Biotechnol 54 291-302
Soberon-Chavez G Lepine F amp Deziel E 2005 Production of rhamnolipids by
Pseudomonas aeruginosa Appl Microbiol Biotechnol 68 718-725
Soriano JA Vintildeas MA Franco JJ Gonzaacutelez JM amp Albaigeacutes J 2006 Spatial and
temporal trends of petroleum hydrocarbons in wild mussels from the Galician coast
(NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquat Microb Ecol 47 1-10
Tian L Ma P amp Zhong J-J 2003 Impact of presence of salicylate or glucose on enzyme
activity and phenanthrene degradation by Pseudomonas mendocina Process
Biochem 38 1125-1132
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull56 1184-1191
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons
removal capacities Syst Appl Microbiol 29 244-252
Torres LG Rojas N Bautista G amp Iturbe R 2005 Effect of temperature and surfactantacutes
HLB and dose over the TPH-diesel biodegradation process in aged soils Process
Biochem 40 3296-3302
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated Soil App Environ Microbiol 71 7008-7018
Wagrowski DM amp Hites RA 1997 Polycyclic aromatic hydrocarbons accumulation in urban
suburban and rural vegetation Environ Sci Technol 31 279-282
Referencias bibliograacuteficas
194
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacilus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Pollut 139 1-13
Wu SC amp Gschwend PM 1986 Sorption kinetics of hydrophobic organic compounds to
natural sediments and soil Environ Sci Technol 20 717-725
Ye B Siddigi MA Maccubbin AE Kumar S amp Sikka HC 1996 Degradation of
polynuclear aromatic hydrocarbons by Sphyngomonas paucimobilis Environ Sci
Technol 30136-142
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005 Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
Zender M 1983 Physical and chemical properties of polycyclic aromatic hydrocarbons p 1-
26 In ABjorseth (ed) Handbook of polycyclic aromatic hydrocarbons Marcel
Dekker Inc New York NY
Zhang XX Cheng SP Zhu CJ amp Sun SL 2006 Microbial PAH-degradation in soil
degradation pathways and contributing factors Pedosphere 16 555-565
Zhang Z Gai L Hou Z Yang C Ma C Wang Z Sun B He X Tang H amp Xu P 2010
Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils Bioresource Technol 101 8452ndash8456
Agradecimientos
197
Agradecimientos
Todaviacutea recuerdo el primer diacutea que entre en el departamento en el laboratorio
aquello me parecioacute todo un mundo en el cual sin quererlo y sin estar convencida de
ello acabeacute metida de lleno Poco a poco fueron pasando los meses los antildeos
presenteacute el Practicum y me diacute cuenta de que queriacutea seguir adelante Unos cuantos
antildeos despueacutes he llegado a la meta lo cual no hubiera sido posible sin mucha gente
que me ha apoyado ayudado y empujado en los momentos en los que yo no podiacutea
maacutes A todos ellos gracias por hacer que esto haya sido posible
El primero de mis agradecimientos va dirigido a Natalia Fernando y Mari
Carmen Os tengo que dar las gracias por brindarme la oportunidad de formar parte
del grupo y por tantas cosas que con cada uno de vosotros he aprendido Despueacutes
de estos antildeos creo que hemos conseguido cosas maravillosas aunque hayamos
tenido imprevistos de todo tipo porque como ya sabemos si ponemos un circo nos
crecen los enanoshellippero aquiacute estamos Somos un grupo muy equilibrado
profesionalmente tenemos un poco de todo y por otro lado no es mal balance tres
histeacutericas frente a uno que pone la calma no se como no hemos acabado contigo
Fernando Natalia gracias por hacerme controlar el miura que llevo dentro y tener
tanta paciencia Carmen gracias por estar siempre ahiacute ya sea desde Espantildea desde
el otro lado del charco o nada mas ser mamaacute En todo momento a nivel personal y
profesional me he sentido arropada por vosotros gracias por vuestro apoyo y ganas
de seguir adelante Vosotros habeis sido los responsables de que quiera investigar
Si una persona en concreto se merece especial agradecimiento es mi Yoli
Aunque al principio de todo no nos conociacuteamos no hay mas que vernos ahora Por
un lado ha sido imprescindible la ayuda que me has dado trabajando cuando maacutes
perdida estaba Por todo tu apoyo ten presnete que me has ayudado a escribir cada
una de las liacuteneas que has leiacutedo Has sabido ser mi amiga y estar conmigo cuando
maacutes lo he necesitado y hacer que me olvidara de todo ya sea haciendo toriijas
pizzas viendo una peli tomando una copichuela o con nuestros preciados pinchitos
sobre todo estos uacuteltimos meses estresantes en los que no seacute como no te he vuelto
loca Gracias tambieacuten por hacerme reir hasta llorar por preocuparte cada diacutea de
198
estas uacuteltimas semanas de coacutemo voy por conocerte todas y cada una de las cosas
en las que estoy trabajando y un largo etc Te conoces mejor yo el estado de cada
uno de mis artiacuteculos las correcciones que tengo y las que me faltan Eres estupenda
y espero no dejar de descubrir nunca cosas sobre ti Mil gracias
Son muchas las personas que han pasado por el despacho Pepe aunque
estas muy muy lejos agardezco tu ayuda continua sobre todo en el Maacutester la mitad
de las cosas se me hubieran olvidado si no hubiera sido por ti que cabeza la miacutea
Tambieacuten tengo que recordar a Raquel Felipe y Cris el antiguo equipo Ecotox
pasamos muy buenos ratos que se echan de menos A mis actuales compantildeeros
Alfredo Pesca Julia Silvia y Carlos que aunque no estas en el despacho como si lo
estuvieras Gracias por amenizar las horas de laboratorio y los madrugones Silvia
especialmente a ti gracias por sacar siempre un rato para charlar y escucharnos
mutuamente aunque nos separen un porroacuten de cajas y un poto gigante ahiacute estas
siempre Espero seguir aquiacute mucho tiempo para apoyarte igual que tuacute lo has hecho
conmigo Cris no me olvido de ti que desde el principio y hasta ahora te has
preocupado de saber que tal me iba estabas al tanto de todo y me has animado a
seguir adelante Te deseo que las cosas te vayan genial porque te lo mereces
asique aacutenimo que no es por presionar pero en breve te toca a tiacute Me faltan palabras
para contar todo lo que Moacutenica y Andrea me han ayudado y ensentildeado desde un
primer momento Igualmente agredezco el apoyo que Patri y Ester me han dado al
igual que los buenos ratos cotilleando imprescindibles Tambieacuten tengo que
agradecer a Jose Luis Sanz de la Universidad Autoacutenoma de Madrid que me abriera
las puertas de su laboratorio para aprender la maravillosa teacutecnica del DGGE y unas
cuantas cosas maacutes Ine a tiacute si que te agradezco un montoacuten las horas que has
perdido de tu trabajo para ensentildearme Desde un primer momento simpre con la
sonrisa puesta auacuten sin concocerme de nada Han sido muchos los viajes que he
hecho y el tiempo empleado en ello pero ha merecido la pena Asique igualmente
formas parte de esta tesis porque cada uno de los artiacuteculos no hubieran estado
completos sin tu ayuda
Son muchas las personas que sin formar parte del gremio han estado siempre
presentes Mis padres y mi hermano ya sabeis que no podriacutea hacer nada sin
vosotros a mi lado Durante estos antildeos no habeis dejado de preocuparos por mi y de
apoyarme ni un solo instante maacutes auacuten cuando las cosas han sido tan complicadas
199
para miacute Nada hubiera salido bien sin vosotros una vez maacutes os doy las gracias por
ser tan maravillosos y por teneros Por otro lado mis amigos ellos si que andan
agenos al tema y sin embargo siempre han sabido cuando preguntar y que palabras
usar cuando mas lo he necesitado Tengo que hacer una mencioacuten especial al sentildeor
Jimmy (responsable graacutefico y de disentildeo de la tesis) a ti si que te ha caiacutedo una
buena desde aquella llamada en la que te dije ldquoha llegado el momentordquo A
parte del gran trabajo que has hecho vistiendo la tesis tuacute una de las personas maacutes
sosegadas que conozco has podido aguantar el histerismo de los diacuteas previos a
depositar la tesis Gracias Jimmy eres un sol pero que sepas que auacuten me queda la
defensa oacutesea presentacioacuten en power pointhellipyo no digo nada Tambieacuten
agaradezco al ldquogrupo parkeeerdquo las horas que pasamos en las cuales a parte de
mucho friacuteo tambieacuten pasamos muy buenos ratos Especialmente a Lauri gracias por
acercarte un buen diacutea y preguntarme iquesttodo bien Desde entonces tus achuchones
tus canciones y tu ldquoflower powerrdquo han hecho que me despeje cada tarde Gracias
tambieacuten por interesarte tanto por mi trabajo dentro de poco te lo podreacute presentar
Las uacuteltimas palabras van dirigidas a Javi A ti que has estado conmigo desde el
principio gracias por no dejar que me desquicie y darme siempre tranquilidad Son
muchas las horas que he dedicado a esto y siempre has estado recordaacutendome
cuando era el momeno de parar Gracias por saber comprender lo que hago aunque
a veces me queje tanto y por ayudarme a echarle un par de narices cuando maacutes
desanimada estaba Gracias por hacer que este mundo roto no estropee mi sonrisa
Todo el tiempo que no te he dedicado lo recuperaremos juntos en nuestra casa
A todos y cada uno de vosotros gracias
Raquel
Resumen
AntecedentesObjetivos
Listado de manuscritosSiacutentesis de capiacutetulosMetodologiacutea general
I
Resumen Antecedentes
13
Antecedentes
Tal y como su propio nombre indica biorremediacioacuten significa ldquodar remediordquo mediante
teacutecnicas bioloacutegicas por lo que una definicioacuten acertada de biorremediacioacuten seriacutea el conjunto
de teacutecnicas que permiten resolver problemas de contaminacioacuten mediante el uso de
microorganismos (bacterias algas unicelulares etc) hongos plantas o enzimas derivadas
de ellos En el contexto de esta tesis la biorremediacioacuten se aplica a suelos u otros sistemas
contaminados con hidrocarburos aromaacuteticos policiacuteclicos (HAP o PAH siglas en ingleacutes
polyciclic aromatic hydrocarbons) Los HAP son compuestos que se generan por la
combustioacuten incompleta de combustibles foacutesiles por causas naturales y en mayor medida
antroacutepicas Si tenemos en cuenta que el sustento del sistema energeacutetico mundial son los
combustibles foacutesiles podemos hacernos una idea de la relevancia y elevada presencia de
estos compuestos en la vida cotidiana Considerando sus complejas propiedades y su
caraacutecter perjudicial para el ser humano y los ecosistemas (Internacional Agency for
Research on Cancer 1972-1990) los HAP suscitaron una creciente preocupacioacuten a partir
del pasado siglo siendo los primeros carcinoacutegenos ambientales reconocidos (Haritash amp
Kaushik 2009) Eacutesto dio lugar a numerosos estudios cientiacuteficos con el objetivo de
determinar sus efectos en el medio y el ser humano asiacute como a la buacutesqueda de soluciones
para su eliminacioacuten Frente a muchas otras teacutecnicas de eliminacioacuten de contaminantes
(teacutecnicas fiacutesicas yo quiacutemicas) la biorremediacioacuten presenta una caracteriacutestica clave que la
hace destacar sobre las otras teacutecnicas y es que se basa en procesos que respetan el medio
perturbado y permiten en la medida de lo posible su recuperacioacuten
Los hidrocarburos aromaacuteticos policiacuteclicos (HAP) Legislacioacuten espantildeola sobre medios
contaminados
La presente tesis se centra en el estudio de la biodegradacioacuten de los hidrocarburos
aromaacuteticos policiacuteclicos y por ello es esencial conocer a fondo queacute son cuaacuteles son sus
caracteriacutesticas y porqueacute suscitan este intereacutes Los HAP son compuestos quiacutemicos formados
por la fusioacuten de un determinado nuacutemero de anillos de su principal componente aromaacutetico el
benceno La estructura quiacutemica de alguno de los compuestos que han sido utilizados
durante el desarrollo de esta tesis aparecen en la Figura 1
Resumen Antecedentes
14
Figura 1 Hidrocarburos aromaacuteticos poliacuteciacuteclicos de bajo (naftaleno fenantreno y antraceno) y alto peso
molecular (pireno y perileno)
Los HAP se pueden clasificar en funcioacuten del nuacutemero de anillos benceacutenicos en HAP de
bajo (menos de tres anillos) y de alto peso molecular Tan soacutelo el naftaleno fenantreno y
antraceno (dos y tres anillos respectivamente) seriacutean considerados HAP de bajo peso
molecular (Cerniglia 1984 1992) La propiedades quiacutemicas de los HAP y por tanto su
destino en el medioambiente depende del nuacutemero de anillos aromaacuteticos que lo componen y
de su tipologiacutea molecular (Kanaly amp Harayama 2000) Por ejemplo el fenantreno y
antraceno son compuestos isoacutemeros (Figura 1) con el mismo peso molecular porque tienen
el mismo nuacutemero de anillos benceacutenicos pero en distinta disposicioacuten lo que les confiere
distintas caracteriacutesticas quiacutemicas En general a medida que aumenta su tamantildeo peso
molecular y angularidad aumenta su hidrofobicidad y estabilidad electroquiacutemica (Zander
1983) Tal y como algunos trabajos han demostrado eacutestos son dos factores primarios que
contribuyen a la persistencia de los HAP en el medio Por ejemplo de acuerdo con
Shuttleworth amp Cerniglia (1995) la vida media en suelos y sedimentos de un HAP de tres
anillos como el fenantreno podriacutea oscilar en un rango de entre 6 a 126 diacuteas mientras que
para moleacuteculas de cuatro a cinco anillos el tiempo aumentariacutea de 229 a maacutes de 1400 diacuteas
Ademaacutes debido a su naturaleza lipofiacutelica tiene un elevado potencial de bioacumulacioacuten en la
cadena troacutefica fenoacutemeno conocido como biomagnificacioacuten (Clements et al 1994) Se sabe
que los HAP ejercen un acusado efecto toacutexico y poseen propiedades mutageacutenicas
teratogeacutenicas y en algunos casos carcinogeacutenicas (Internacional Agency for Research on
Cancer 1972-1990) De hecho dieciseacuteis HAP han sido clasificados como contaminantes
prioritarios por la US Environmental Protection Agency (Agencia de proteccioacuten ambiental
Resumen Antecedentes
15
de Estados Unidos) y por la Comisioacuten Europea de Medio Ambiente (Maliszewska-Kordybach
1996)
Los HAP estaacuten presentes como constituyentes naturales de los combustibles foacutesiles y
se forman durante la combustioacuten incompleta de la materia orgaacutenica Las fuentes naturales
de produccioacuten de HAP son los incendios forestales y de pastizales yacimientos de petroacuteleo
o erupciones volcaacutenicas (Haritash amp Kaushik 2009) Sin embargo las fuentes antroacutepicas
son las que maacutes contribuyen a su formacioacuten mediante la quema de combustibles foacutesiles con
fines energeacuteticos en el tratamiento de la madera con creosota mediante el uso de
lubricantes y en el refino del petroacuteleo y actividades de transporte (Lee et al 1981) Aunque
los vertidos se produzcan en una zona determinada es posible que la carga contaminante
se extienda si alcanza un efluente o mediante su filtracioacuten a traveacutes del suelo pudiendo
alcanzar acuiacuteferos Otras cargas contaminantes se generan por descarga directa
procedentes de efluentes industriales en grandes superficies de suelos o mares o por la
liberacioacuten accidental de materia prima (Kanaly amp Harayama 2000) Se han detectado HAP
en el aire procedente fundamentalmente de la quema industrial de combustibles foacutesiles y el
traacutefico (Koeber et al 1999 Lim et al 1999) en suelos y en la parte superficial y profunda
de la columna de agua y sedimentos (Readman et al 2002 Johnsen et al 2005 2006) En
alimentos vegetales y plantas aparecen como consecuencia de la difusioacuten y posterior
sedimentacioacuten de los HAP atmosfeacutericos sobre la vegetacioacuten (Wagrowski amp Hites 1997) y
por la adsorcioacuten de HAP acumulados en el agua del suelo
El suelo constituye uno de los medios receptores de la contaminacioacuten maacutes sensibles y
vulnerables Sin embargo y auacuten dada la gravedad y extensioacuten creciente de la contaminacioacuten
con HAP no fue hasta la Conferencia de Naciones Unidas sobre el Medio Ambiente y el
Desarrollo celebrada en Riacuteo de Janeiro en 1992 cuando se reconocioacute y planteoacute de forma
trascendente la importancia de la proteccioacuten de los suelos y la definicioacuten de sus usos
potenciales La Agencia Europea de Medio Ambiente (AEMA) estimoacute en 1999 que el
nuacutemero de zonas o aacutereas contaminadas en Europa Occidental estaba entre 300000 y
1500000
Hasta la promulgacioacuten de la Ley 101998 de 21 Abril de Residuos Espantildea careciacutea de
cualquier instrumento normativo para legislar controlar y proteger lo referente a suelos
contaminados Con esta Ley las Comunidades Autoacutenomas son las encargadas de declarar
delimitar e inventariar los suelos contaminados de sus territorios ademaacutes de establecer las
bases para una determinada actuacioacuten Con el Real decreto 92005 del 14 de Enero se da
cumplimiento a lo dispuesto en la 101998 de Residuos y en eacutel se establece la relacioacuten de
actividades potencialmente contaminantes del suelo y los criterios y estaacutendares para la
Resumen Antecedentes
16
declaracioacuten de un suelo bajo la categoriacutea de ldquocontaminadordquo Uno de los aspectos maacutes
importantes desde el punto de vista de la biorremediacioacuten se recoge en el Artiacuteculo 7 del
Real Decreto 92005 por el cual ldquola declaracioacuten de un suelo como contaminado obligaraacute a la
realizacioacuten de las actuaciones necesarias para proceder a su recuperacioacuten ambientalrdquo
Ademaacutes antildeade que las teacutecnicas deben ser las maacutes apropiadas en cada caso garantizando
soluciones de caraacutecter permanente y prioriza las teacutecnicas de tratamiento in situ que eviten la
generacioacuten traslado y eliminacioacuten de residuos
Lo dispuesto en esta ley sin duda supone un enorme impulso a las teacutecnicas de
biorremediacioacuten ya que a traveacutes de ellas se favorece el tratamiento in situ y la recuperacioacuten
del ecosistema a su estadio original sin generacioacuten de residuos y con el menor impacto
ambiental posible
Factores que condicionan la biodegradacioacuten
Aunque la biodegradacioacuten bacteriana es una de las teacutecnicas maacutes eficaces en la
descontaminacioacuten in situ de medios contaminados con HAP la eficacia y tasas de
biodegradacioacuten dependen en gran medida del nuacutemero y tipo de microorganismo
degradador presente en el medio y de la naturaleza y estructura quiacutemica del contaminante a
degradar (Haritash amp Kaushik 2009) Ademaacutes a la hora de disentildear un sistema de
biorremediacioacuten debemos tener en cuenta que existen muacuteltiples factores ambientales que
van a condicionar la eficacia y la rapidez del proceso con el agravante de que durante la
aplicacioacuten in situ es difiacutecil y en algunos casos imposible poder controlar o modificar alguno
de estos factores La biorremediacioacuten es una teacutecnica eficaz y econoacutemica pero cuenta con la
desventaja del tiempo ya que en algunos casos la descontaminacioacuten del medio y su
recuperacioacuten pueden durar antildeos
Por tanto los estudios de optimizacioacuten en los que se combinen todos los factores
posibles considerando los efectos sineacutergicos y antagoacutenicos son esenciales en
biorremediacioacuten Entre los factores ambientales maacutes estudiados en la literatura destacamos
temperatura pH tipo y concentracioacuten de nutrientes inorgaacutenicos y fuentes de carbono
Temperatura y pH
La temperatura es una de las variables maacutes influyentes en el proceso de biodegradacioacuten
bacteriana ya que afecta tanto a las propiedades fisicoquiacutemicas de los HAP como al
Resumen Antecedentes
17
metabolismo microbiano La temperatura guarda una relacioacuten proporcional con los rangos
de difusioacuten y solubilidad de los HAP e inversamente proporcional con el coeficiente de
particioacuten suelo-agua (Wu amp Gschwend 1986) Mientras que el coeficiente de particioacuten de los
HAP decrece entre un 20-30 por cada incremento de 10ordmC en temperaturas comprendidas
entre los 5 ordmC - 45 ordmC el coeficiente de difusioacuten en agua aumenta entre 4-5 veces con un
incremento de la temperatura de 20 a 120 ordmC Esto se traduce en que cuanto menor es la
temperatura menor es la solubilidad de los HAP en la fase acuosa y consecuentemente
menor es su biodisponibilidad para ser mineralizados por los microorganismos (Haritash amp
Kaushik 2009)
Por otro lado las bajas temperaturas afectan negativamente al metabolismo
microbiano ralentizaacutendolo y aumentando la duracioacuten de la fase de latencia en la que hay
inactividad (Atlas amp Bartha 1972 Eriksson et al 2001) Tal y como se ha demostrado en
estudios previos (Leahy amp Colwell 1990) la velocidad de metabolizacioacuten normalmente se
duplica por cada aumento de 10 ordmC en temperaturas comprendidas entre los 10 y 40 ordmC Sin
embargo y a pesar de las desventajas que las bajas temperaturas presentan para la
biodegradacioacuten existe degradacioacuten de hidrocarburos en ambientes friacuteos cuyas temperaturas
oscilan entre los 0 ordmC ndash 10 ordmC (Margesin et al 2002) Algunos trabajos se han centrado en el
estudio de la biodegradacioacuten en zonas de agua marina y suelos bajo temperaturas
extremadamente bajas (Colwell et al 1978 Mohn amp Stewart 2000 Ericksson et al 2001
Delille amp Pelletiere 2002) obteniendo resultados positivos Sin embargo la mayoriacutea de los
estudios de biodegradacioacuten se han llevado a cabo en condiciones de laboratorio en un rango
de temperaturas comprendido entre los 20 ndash 35 ordmC sin observar a penas diferencias en las
tasas de biodegradacioacuten (Chen et al 2008) Por debajo de estas temperaturas la
degradacioacuten es maacutes complicada porque el metabolismo de los microorganismos se ralentiza
y la solubilizacioacuten de los HAP disminuye Aun asiacute hay bacterias adaptadas a estas
condiciones que hacen posible la degradacioacuten en ambientes con temperaturas extremas
Varias especies de Pseudomonas y Sphingomonas se han identificado como bacterias
degradadoras de HAP en la Antaacutertida (Aislabie et al 2000) Eacutestas y otras especies estaacuten
adaptadas a las temperaturas locales y a otras condiciones de estreacutes ya que durante el
deshielo sobreviven en suelos friacuteos y secos pobres en nutrientes y a menudo alcalinos Sin
embargo la capacidad de estas bacterias para crecer en suelos con condiciones climaacuteticas
suaves y la utilizacioacuten de HAP para su crecimiento implica que estas bacterias son
psicrotolerantes (Aislabie et al 2000) cuya temperatura oacuteptima es superior a los 20 ordmC pero
son capaces de sobrevivir cerca o por debajo de los 0 ordmC Ademaacutes existen algunas especies
cuyo crecimiento se desarrolla en ambientes que permanentemente esteacuten por debajo de los
5 ordmC este grupo de bacterias son psicroacutefilas La temperatura es un factor que difiacutecilmente se
puede controlar o manipular en proyectos de aplicacioacuten in situ por lo que es importante
Resumen Antecedentes
18
elaborar un estudio previo bajo las condiciones del ecosistema afectado Esto es
fundamental sobre todo en ambientes con temperaturas bajas en los que se puede estudiar
queacute otros factores modificar para suplir las desventajas de la temperatura como puede ser
inocular cepas bacterianas adaptadas a las bajas temperaturas aumentar el oxiacutegeno o
adicionar nutrientes En estas condiciones no toda la comunidad tiene por queacute ser eficaz en
la degradacioacuten de un contaminante aunque se ha propuesto que las bacterias y no los
hongos son las mayores colonizadoras y degradadoras (Kerry 1990) La identificacioacuten de
las especies de la poblacioacuten autoacutectona asiacute como la refrenciacioacuten de sus capacidades
metaboacutelicas son muy importantes en la biorremediacioacuten de suelos de ambientes friacuteos Esta
cuestioacuten es especialmente importante en la Antaacutertida ya que el Sistema del Tratado
Antaacutertico prohiacutebe la introduccioacuten de organismos aloacutectonos
Por otro lado el pH es un factor abioacutetico que de forma similar a la temperatura puede
afectar significativamente tanto a la actividad y diversidad microbiana como a la
mineralizacioacuten de los HAP Los rangos de pH oacuteptimos para el proceso de metabolizacioacuten
pueden ser muy variables ya que depende de las caracteriacutesticas del medio contaminado y
de la poblacioacuten microbiana que alberga (Dibble amp Bartha 1979) Las micobacterias son
bacterias neutroacutefilas cuyo pH oacuteptimo es superior 6 (Portaels amp Pattyn 1982) Sin embargo
a paritr de este pH se ha observado que la degradacioacuten de HAP por Mycobacterium es maacutes
eficaz cuando el pH tiende ligeramente a aacutecido (65) porque la membrana de aacutecidos
micoacutelicos es maacutes permeable a compuestos hidrofoacutebicos (Kim et al 2005) Otros autores
han mostrado que para otro tipo de bacterias comuacutenmente descritas en procesos de
biodegradacioacuten como Pseudomonas sp el rango oacuteptimo de pH oscila entre 55 y 78
notablemente mejor cuanto maacutes neutro (Dibble amp Bartha 1979) El uso de ciertos
surfactantes puede causar la basificacioacuten del medio (Bautista et al 2009) por lo que este
aspecto debe ser considerado a la hora de disentildear un proceso de biorremediacioacuten Tambieacuten
se pueden generar variaciones de pH durante el proceso como consecuencia de los
metabolitos intermedios derivados de los HAP Por ejemplo al comienzo de la degradacioacuten
se generan metabolitos con grupos hydroxiacutelicos que producen un aumento del pH (Habe amp
Omori 2003 Puntus et al 2008)
Nutrientes inorgaacutenicos
Ante una perturbacioacuten por un contaminante el requerimiento de nutrientes de las bacterias
degradadoras del ecosistema aumenta para poder metabolizar el aporte extra de carbono
que supone el contaminante Por este motivo en biorremediacioacuten es importante encontrar
una relacioacuten oacuteptima de carbononitroacutegenofoacutesforo (CNP) que tradicionalmente se han fijado
Resumen Antecedentes
19
en 100101 (ej Bouchez et al 1995) Sin embargo este aspecto es objeto de controversia
ya que otros autores (Leys et al 2005) han demostrado que la relacioacuten anteriormente
propuesta como oacuteptima puede ser insuficiente limitando el crecimiento bacteriano y por
tanto ralentizando la biodegradacioacuten La bioestimulacioacuten es una teacutecnica de biorremediacioacuten
que consiste en la adicioacuten de nutrientes inorgaacutenicos a los substratos contaminados La
disponibilidad de nutrientes es un aspecto muy importante en la eficacia de la
biodegradacioacuten Nutrientes como el nitroacutegeno el foacutesforo o el hierro son esenciales para el
metabolismo bacteriano en general y mucho maacutes en el caso de biorremediacioacuten de medios
contaminados por HAP Aunque la mayoriacutea de los trabajos indican que la adicioacuten de
nutrientes mejora el proceso algunos autores (Yu et al 2005) obtuvieron resultados
opuestos La diferencia entre unos resultados y otros radican en que la necesidad de
nutrientes depende del tipo de bacteria tipo de hidrocarburo y de las condiciones del medio
(Leys et al 2005) El hierro es un nutriente esencial necesario en el proceso de
biodegradacioacuten ya que por un lado es cofactor de las enzimas que catalizan la oxidacioacuten de
los HAP y por otro se ha relacionado con la produccioacuten de biosurfactantes para potenciar la
solubilidad de los HAP (Wei et al 2003) Sin embargo determinar la proporcioacuten oacuteptima de
este nutriente es fundamental pues altas concentraciones pueden ser toacutexicas (Santos et al
2008) Es tambieacuten una cuestioacuten a considerar la forma en la que se adicionan o se
encuentran los nutrientes en el medio ya que condiciona su biodisponibilidad Asiacute algunos
autores (Schlessinger 1991) proponen que las formas oxidadas como nitratos son maacutes
solubles que las formas reducidas como amonio que ademaacutes tiene propiedades
adsorbentes Establecer si un determinado problema medioambiental requiere un aporte
exoacutegeno de nutrientes es por tanto una cuestioacuten a discutir que probablemente dependa de
otras variables bioacuteticas y abioacuteticas
Fuentes de carbono laacutebiles
La adicioacuten a un medio contaminado de otras fuentes de carbono faacutecilmente biodegradables
se considera una alternativa que puede favorecer la biodegradacioacuten porque aumenta la
biomasa de la poblacioacuten microbiana y por tanto de la poblacioacuten degradadora Realmente se
puede entender como una forma de bioestimulacioacuten enfocada a aumentar y estimular el
crecimiento bacteriano o su actividad y por consiguiente la degradacioacuten Algunas de las
sustancias tratadas con este fin son el piruvato que estimula el crecimiento de ciertas cepas
bacterianas o el salicilato que induce la activacioacuten de enzimas degradadoras En el caso de
la glucosa su raacutepida asimilacioacuten y aumento de biomasa asociado se podriacutea traducir en un
aumento de la biodegradacioacuten (Ye et al 1996) Lee et al (2003) propusieron y
comprobaron que el piruvato potenciaba el crecimiento de la cepa degradadora
Resumen Antecedentes
20
Pseudomonas putida lo que se tradujo en un aumento de la tasa de biodegradacioacuten de
naftaleno Chen amp Aitken (1999) han comprobado que el salicilato induce la siacutentesis de
enzimas cataboacutelicas y por tanto su adicioacuten favorece la metabolizacioacuten de HAP siempre
que su concentracioacuten en el medio no supere una concentracioacuten liacutemite inhibitoria Wong et al
(2000) observoacute que la adicioacuten de glucosa favoreciacutea el crecimiento total de la poblacioacuten pero
las tasas de biodegradacioacuten fueron significativamente menores Estos resultados se deben
a que la cepa o consorcio degradador es capaz de mineralizar un HAP como uacutenica fuente de
carbono y la asimilacioacuten de glucosa inhibe la siacutentesis de enzimas implicadas en la
degradacioacuten del contaminante Es necesario valorar en cada caso de estudio coacutemo afecta la
adicioacuten de una nueva fuente de carbono ya que en el caso de bacterias no pre-adaptadas a
degradar HAP es posible que sus efectos sean positivos (Wong et al 2000) pero en
poblaciones microbianas histoacutericamente adaptadas a substratos contaminados la adicioacuten de
glucosa puede favorecer el crecimiento de microorganismos heteroacutetrofos no degradadores
Importancia y efecto de los surfactantes en la biodegradacioacuten de HAP
La baja solubilidad de los HAP y de la mayoriacutea de los compuestos del petroacuteleo limita la
capacidad de los microorganismos para acceder y degradar los compuestos contaminantes
Los surfactantes son tensioactivos que actuacutean disminuyendo la tensioacuten superficial del agua
para facilitar la disolucioacuten de los HAP en la fase acuosa En algunos estudios (Bautista et al
2009) se ha demostrado que el uso de surfactantes en procesos de biodegradacioacuten es
necesario para solubilizar los HAP Muchas bacterias degradadoras de HAP han
desarrollado la capacidad de generar biosurfactantes (surfactantes de origen microbiano)
como parte de su superficie celular o como moleacuteculas liberadas extracelularmente (Fiechter
1992) Algunas de estas especies pertenecen a los geacuteneros Pseudomonas (P aeruginosa
P fluorescens) Rhodococcus Mycobacterium Lactobacillus Acinetobacter o
Sphingomonas Los biosurfactantes se clasifican en funcioacuten de su masa molecular en
biosurfactantes de bajo peso molecular como glicoliacutepidos o lipopeacuteptidos y de alto peso
molecular que incluyen moleacuteculas maacutes complejas como polisacaacuteridos anfipaacuteticos proteiacutenas
lipopolisacaacuteridos y lipoproteiacutenas Se han observado resultados muy contradictorios en
cuanto a sus efectos sobre las tasas de biodegradacioacuten por un lado positivos (Jing et al
2007) pero tambieacuten inhibitorios (Laha amp Luthy 1991) Los biosurfactantes de alto peso
molecular son eficaces en la estabilizacioacuten de emulsiones de aceite en agua mientras que
los de bajo peso molecular son maacutes eficaces en la disminucioacuten de la tensioacuten interficial y
superficial (Rosenberg amp Ron 1999) En el caso de los surfactantes sinteacuteticos su eficacia
estaacute determinada por sus propiedades de carga (no ioacutenicos anioacutenicos o catioacutenicos) su
balance hidrofiacutelico-lipofiacutelico y su concentracioacuten micelar criacutetica (CMC) concentracioacuten a la cual
Resumen Antecedentes
21
la tensioacuten superficial es miacutenima y los monoacutemeros de surfactante se agregan formando
micelas Sin embargo algunos surfactantes pueden inhibir la mineralizacioacuten de los HAP por
cuestiones como la toxicidad del medio derivada de una elevada concentracioacuten de
surfactantes la cual resulta toacutexica para los microorganismos (ej Tergitol NP-10) o porque
al solubilizarse los HAP por accioacuten del surfactante aumenta toxicidad del medio (Liu et al
2001) En algunos casos ademaacutes los surfactantes no son biodegradables (Bautista et al
2009) De hecho Bautista et al (2009) comprobaron que el surfactante no ioacutenico Tergitol
NP-10 es un surfactante no biodegradable y toacutexico para los microorganismos en
comparacioacuten con el Tween-80 Dada la amplia variabilidad de resultados referentes a los
surfactantes es importante la eleccioacuten correcta en cada proceso considerando el tipo de
contaminante a eliminar y los microorganismos presentes en el medio
Biodegradacioacuten bacteriana cepas y consorcios microbianos degradadores de HAP
Son muchas las especies bacterianas descritas con capacidad degradadora de HAP la
mayoriacutea de ellas aisladas de aguas sedimentos y suelos previamente contaminados con
hidrocarburos La biodegradacioacuten de HAP de bajo peso molecular como el naftaleno
fenantreno y antraceno ha sido ampliamente estudiada Sin embargo son escasos los
estudios realizados sobre la biodegradacioacuten de HAP de alto peso molecular como el pireno
perileno acenafteno o fluoreno (Kanaly amp Harayama 2000) De acuerdo con Chauhan et al
(2008) especies de Pseudomonas y Ralstonia se relacionan en mayor medida con la
degradacioacuten de naftaleno y fenantreno Burkolderia y Stenotrophomonas con naftaleno
fenantreno y antraceno y otras especies pertenecientes a los geacuteneros Rhodococcus
Sphingomonas y Mycobacterium con HAP de mayor peso molecular como fluoranteno
benzo[a]pireno pireno benzo[b]fluoranteno Las especies bacterianas degradadoras
pertenecen a grupos filogeneacuteticos muy diversos y en muchos casos taxonoacutemicamente
alejados Trabajos previos (Vintildeas et al 2005 Molina et al 2009 Gonzaacutelez et al 2011)
muestran una gran parte de las bacterias degradadoras pertenecen al phylum
Proteobacteria en mayor proporcioacuten a las clases α- Proteobacteria (Sphingomonas
Bradyrizobium Nitrobacteria Balneimonas) y γ- (Pseudomonas Stenotrhophomonas
Enterobacter Pantoea Acinetobacter o Psychrobacter) Tambieacuten se han aislado especies
pertenecientes a la clase β- Proteobacterias (Ralstonia) y a los phylum Actinobacteria
(Microbacterium sp Rhodococcus sp) Firmicutes (Bacillus subtillis) y Bacteroidetes
(Flexibacter) aunque eacutestas en menor frecuencia Muchos de los trabajos de degradacioacuten
bacteriana se han realizado con cepas individuales (Grimberg et al 1996 Das amp Mukherjee
2006) extraiacutedas de suelos contaminados o bien con consorcios artificiales formados por
varias cepas degradadoras (Ghazali et al 2004) siendo muy pocos aquellos en los que se
Resumen Antecedentes
22
ha utilizado un consorcio bacteriano natural extraiacutedo directamente de un suelo Bautista et al
(2009) sentildeala que la capacidad de degradacioacuten de un consorcio artificial es mayor que la de
las cepas individuales Seguacuten algunos autores (Fritsche 1985 Mueller et al 1997) la mejor
eficiencia de degradacioacuten de un consorcio es debido a que la diversidad de especies permite
que cada una tenga un papel en el proceso de biodegradacioacuten facilitando la degradacioacuten de
HAP gracias al cometabolismo establecido entre las especies implicadas
Existe una importante controversia referente a la capacidad degradadora que
presentan los consorcios naturales ya que se ha observado que ciertos consorcios
extraiacutedos de zonas no contaminadas con HAP son capaces de metabolizar dichos
compuestos (Tian et al 2008 Couling et al 2010) Seguacuten estos autores es una
caracteriacutestica general presente en algunas comunidades microbianas que se expresa ante
una determinada perturbacioacuten Sin embargo Barkay amp Pritchart (1988) exponen que es una
caracteriacutestica que soacutelo estaacute presente en comunidades previamente expuestas y por lo tanto
preadaptadas como consecuencia de presiones selectivas Algunos autores (Jhonsen et al
2005) subrayan que la capacidad cataboacutelica se propaga faacutecilmente entre bacterias de un
mismo suelo contaminado como resultado de la transferencia horizontal de genes (ej
conjugacioacuten y transformacioacuten) Esto facilitariacutea auacuten maacutes que una comunidad no preadaptada
pueda hacer frente a una perturbacioacuten
Teacutecnicas de biorremediacioacuten
El objetivo uacuteltimo de la biorremediacioacuten es que el proceso de biodegradacioacuten se desarrolle
de la forma maacutes eficaz posible y por eso muchos trabajos se centran en la optimizacioacuten del
proceso mediante el desarrollo de teacutecnicas que aumenten la eficacia del mismo Teacutecnicas
como la bioestimulacioacuten anteriormente mencionada se centran en aumentar la capacidad
degradadora de la comunidad autoacutectona bacteriana mediante la adicioacuten de nutrientes
(nitroacutegeno foacutesforo potasio) de forma que la falta de nutrientes no suponga una limitacioacuten
para el metabolismo microbiano y por consiguiente para la biorecuperacioacuten de la zona
perturbada Otras teacutecnicas se basan en el aumento de la poblacioacuten degradadora mediante la
adicioacuten de cepas o consorcios con capacidad reconocida para metabolizar un determinado
compuesto es lo que se conoce como bioaumento En algunos trabajos los resultados
derivados de la bioestimulacioacuten y el bioaumento han sido positivos (Mills et al 2004
Atagana 2006) pero en trabajos como Chen et al (2008) o Yu et al (2005) los efectos de
ambas teacutecnicas en el proceso fueron negativos o simplemente no tuvieron efecto Se tiene
que tener en cuenta que ambas teacutecnicas generan cambios en las comunidades autoacutectonas
que afectan y modifican las relaciones de competencia Estos cambios pueden ser auacuten maacutes
Resumen Antecedentes
23
acusados en el caso del bioaumento pues la introduccioacuten de una comunidad foraacutenea puede
tener resultados difiacuteciles de predecir La atenuacioacuten natural es otra teacutecnica basada en la
mera actuacioacuten de la comunidad autoacutectona sin ninguacuten tipo de modificacioacuten de la comunidad
yo adicioacuten de sustancias Dowty et al (2001) entre otros defiende que cuando se trata de
restablecer el medio a las condiciones originales preservando la biodiversidad la
atenuacioacuten microbiana puede ser la mejor opcioacuten siempre que las poblaciones autoacutectonas
presenten capacidad degradadora
Resumen Objetivos
25
Objetivos
El objetivo general de la tesis es el conocimiento profundo de la biodegradacioacuten bacteriana
de hidrocarburos aromaacuteticos policiacuteclicos para la biorremediacioacuten y recuperacioacuten de medios
contaminados con estos compuestos toacutexicos El proyecto se ha centrado en la identificacioacuten
y conocimiento de la poblacioacuten bacteriana de consorcios procedentes de ambientes
(contaminados o no) y de su dinaacutemica ante determinadas condiciones durante el proceso de
biodegradacioacuten Para alcanzar este objetivo principal se fijaron objetivos especiacuteficos
desarrollados en cuatro capiacutetulos
1 Estudiar los factores abioacuteticos a fin de optimizar las condiciones de desarrollo en el
proceso de biodegradacioacuten de HAP en cultivos liacutequidos (capiacutetulo 1a) En un segundo
proyecto de optimizacioacuten el objetivo fue asemejar el proceso en laboratorio lo maacutes
posible a las condiciones naturales considerando los efectos derivados de la
interaccioacuten muacuteltiple de factores ambientales y bioloacutegicos (capiacutetulo 1b)
2 Analizar el efecto de la aplicacioacuten de distintos tipos de surfactantes (no ioacutenicos
biodegradables y no biodegradables) en la eficacia de degradacioacuten de HAP de un
consorcio bacteriano previamente adaptado (C2PL05) Asiacute mismo se quiso estudiar el
efecto del tipo de surfactante en la sucesioacuten y dinaacutemica del consorcio identificando los
microorganismos implicados a lo largo del proceso (capiacutetulo 2)
3 Estimar la capacidad degradadora de microcosmos inoculados con consorcios
procedentes de suelos con distinta historia de contaminacioacuten suelo croacutenicamente
contaminado (C2PL05) frente a un suelo procedente de un ambiente libre de
contaminacioacuten (BOS08) bajo condiciones climaacuteticas suaves y extremas Describir y
comparar las comunidades bacterianas que componen ambos consorcios (capiacutetulo 3)
4 Evaluar la eficacia de diversas teacutecnicas de biorremediacioacuten (atenuacioacuten natural
bioestimulacioacuten yo bioaumento) tanto en la eliminacioacuten del contaminante y la
toxicidad como en la capacidad de recuperacioacuten del ecosistema (capiacutetulo 4) Para el
desarrollo de este objetivo se llevoacute a cabo una simulacioacuten a pequentildea escala
(microcosmos) de un proceso de biorremediacioacuten in situ de suelos naturales
contaminados con creosota
Resumen Listado de manuscritos
27
Listado de manuscritos
Los capiacutetulos que integran este proyecto doctoral han sido redactados en ingleacutes para su
publicacioacuten en revistas cientiacuteficas de aacutembito internacional Por ello se presentan los
manuscritos originales de dichos artiacuteculos A continuacioacuten se detalla la traduccioacuten del tiacutetulo
los nombres de los coautores y el estado de publicacioacuten de los manuscritos
Capiacutetulo 1a Simarro R Gonzaacutelez N Bautista LF Sanz R y Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium
Water Air and Soil Pollution (2011) 217 365-374
Capiacutetulo 1b Simarro R Gonzaacutelez N Bautista LF y Molina MC
Evaluation of the influence of multiple environmental factors on the
biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial
consortium using an orthogonal experimental design
Water Air and Soil Pollution (Aceptado febrero 2012)
Capiacutetulo 2 Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L y Villa
JA
Effect of surfactants on PAH biodegradation by a bacterial consortium and
on the dynamics of the bacterial community during the process
Bioresource Technology (2011) 102 9438-9446
Capiacutetulo 3 - Simarro R Gonzaacutelez N Bautista LF y Molina MC
High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures
FEMS Microbiology Ecology (Subscrito Diciembre 2011 En revisioacuten)
Resumen Listado de manuscritos
28
Capiacutetulo 4 - Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez L y Peacuterez
M
Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil
change in bacterial community
Manuscrito ineacutedito
Resumen Siacutentesis de capiacutetulos
29
Siacutentesis de capiacutetulos
La presente tesis doctoral se desarrolla dentro de un proyecto de investigacioacuten basado en la
biorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicos y
sustancias contaminantes que los contengan Este proyecto se esta llevando a cabo desde
hace seis antildeos por el grupo de Biorremediacioacuten del Departamento de Biologiacutea y Geologiacutea de
la Universidad Rey Juan Carlos Los artiacuteculos citados anteriormente componen los cuatro
capiacutetulos que se desarrollan en el cuerpo de la tesis
Anteriormente al desarrollo de los experimentos que componen los capiacutetuos de la
presente tesis se realizoacute un trabajo (Molina et al 2009) en el que se estudioacute la capacidad
de degradacioacuten de un consorcio bacteriano extraiacutedo de un suelo croacutenicamente contaminado
y se describioacute su poblacioacuten bacteriana mediante teacutecnicas dependientes e independientes de
cultivo El consorcio fue capaz de degradar los HAP (naftaleno fenantreno y antraceno) en
maacutes de un 98 en un periodo de 18 diacuteas y ademaacutes eliminoacute completamente la toxicidad del
medio en 41 diacuteas La identificacioacuten molecular permitioacute aislar e identificar 5 cepas bacteriana
(DIC-1 a DIC-6 DIC Degrading isolated Culture) todas γ-Proteobacterias pertenecientes a
los geacuteneros Enterobacter Pseudomonas y Stenotrophomonas (maacutes detalles en Molina et al
2009) Ademaacutes el anaacutelisis de la poblacioacuten mediante electroforesis en un gel con gradiente
desnaturalizante (DGGE Denaturing Gradient Gel Electrophoresis) confirmoacute que estos tres
geacuteneros eran dominantes La alta eficacia en la degradacioacuten de los HAP y la escasa
biodiversidad tiacutepica de suelos sometidos a elevadas concentraciones de contaminantes
durante largos peridos de tiempo indican que el consorcio C2PL05 estaacute totalmente
adaptado a la degradacioacuten de HAP
En el capiacutetulo 1 se optimizoacute el proceso de biodegradacioacuten a traveacutes de dos disentildeos
experimentales diferentes que se recogen en los subcapiacutetulos 1a y 1b En el capiacutetulo 1a
se evaluacutea y mejora la influencia de varios factores ambientales como la relacioacuten molar de
CNP la fuente de nitroacutegeno fuente y concentracioacuten de hierro pH y fuente de carbono El
anaacutelisis estadiacutestico de las tasas de degradacioacuten (Kb) y los incrementos de la densidad celular
indicoacute que todos los factores fueron significativamente influyentes en la Kb Esto permitioacute
establecer un valor oacuteptimo de estos factores y descartar en los siguientes ensayos aquellos
paraacutemetros como el pH cuyo valor oacuteptimo (pH 7) seguacuten nuestros resultados coincidiacutea con
otros estudios y estaba claramente definido en la bibliografiacutea A partir de los resultados de
esta primera parte se realizoacute un segundo ensayo de optimizacioacuten ortogonal multifactorial
(capiacutetulo 1b) que permitioacute la optimizacioacuten de 8 factores de forma conjunta La concentracioacuten
de surfactante y de inoacuteculo bacteriano son dos factores que no fueron incluiacutedos en el
anterior anaacutelisis pero a traveacutes de la bibliografiacutea se consideraron factores importantes en la
Resumen Siacutentesis de capiacutetulos
30
biodegradacioacuten de HAP Los resultados confirmaron que la temperatura la fuente de
carbono y la concentracioacuten de inoacuteculo fueron factores significativos en el incremento de la
densidad celular pero soacutelo la fuente de carbono influyoacute significativamente el porcentaje total
de degrad acioacuten Estos resultados (capiacutetulo 1) permitieron conocer cuaacuteles son las
condiciones oacuteptimas del cultivo para una degradacioacuten maacutes eficaz de HAP con el consorcio
bacteriano C2PL05
El uso de surfactantes en la biodegradacioacuten de HAP puede optimizar la eficacia del
proceso y en algunos casos su uso es imprescindible Sin embargo su utilizacioacuten implica
un elevado coste y en ocasiones pueden tener efectos negativos dependiendo de la
concentracioacuten y tipo de surfactante En el capiacutetulo 2 se evaluacutea el efecto de dos
surfactantes no ioacutenicos Tergitol NP-10 (no biodegradable) y Tween-80 (biodegradable) en
la capacidad degradadora del consorcio microbiano C2PL05 teniendo en cuenta la
velocidad de degradacioacuten de los HAP y la dinaacutemica de la poblacioacuten microbiana durante el
proceso (teacutecnicas cultivo-dependientes e independientes) La degradacioacuten bacteriana de
los HAP y la reduccioacuten de la toxicidad del medio fue significativamente mejor con el
surfactante no ioacutenico y biodegradable Tween-80 Ademaacutes el tipo de surfactante utilizado
para optimizar la biodegradacioacuten de HAP afectoacute significativamente a la dinaacutemica de la
comunidad bacteriana del consorcio siendo especies pertenecientes a los geacuteneros
Pseudomonas Sphingomonas Sphingobium y Agromonas responsables de estas
diferencias Teoacutericamente la uacutenica funcioacuten del surfactante en el proceso de
biodegradacioacuten es aumentar la solubilidad de los HAP pero sin embargo en este capiacutetulo
se ha puesto de manifiesto que modifican notablemente las poblaciones bacterianas y la
sucesioacuten de especies pudiendo afectar a la eficacia del proceso Un estudio previo que
desemboque en la eleccioacuten del surfactante maacutes adecuado asiacute como su concentracioacuten
favorece la efiacacia de la biorremediacioacuten
El capiacutetulo 3 se centra en el estudio de la capacidad degradadora de los
microorganismos El principal objetivo es comprobar si la capacidad de degradacioacuten se
adquiere necesariamente tras un periodo de exposicioacuten a un contaminante o si bien es una
caracteriacutestica intriacutensecamente presente en algunas bacterias Se considera que la
temperatura es uno de los factores maacutes influyentes en el proceso de biodegradacioacuten de
manera que a temperaturas friacuteas (lt15 ordmC) o extremas (lt5 ordmC) se dificulta el proceso porque
afecta a la solubilidad de los HAP y al metabolismo microbiano Sin embargo existen
especies que toleran o estaacuten adaptadas a las bajas temperaturas y que ademaacutes pueden
degradar HAP En este capiacutetulo se avaluoacute la capacidad degradadora de un consorcio
preadaptado a HAP (C2PL05) frente a un consorcio extraiacutedo de una zona priacutestina rica en
madera en descomposicioacuten (BOS08) Al mismo tiempo se simularon dos ambientes de
Resumen Siacutentesis de capiacutetulos
31
biodegradacioacuten uno a temperaturas suaves comprendidas entre los 15 ordmC-25 ordmC y otro maacutes
extremo con temperaturas entre los 5 ordmC-15 ordmC todo ello en un sustrato soacutelido (suelo) con
objeto de ajustarnos a las condiciones naturales Sin duda el resultado maacutes significativo fue
que el consorcio BOS08 no adaptado a la degradacioacuten de HAP fue capaz de degradar
eficazmente e incluso mejor que el consorcio C2PL05 cuando las temperaturas fueron bajas
Ademaacutes se observoacute que aunque hubo geacuteneros exclusivos de cada consorcio (Ralstonia
Bacillus) otros fueron comunes en ambos (Microbacterium Acinetobacter Pseudomonas)
Los resultados obtenidos confirman la hipoacutetesis de que la capacidad de degradacioacuten estaacute
presente de forma intriacutenseca en algunas especies y no depende de una pre-exposicioacuten al
contaminante
En la biorremediacioacuten de un suelo contaminado con HAP es muy importante tener en
cuenta la respuesta de la poblacioacuten bacteriana autoacutectona del suelo frente a un episodio de
contaminacioacuten En el capiacutetulo 4 se estudioacute el comportamiento de la comunidad bacteriana
de un suelo previamente no contaminado cuando es perturbado con creosota La
biorremediacioacuten in situ es un proceso maacutes complejo que cuando se estudia bajo condiciones
controladas de laboratorio ya que hay factores como la escasez de nutrientes o las bajas
temperaturas que dificultan el proceso (capiacutetulos 1 y 3) Sin embargo la aplicacioacuten de
tratamientos in situ como la bioestimulacioacuten o el bioaumento pueden mejorar la eficacia de la
biorremediacioacuten En este capiacutetulo se determinoacute la respuesta de la comunidad bacteriana
frente a la bioestimulacioacuten el bioaumento o a la atenuacioacuten natural evaluando el porcentaje
de degradacioacuten de creosota y los HAP que la componen la reduccioacuten de la toxicidad y al
mismo tiempo estudiando los cambios poblacionales El criterio para la eleccioacuten de la
teacutecnica maacutes eficaz se determinoacute en funcioacuten de la eficacia en la degradacioacuten y en la
reduccioacuten de la toxicidad Los resultados mostraron que aunque la creosota se redujo
considerablemente y sin diferencias significativas entre tratamientos la toxicidad del medio
permanecioacute alta durante todo el proceso La ausencia de diferencias significativas entre
tratamientos en cuanto a la eliminacioacuten de creosta se refiere indica que la comunidad
autoacutectona del suelo tiene mcroorgasnimos con capacidad degradadora aunque previamente
no hayan estado expuestos a HAP Las bajas temperaturas a las que se desarrolloacute el
experimento fue la causa de que la toxicidad del medio no se redujera Cabe destacar la
importancia de las identificaciones mediante teacutecnicas no cultivables de especies
pertenecientes a los geacuteneros Balneimonas y Pantoea previamente no descritas en procesos
de biodegradacioacuten de creosota o HAP
Resumen Metodologiacutea general
33
Metodologiacutea general
Todos los materiales y meacutetodos estaacuten descritos y con sus respectivas refrencias en cada
uno de los capiacutetulos que se indican a continuacioacuten Sin embargo en algunos casos y dado
que la publicacioacuten de los datos en muchos casos obliga a ajustarse a los formatos de cada
revista especializada algunos meacutetodos no se han explicado en detalle en los capiacutetulos Este
apartado ldquoMetodologiacutea generalrdquo tiene como objetivo profundizar en el fundamento de
algunos de los meacutetodos utilizados durante el desarrollo de este proyecto
Preparacioacuten de consorcios bacterianos
El consorcio bacteriano C2PL05 fue utilizado en los experimentos de los capiacutetulos que
componen esta tesis como consorcio degradador de HAP Este consorcio fue extraiacutedo de un
suelo croacutenicamente contaminado con HAP (Figura 2A) de una refineriacutea de petroacuteleo situada
en Puertollano Ciudad Real (Espantildea) Su capacidad degradadora se verificoacute en un cultivo
semicontinuo en matraces Erlenmeyer de 100 ml que conteniacutean 50 ml BHB con Tween-80
(1 vv) y naftaleno fenantreno (05 gmiddotlminus1) y antraceno (005 gmiddotlminus1) realizando refrescos del
medio cada 15 diacuteas
Cuando se indique (capiacutetulo 3) se preparoacute un consorcio de un suelo procedente de un
bosque (43ordm 4175acuteN 8ordm 0683acuteO Frgas do Eume Galicia Espantildea Figura 2B) totalmente
libre de contaminacioacuten por HAP al que se denominoacute BOS08 El suelo se obtuvo de la parte
maacutes superficial por lo que teniacutea un alto contenido en materia orgaacutenica y restos de madera
muerta
Figura 2 Suelo contaminado procedente de la refineriacutea (A) y suelo
procedente de bosque (B) de los cuales se extrajeron los consorcios
C2PL05 y BOS08 respectivamente
A B
Resumen Metodologiacutea general
34
Para la extraccioacuten de ambos consorcios bacterianos 1 g de suelo se resuspendioacute en
10 ml de solucioacuten salina PBS (pH 70) y se mantuvo en agitacioacuten constante a 150 rpm en
oscuridad y a 25ordmC durante 24 horas Posteriormente se formoacute un cultivo madre de cada
consorcio en 50 ml de BHB con la mezcla de HAP que se fuera a utilizar en el experimento
tween-80 (1 vv) como surfactante y 15 ml del extracto de cada consorcio Los cultivos se
incubaron en un agitador orbital a 150 rpm y 25ordmC hasta que alcanzara la fase exponencial
En este momento se inoculaba la cantidad de cultivo madre necesario en los microcosmos
de los experimentos en funcioacuten de la concentracioacuten de inoacuteculo deseada en los mismos
Disentildeos experimentales
En este apartado se explica el disentildeo y la composicioacuten de los experimentos que conforman
los capiacutetulos de esta tesis para facilitar su comprensioacuten Generalizando los capiacutetulos 1 (1a y
1b) y 2 tratan de optimizar el medio nutritivo suministrado al consorcio C2PL05 el tipo y
concentracioacuten de surfactante y otros factores ambientales para lo cual los microcosmos
eran cultivos liacutequidos incubados en Erlenmeyers en un agitador orbital Los capiacutetulos 3 y 4
se centran en el estudio de la biodegradacioacuten de HAP en sustrato soacutelido (arena de riacuteo y
suelo natural respectivamente) para reproducir en la medida de los posible las condiciones
naturales
En el capiacutetulo 1a se optimizaron 6 factores (3 posibles valores cada factor) de forma
individual y consecutiva En total se desarrollaron 18 tratamientos en cultivos liacutequidos (3
reacuteplicas) incubados en un agitador orbital a 150 rpm 25 ordmC y oscuridad (Figura 3) durante
168 horas En el capiacutetulo 1b el disentildeo ortogonal L18 (37) (21) permitioacute mediante el desarrollo
de 18 tratamientos (3 reacuteplicas cada uno) la optimizacioacuten de 8 factores 7 de ellos con 3
posibles valores (37) y un factor con dos valores (21) Un total de 54 cultivos se incubaron
durante 159 horas en las mismas condiciones que en el capitulo 1a variando la temperatura
seguacuten las necesidades del tratamiento En la Figura 4 y 5 se muestran los disentildeos
experimentales correspondientes a los capiacutetulos 1a y 1b respectivamente
Resumen Metodologiacutea general
35
Figura 3 Cultivos liacutequidos incubados en un agitador orbital
Optimizacioacuten
CNP
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
100101
1002116
100505
Optimizacioacuten
fuente de N
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
NaNO3
NH4NO3
(NH4)2SO3
Optimizacioacuten
fuente de Fe
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
FeCl3
Fe(NO3)3
Fe2(SO4)3
Optimizacioacuten
[Fe]
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
005 mM
01 mM
02 mM
Optimizacioacuten
pH
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
50
70
80
Optimizacioacuten
fuente de C
BHB tween-80
C2PL05
Naftaleno fenantreno
antraceno y glucosa (20 80 100)
X 3
HAP
HAPglucosa (5050)
Glucosa
2ordm 3ordm
4ordm 5ordm 6ordm
Figure 4 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 1a
Resumen Metodologiacutea general
36
Tordf
Optimizacioacuten CNP
OptimizacioacutenFuente N
OptimizacioacutenFuente Fe
Optimizacioacuten[Fe]
Optimizacioacuten[Tween-80]
Optimizacioacutendilucioacuten inoacuteculo
Optimizacioacutenfuente de C
20ordmC25ordmC30ordmC
1001011002116100505
NaNO3
NH4NO3
(NH4)2SO3
FeCl3Fe(NO3)3
Fe2(SO4)3
005 mM01 mM02 mM
CMC20 CMC
10-1
10-2
10-3
0100505020100
18 tratamientos
X 3
C2PL05Antraceno dibenzofurano pireno
BHB (modificado seguacuten tratamiento)
Figura 5 Disentildeo experimental correspondiente a al experimento que conforma el capiacutetulo 1b
En el capiacutetulo 2 se estudioacute la capacidad de degradacioacuten y la evolucioacuten del consorcio
C2PL05 en dos tratamientos (cada uno en triplicado) uno adicionado con Tween-80 y otro
con Tergitol NP-10 (1 vv) como surfactantes En total 6 cultivos liacutequidos se incubaron a
150 rpm 25 ordmC y oscuridad durante 45 diacuteas como se muestra en la Figura 3 El disentildeo
experimental de este capiacutetulo se resume graacuteficamente en la Figura 6
Tratamiento 1con Tween-80
Tratamiento 2con Tergitol NP-10
C2PL05BHB-Tergitol NP-10 (1)Naftaleno fenantreno antraceno
X 3
X 3
C2PL05BHB-Tween-80 (1)Naftaleno fenantreno antraceno
Figura 6 Disentildeo experimental correspondiente al experimento que conforma
el capiacutetulo 2
Resumen Metodologiacutea general
37
El capiacutetulo 3 se desarrolloacute en microcosmos con 90 g de arena de riacuteo esterilizada
(Figura 7) e incinerada en una mufla a 300 ordmC para eliminar cualquier tipo de
microorganismos o materia orgaacutenica que pudiera contener Se realizaron 4 tratamientos
distintos en funcioacuten de la temperatura de incubacioacuten (5-15 ordmC o 15-25 ordmC) y del consorcio
inoculado (C2PL05 o BOS08) cada tratamiento con tres reacuteplicas para cada uno de los 5
tiempos de muestreo lo que supuso un total de 60 microcosmos (Figura 8) Los nutrientes
se suministraron antildeadiendo 18 ml de medio BHB que proporcionaba una humedad relativa
del 60 y que ademaacutes conteniacutea Tween-80 (1 vv) Los microcosmos se inocularon con
35 ml de un cultivo madre del consorcio C2PL05 oacute BOS08 y se incubaron en caacutemaras bajo
condiciones controladas de temperatura (seguacuten tratamiento) humedad (60 constante) y
luz (16 horas de luz8 horas oscuridad)
Figura 7 Microcosmos del experimento para el capiacutetulo 3 en caacutemara de crecimiento
Resumen Metodologiacutea general
38
Tratamiento 1
Tratamiento 2
Tratamiento 3
Tratamiento 4
C2PL0515-25ordmCBHB oacuteptimoNaftaleno fenantreno antracenopireno y perileno
C2PL055-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS0815-25ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS085-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
X 3
X 3
X 3
X 3
X 5 tiempos
X 5 tiempos
X 5 tiempos
X 5 tiempos
TOTAL = 60 MICROCOSMOS
Figura 8 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 3
El experimento que compone el capiacutetulo 4 de biorremediacioacuten in situ se desarrolloacute
bajo condiciones ambientales externas en una zona del campus preparada para ello Como
sustrato se utilizoacute suelo natural extraiacutedo de los primeros 20 cm y tamizado con una maya lt
2 mm El sustrato se depositoacute en bandejas de plaacutestico para evitar que el agente
contaminante se filtrara al suelo y se protegioacute de la lluvia tal y como se observa en la Figura
9 Cada uno de los cinco tratamientos (control atenuacioacuten natural bioestimulacioacuten
bioaumento y bioestimulacioacuten junto con bioaumento) se hizo en duplicado para cada uno de
los 4 muestreos realizados durante los 8 meses de experimentacioacuten (octubre-junio) Cada
microcosmos (bandeja) conteniacutea 550 g de suelo humedecidos (40) con agua o BHB como
fuente de nutrientes en el caso de los tratamientos con bioestimulacioacuten Los tratamientos
bioaumentados se enriquecieron con 5 ml de un cultivo madre del consorcio C2PL05 Como
agente contaminante se utilizoacute creosota antildeadiendo 25 ml de una disolucioacuten de creosota en
Resumen Metodologiacutea general
39
n-hexano (25 g creosota por bandeja) a todos los tratamientos excepto al control Resumen
del disentildeo en la Figura 10
Figura 9 Experimento para el capiacutetulo 4 bajo condiciones ambientales
externas en el Campus de la Universidad Rey Juan Carlos Moacutestoles
Tratamiento 1 Control
Tratamiento 2 Atenuacioacuten
natural
Tratamiento 3 Bioestimulacioacuten
Tratamiento 4 Bioaumento
Tratamiento 5 Bioestimulacioacuten
y Bioaumento
Suelo sin contaminar X 4 tiempos
CreosotaH2O-Tween-80 X 4 tiempos
CreosotaBHB oacuteptimo-Tween-80 X 4 tiempos
CreosotaH20 ndash Tween-80 X 4 tiemposC2PL05
CreosotaBHB oacuteptimo-Tween-80 X 4 tiemposC2PL05
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
TOTAL = 40 MICROCOSMOS
Figura 10 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 4
Resumen Metodologiacutea general
40
Anaacutelisis fiacutesico-quiacutemicos
La caracterizacioacuten del suelo contaminado del cual se extrajo el consorcio C2PL05 asiacute como
la explicacioacuten de las teacutecnicas y metodologiacuteas empleadas se detallan en Molina et al (2009)
No obstante en la Tabla 1 se presentan las propiedades fiacutesico-quiacutemicas de dicho suelo
contaminado
Tabla 1 Propiedades fisico-quiacutemicas y bioloacutegicas del suelo contaminado con HAP
Propiedades Unidades Media plusmn ES
Tamantildeo medio de partiacutecula μm3 291 plusmn 6 Composicioacuten (arenaslimosarcillas) v 291009000 plusmn 03603600
pH - 77 plusmn 01
Conductividad μSmiddotcm-1 74 plusmn 22
WHCa v 33 plusmn 7
(NO3)- μgmiddotKg-1 40 plusmn 37
(NO2)- μgmiddotKg-1 117 plusmn 01
(NH4)+ μgmiddotKg-1 155 plusmn 125
(PO4)3- μgmiddotKg-1 47 plusmn 6
Carbono total v 96 plusmn 21
TOCb (tratamiento aacutecido) v 51 plusmn 04
MPNc (heteroacutetrofos) x104 ceacutelulasmiddotg-1 97 plusmn 12
MPNc (degradador de HAP) x103 ceacutelulasmiddotg-1 93 plusmn 19
Toxicity EC50d gmiddot100ml-1 144 plusmn 80
Hidrocarburos extraiacutedos w 92 plusmn 18
a Capacidad de campo del agua (WHC Water holding capacity) maacutexima cantidad de agua que
puede contener un suelo b Carbono orgaacutenico total (TOC total organic carbon) c Nuacutemero maacutes
probable (MPN most probably number) teacutecnica cultivo-dependiente que estima el nuacutemero de
ceacutelulas capaces de crecer con una determinada fuente de carbono (ver apartado Anaacutelisis
bioloacutegicos) d EC50 es una medida de la eficacia de una determinada sustancia o de su toxicidad
y representa la cantidad de un compuesto necesaria para disminuir al 50 una funcioacuten En
nuestro caso indica la toxicidad del medio que disminuye a la mitad la actividad microbiana del
consorcio
La metodologiacutea utilizada para la extraccioacuten de HAP (capiacutetulos 1 2 y 3) y creosota
(capiacutetulo 4) se detalla en el apartado de material y meacutetodos de los capiacutetulos
correspondientes La cromatografiacutea liacutequida de alto rendimiento (HPLC high-performance
liquid chromatography) fue la teacutecnica utilizada para el anaacutelisis de los HAP en los capiacutetulos 1
y 2 siguiendo el protocolo descrito por Bautista et al (2009) El equipo de anaacutelisis HPLC
(Prestar 230 Varian Palo Alto CA USA) esta compuesto por una columna C18 en fase
reversa Luna C18 (2) (75 cm longitud x 46 mm diaacutemetro interno y 3 μm tamantildeo de partiacutecula
Phenomenex Torrance CA USA) y conectado a una matriz de fotodiodos de UVVis
Resumen Metodologiacutea general
41
(ultravioletavisible) y un detector de fluorescencia La fase moacutevil utilizada se compone de un
gradiente acetonitriloagua programado como se detalla a continuacioacuten gradiente isocraacutetico
6040 (0-2 min) gradiente de 7525 (2-14 min) gradiente isocraacutetico 7525 (14-15 min)
gradiente de 1000 (15-16 min) El volumen de inyeccioacuten de muestra es de 10 μl y el flujo de
elusioacuten en la columna de 08 mlmiddotmin-1 La deteccioacuten de los HAP se realiza a 254 nm El
posterior tratamiento de los datos se detalla en los respectivos capiacutetulos
El meacutetodo para la deteccioacuten de HAP en el capiacutetulo 3 y de creosota en el capitulo 4 fue
la cromatografiacutea de gases (GC Gas Chromatography) utilizando un cromatoacutegrafo de gases
(system Varian 3900 Palo Alto CA USA) con un detector con ionizador de llama (FID
Flame Ionization Detector) La metodologiacutea protocolo y posterior tratamiento de los datos se
detallan en el material y meacutetodos de los respectivos capiacutetulos
Anaacutelisis bioloacutegicos
La densidad celular es una teacutecnica utilizada en todos los ensayos que componen esta tesis y
por tanto la metodologiacutea y el posterior tratamiento de los datos estaacuten detalladamente
descritos en todos los manuscritos que conforman los capiacutetulos de la tesis
Las teacutecnicas cultivo dependientes desarrolladas en los ensayos han sido el NMP
descrito en los capiacutetulos 2 3 y 4 y el aislamiento de colonias aplicando la metodologiacutea
empleada por Molina et al (2009) y descrita en los capiacutetulos 2 y 3
Teacutecnicas moleculares
Extraccioacuten y amplificacioacuten de ADN
La extraccioacuten de ADN de muestras de cultivos liacutequidos y muestras de biomasa de una
colonia aislada (capiacutetulos 2 y 3) se realizoacute usando el kit de extraccioacuten fiacutesico-quiacutemico de ADN
bacteriano Microbial DNA isolation Kit (Laboratorios MoBio Solano Beach CA USA) Para
la extraccioacuten de ADN total de muestras de suelo (capiacutetulos 3 y 4) se usoacute el kit de extraccioacuten
fiacutesico-quiacutemico Power Soil DNA kit (Laboratorios MoBio Solano Beach CA USA) siguiendo
en ambos casos el protocolo recomendado por el fabricante
Resumen Metodologiacutea general
42
Para la amplificacioacuten de las secuencias de ADN se utilizaron varias parejas de
cebadores en funcioacuten de la teacutecnica posterior de anaacutelisis del producto de PCR La
amplificacioacuten del ADN se realizoacute con el fin de identificar las secuencias de las cepas
aisladas o para un posterior anaacutelisis del ADN total de una muestra mediante electroforesis
en gel con gradiente desnaturalizante (DGGE denaturing gradient gel electrophoresis)
Cuando fue necesario reamplificar material geneacutetico procedente de una banda de DGGE la
pareja de primers utilizada no presentaba cola de GC (guanina-citosina) En la Tabla 2 se
describen las caracteriacutesticas de los cebadores y en la Figura 11 se detallan las condiciones
del programa correspondiente a cada pareja de cebadores
Tabla 2 Caracteriacutesticas de los cebadores utilizados para la amplificacioacuten de ADN por PCR
Cebador Secuencia 5acute--3acute Nordm de bases
Tordf hibridacioacuten
(ordmC)
Programa de PCR (Figura
Teacutecnica de anaacutelisis del producto de
16F27 AGAGTTTGATCMTGGCTCAG 20 55 I Purificacioacuten Secuenciacioacuten16R1488 CGGTTACCTTGTTACGACTTCAGG 24 55 I
16F341 CCTACGGGAGGCAGCAG 17 54 II DGGE Clonacioacuten Ecoli 16R907 CCGTCAATTCCTTTRAGTTT 20 54 II
16F338 CTCCTACGGGAGGCAGCAG 19 55 II DGGE Clonacioacuten Ecoli 16R518 CGTATTACCGCGGCTGCTGG 20 55 II
ITS1F CTTGGTCATTTAGAGGAAGTAA 20 54 III Presencia material geneacutetico ITS4 TCCTCCGCTTATTGATATGC 20 54 III
Primer con posibilidad de antildeadir una secuencia de 40 bases (5acute-CGC CCG CCG CGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) rica en guanina (G) y citosina(C) unida al extremo 5acute- del
cebador necesaria para electroforesis en gel con gradiente desnaturalizantede
Resumen Metodologiacutea general
43
Figura 11 Condiciones de los programas de PCR I II y III a) Paso en el cual se procede a la
activacioacuten del principio activo de la polimerasa ExTaq-HS a una Tordf de activacioacuten de 94ordmC b) Tordf de
desnaturalizacioacuten c) Tordf de hibridacioacuten d) Tordf de polimerizacioacuten e) Tordf de extensioacuten f) Tordf final y de
conservacioacuten del producto de PCR
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 5 min
95 ordmC 1 min
54 ordmC 05 min
72 ordmC 15 min
72 ordmC 10 min
30 CICLOS
PROGRAMA PCR III
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR II
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
94 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR I
Resumen Metodologiacutea general
44
Electroforesis en gel con gradiente de desnaturalizacioacuten (DGGE) y clonacioacuten en
Escherichia coli
El estudio de la comunidad bacteriana se realizoacute mediante la teacutecnica DGGE ampliamente
descrita en los capiacutetulos 2 3 y 4 Las bandas maacutes predominantes fueron extraiacutedas del gel
eluiacutedas en de agua esterilizada y almacenadas a -20 ordmC para su posterior reamplificacioacuten y
clonacioacuten Las imaacutegenes de DGGE se analizaron graacutefica y estadiacutesticamente para diferenciar
entre las comunidades objeto de estudio y la influencia de los tratamientos en los cambios
de una comunidad El anaacutelisis graacutefico mediante el programa UN-Scan-It (v 60 Silk Scientific
US) permitioacute identificar el porcentaje de abundancia de cada banda con respecto de una
comunidad
La clonacioacuten en Ecoli se empleoacute debido a la imposiblidad de reamplificar el ADN
contenido en una banda cortada del gel de DGGE La metodologiacutea empleada para el
desarrollo de esta teacutecnica en los capiacutetulos 2 3 y 4 es la recomendada por el fabricante del
kit utilizado pGEM-T Easy Vector System II (Pomega)
Alineamiento de secuencias y anaacutelisis filogeneacuteticos
Las secuencias fueron editadas utilizando el programa Chromas Pro v142 que permite
ademaacutes visualizar y modificar posibles ambiguumledades en los nucleoacutetidos Las secuencias
fueron descargadas en las bases de datos disponibles (Genbank
(httpwwwncbinlmnihgovgenbank) y Ribosomal Sequence Data
(httprdpcmemsueduseqmatchseqmatch_introjsp)) a traveacutes de la opcioacuten BLAST con el
fin de aproximarnos a la identificacioacuten molecular de los organismos La secuencias fueron
alineadas utilizando el programa Bioedit v709 y posteriormente se elaboroacute una matriz de
datos a partir de la cual se establecieron las posibles relaciones filogeneacuteticos entre las
secuencias problema y aquellas descargadas de las bases de datos El programa utilizado a
tal efecto fue PAUP 40B10 (Swofford 2003)
Se utilizaron dos tipos de anaacutelisis para estimar las relaciones filogeneacuteticas y la
fiabilidad de las topologiacuteas obtenidas Por un lado se utilizoacute la Maacutexima Parsimonia estaacutendar
(Maxima Parsimonia de Fitch MP) un meacutetodo que elige el aacuterbol que requiere el menor
nuacutemero de cambios evolutivos para explicar las relaciones entre taxones a partir de la
informacioacuten generada por los sitios informativos el valor relativo de los diferentes caracteres
y de sus transformaciones Para evaluar la fiabilidad de las relaciones establecidas por
parsimonia se selecciono el meacutetodo Bootstraping (Felsenstein 1985) donde los caracteres
Resumen Metodologiacutea general
45
de las matrices se combinan al azar con las repeticiones necesarias considerando los
paraacutemetros establecidos en el anaacutelisis de parsimonia Asiacute el porcentanje con que aparece
un determinado grupo es una medida de la bondad de dicho grupo o rama Por otro lado la
diferencia entre secuencias (distancia geneacutetica) se computoacute en teacuterminos de nuacutemero de
nucleoacutetidos diferentes por sitio entre secuencias realizando un anaacutelisis de neighbour-joining
de acuerdo al algoritmo de Jukes amp Cantor (1969) Ambos tipos de anaacutelisis se llevaron a
cabo usando el software PAUP 40B10 (Swofford 2003)
Anaacutelisis estadiacutesiticos
Todos los capiacutetulos se disentildearon de forma que tras la finalizacioacuten del experimento los datos
pudieran ser tratados estadiacutesticamente El tratamiento estadiacutestico y los anaacutelisis realizados
con los datos de los ensayos estaacuten descritos en el apartado correspondiente de los
manuscritos que componen los artiacuteculos de la presente tesis Es necesario explicar
detalladamente el experimento que compone el capiacutetulo 1b disentildeado con un experimento
ortogonal del tipo L18 (37) (21) seleccionado del modulo de Statistica (Version 60) Este tipo
de disentildeo permitioacute hacer una combinacioacuten de muacuteltiples factores de forma reducida Es decir
un total de 18 experimentos representan todas las combinaciones posibles que se pueden
dar entre 8 factores siete de los cuales pueden tomar tres valores (37) diferentes (ej factor
Tordf valores 30ordmC 25ordmC y 20ordmC) y uno de ellos con dos valores (21) (ej factor concentracioacuten
de surfactante valores CMC y +20 CMC)
Para visualizar cambios en las comunidades microbianas (patrones univariantes) en
cada combinacioacuten de factores (ej tiempo tipo de consorcio temperatura) se realizoacute una
ordenacioacuten multivariante mediante un escalamiento multidimensional no-meacutetrico (MDS non-
parametric Multidimensional Scaling) usando el programa PRIMER (Clarke 1993) Este tipo
de anaacutelisis se realizoacute en los capiacutetulos 3 y 4 La ordenacioacuten se hizo sobre la base de la matriz
de dismilaridad de Bray-Curtis construida a partir de la transformacioacuten de los datos de
abundancia por la raiacutez cuarta para minimizar la influencia de los valores maacutes extremos
(Clarke 1993 Martiacuten Guirao 2007) Se usoacute el procedimiento SIMPER (Clarke 1993) para
identificar el porcentaje de contribucioacuten de cada banda a la disimilitud entre tratamientos
establecida en la matriz de Bray-Curtis Las bandas se consideraron influyentes cuando su
contribucioacuten se encontraba dentro de los primeros 70 (capiacutetulo 2) 60 (capiacutetulo 3) o 50
(capiacutetulo 4 Viejo 2009) del porcentaje medio de similaridaddisimilaridad acumulado entre y
dentro de la combinacioacuten de factores El criterio aplicado para escoger el porcentaje de
contribucioacuten limite se hizo en funcioacuten de la riqueza de bandas de forma que cuanto menor
fuera este paraacutemetro mayor el porcentaje liacutemite
Capiacutetulo
Publicado en Water Air amp Soil Pollution (2011) 217 365-374
Simarro R Gonzaacutelez N Bautista LF Sanz R amp Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene and
anthracene) biodegradation process by a bacterial consortium
Optimizacioacuten de los principales factores abioacuteticos de un proceso de biodegradacioacuten
de HAP (naftaleno fenantreno y antraceno) por un consorcio bacteriano
1a
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
49
Abstract
The aim of this work is to determine the optimum values for the biodegradation process of six
abiotic factors considered very influential in this process The optimization of a polycyclic
aromatic hydrocarbons (naphthalene phenanthrene and anthracene) biodegradation
process was carried out with a degrading bacterial consortium C2PL05 The optimized
factors were the molar ratio of carbonnitrogenphosphorus (CNP) the nitrogen source the
iron source the iron concentration the pH and the carbon source Each factor was optimized
applying three different treatments during 168 h analyzing cell density by spectrophotometric
absorbance at 600 nm and PAH depletion by HPLC To determine the optimum values of the
factors an analysis of variance (ANOVA) was performed using the cell density increments
and biotic degradation constants calculated for each treatment The most effective values of
each factor were a CNP molar ratio of 1002116 NaNO3 as nitrogen source Fe2(SO4)3 as
iron source using a concentration of 01 mmolmiddotl-1 a pH of 70 and a mixture of glucose and
PAH as carbon source Therefore high concentration of nutrients and soluble forms of
nitrogen and iron at neutral pH favour the biodegradation Also the addition of glucose to
PAH as carbon source increased the number of total microorganism and enhanced the PAH
biodegradation due to augmentation of PAH degrader microorganisms It is also important to
underline that the statistical treatment of data and the combined study of the increments of
the cell density and the biotic biodegradation constant has facilitated the accurate
interpretation of the optimization results For an optimum bioremediation process is very
important to perform these previous bioassays to decrease the process development time
and so the costs
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
51
Introduction
Polycyclic aromatic hydrocarbons (PAH) are persistent organic compounds with two or more
aromatic rings They are formed by incomplete combustion of fossil fuels and pyrolysis of
organic matter derived from human activities and as a result of natural events like forest fires
The toxic mutagenic and carcinogenic properties of PAH have concerned the Unites States
Environmental Protection Agency (US-EPA) proposing some of them as priority pollutants
(including naphthalene phenanthrene and anthracene) In addition the PAH solubility is very
low in aqueous medium (Luning Prak amp Pritchard 2002) affecting their degradation and
biomagnification within the ecosystems The microbial bioremediation removes or
immobilizes the pollutants reducing toxicity with a very low environmental impact Generally
microbial communities present in PAH contaminated soils are enriched by microorganisms
able to use them as only carbon source (Heitkamp amp Cerniglia 1988 Gallego et al 2007)
However this process can be affected by a few key environmental factors (Roling-Wilfred et
al 2002) that may be optimized to achieve a more efficient process The molar ratio of
carbon nitrogen and phosphorus (CNP) is very important for the metabolism of the
microorganisms and so for PAH degradation (Bossert amp Bartha 1984 Alexander 1994
Kwok amp Loh 2003) The molar ratio 100101 is frequently considered optimal for
contaminated soils (Bossert amp Bartha 1984 Alexander 1994) while other author have
reported negative or non-effects (Chaicircneau et al 2005) According to Leys et al (2005)
these contradictory results are due to the nutrients ratio required by PAH degrading bacteria
depends on environmental conditions type of bacteria and type of hydrocarbon In addition
the chemical form of those nutrients is also important being the soluble forms (ie iron or
nitrogen in form of phosphate nitrate and ammonium) the most frequent and efficient due to
their higher availability for microorganisms Depending on the microbial community and their
abundance another factor that may improve the PAH degradation is the addition of readily
assimilated such as glucose carbon sources (Zaidi amp Imam 1999)
Moreover the pH is an important factor that affects the solubility of both PAH and
many chemical species in the cultivation broth as well as the metabolism of the
microorganisms showing an optimal range for bacterial degradation between 55 and 78
(Bossert amp Bartha 1984 Wong et al 2001)
In general bioremediation process optimization may be flawed by the lack of studies
showing the simultaneous effect of different environmental factors Hence our main goal was
to set up the optimum values of six abiotic factors CNP molar ratio nitrogen source iron
source iron concentration pH and carbon source for the biodegradation of three PAH
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
52
(naphthalene phenanthrene and anthracene) at 25 ordmC In order to achieve the main objective
we analyzed the effects of the above factors on the microbial growth and the biotic
degradation rate
Materials and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all gt99 purity) were purchased from Sigma-
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) The consortium C2PL05
was not able to degrade PAH significantly without the addition of surfactants (data not
shown) Therefore surfactant Tween-80 (Sigma-Aldrich Steinheim Germany) was selected
as the most efficient biodegradable and non-toxic surfactant (Bautista et al 2009) for the
consortium C2PL05 Bushnell Haas Broth medium (BHB) was purchased from Panreac
(Barcelona Spain) and its composition is 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-
1 KHPO4 1 gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 This base composition was
modified in each experiment as required
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1g of soil (lt 2 mm) was resuspended in 10 ml
of phosphate buffer saline (PBS) and incubated during 12 h in an orbital shaker (Innova 40
New Brunswick Scientific Edison NJ USA) at 150 rpm and 25ordmC under dark conditions
After that 15 ml of the supernatant was inoculated in 50 ml of BHB broth (pH 70) 1 wt
Tween-80 as surfactant and naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1)
as carbon source The culture was incubated at 150 rpm and 25ordmC under dark conditions
until the exponential phase was completed This was confirmed by monitoring the cell density
by absorbance at 600 nm in a spectrophotometer (Spectronic GenesysTM UK) Then the
consortium was stored at 4 ordmC to stop its growth At the beginning of each experiment 500 μl
of the stored consortium was inoculated into the fermentation flasks To identify the microbial
consortium C2PL05 colonies from aliquots of the soil extract were isolated in BHB agar
plates with PAH as only carbon source to confirm that these colonies were PAH degraders
Eight colonies were isolated and transferred onto LB-glucose agar plates in order to increase
microbial biomass for DNA extraction Total DNA of the colonies was extracted using
Microbial DNA isolation kit (MoBio Laboratories) Amplification of the 16S rRNA coding
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
53
region of the DNA was performed as described by Vintildeas et al (2005) using the primers
16F27 and 16R1488 Sequences were edited and assembled using BioEdit 487 software
(Hall 1999) All isolated strains of the consortium C2PL05 were γ-proteobacteria and the
genera present were Enterobacter Pseudomonas and Stenotrophomonas In addition non
culture-dependent molecular techniques as denaturant gradient gel electrophoresis (DGGE)
was performed to know the total biodiversity of the microbial consortium C2PL05 16S rRNA
gen was amplified using the primers 341F-GC and 907R (GC clamp 5acute-CGC CCG CCG
CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995) About 6 of
polyacrylamide (3751 acrylamidebisacrylamide) gels with a 30-60 urea-formamide
denaturant gradient and 075 mm were used in 1xTAE buffer at 200V for 4h at 60 ordmC The
bands were excised and reamplificated to identify the DNA The two genera identified
coincided with genera Pseudomonas and Stenotrophomonas identified by culture-dependent
techniques (more details in Molina et al 2009)
Experimental design
A total of 6 abiotic factors were evaluated To obtain an optimum value three treatments
each in triplicate were performed for each factor The replicates were carried out in 100 ml
Erlenmeyer flasks with 50 ml of BHB medium (pH 70) Tween-80 (1wt) naphthalene
phenanthrene and anthracene (each at 500 mgmiddotl-1) and 500 microl of the C2PL05 consortium
The concentration of the inoculum was 315x106 cells ml-1 of the heterotrophic microorganism
and 695x105 cells ml-1 of the PAH degrading microorganism The number of the
microorganisms capable to degrade any carbon source present in the medium (heterotrophic
microorganisms) and microorganisms capable to degrade PAH as sole carbon source (PAH-
degrading bacteria) were measured by the most probably number (MPN) method (Wrenn amp
Venosa 1996) LB-glucose broth and BHB medium were used to determine heterotrophic
microorganism and PAH degrading microorganism respectively To maintain the same initial
number of cells in each experiment the absorbance of the inoculum was measured and
diluted if necessary before inoculation to reach an optical density of 16 AU The replicates
were incubated in an orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA)
at 150 rpm and 25 ordmC under dark conditions Previous to inoculate the consortium the
Erlenmeyer flasks were shacked overnight to solubilize most of the PAH Samples were
withdrawn at 0 15 24 39 48 64 72 159 and 168 h to monitor the PAH depletion and cell
growth
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
54
Treatment conditions
Composition of BHB base was 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-1 KHPO4 1
gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 The compounds MgSO4 and CaCl2 and their
concentration were constant for all treatments and KHPO4 and K2HPO4 were modified only in
concentration The other components were modified both the concentration and compounds
according to the requirements of the optimized factors PAH at 1500 mgmiddotl-1 (500 mgmiddotl-1 of
naphthalene phenathrene and anthracene) was used as carbon source for all treatments
except for those in which the carbon source was optimized and PAH were mixed with
glucose in a proportion of 50 PAH-glucose or only glucose was added In all cases an
overall carbon concentration of 01176 mmoll-1 was used Once a factor was optimized its
optimum value was kept for the subsequent factor optimization
The levels of each factor studied were selected as described below For the CNP
molar ratio the values employed were 100101 frequently described as optimal (Bossert
and Bartha 1984) 100505 and 1002116 To optimize the nitrogen source NaNO3
NH4(NO3) and (NH4)2SO3 were used The optimal iron source was selected amongst FeCl3
Fe(NO3)3 and Fe2(SO4)3 The concentration levels of the optimal iron form were 005 01 and
02 mmoll-1 and three different pH values were also tested 50 70 and 80 The effect of the
carbon source was determined by adding PAH as only carbon source PAH and glucose
(50 of carbon atoms from each source) or glucose as only carbon source
Bacterial growth
Bacterial growth during the PAH degradation process was monitored at 0 15 24 39 48 64
72 159 and 168 h by spectrophotometric absorbance of the culture media at 600 nm in a
UV-Vis spectrophotometer (Spectronic GenesysTM UK) From the above optical density data
the average of the cell density increments (CDI) was calculated by applying the following
equation
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
55
Kinetic degradation
Naphthalene phenanthrene and anthracene concentrations in the culture media were
analysed using a ProStar 230 HPLC system (Varian Palo Alto CA USA) with a reverse
phase C18 column following the method described in Bautista et al (2009) The
concentration of each PAH was calculated from a standard curve based on peak area using
the absorbance at 254 nm Depletion rate of each PAH (-ri) during the experiments was fitted
to a first order kinetic model (Equation 2)
iBiiAii
i CkCkdt
dCr Eq 2
where C is the concentration of the corresponding PAH kA is the apparent first-order
kinetic constant due to abiotic processes kB is the apparent first-order kinetic constant
due to biological processes t is the time elapsed and the subscript i corresponds to
each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1 wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40 New Brunswick Scientific Edison
NJ USA) at 150 rpm and 25 ordmC under dark conditions PAH concentration in the control
experiment were analysed using the HPLC system described previously The values of kA for
each PAH was calculated by applying eq 2 considering kB asymp 0 since no bacterial consortium
was inoculated
Statistical analysis
In order to evaluate the effects of the treatments on the kinetic biodegradation constant (kB)
and cell density increments (CDI) bifactorials analysis of variance (ANOVA) were used The
variances were checked for homogeneity by applying the Cochranacutes test When indicated
data were transformed to homogenize variances Student-Newman-Keuls (SNK) test was
used to discriminate among different treatments after significant F-test All tests were
performed with the software Statistica 60 for Windows
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
56
Results
Control experiments (Figure 1) show that phenathrene and anthracene concentration was
not affected by any abiotic process since no depletion was observed along the experiment
so that kA asymp 0 h-1 However in the case of naphthalene some degree of abiotic depletion was
measured during the controls yielding an apparent first-order abiotic rate constant of 27x10-
3 plusmn 7x10-5 h1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the optimisation experiments
0 100 200 300 400 500 600 700
20
40
60
80
100
Rem
aini
ng P
AH
(
)
Time (hour)
Figure 1 Naphthalene ( ) phenathrene ( ) and anthracene ( )
depletion due to abiotic processes in control experiments
Table 1 Analysis of variance (ANOVA) summary for the cell density increments (CDI) and the
biotic degradation constant (kB) MS is the means of squares and df degrees of freedom
CDI kB
Factor df MS F-value p-value df MS F-value p-value
CNP ratio 2 27middot10-1 238 4 57middot10-2 566 Error 6 11middot10-2 18 10middot10-3
N source 2 21middot10-1 234 4 90middot10-6 113
Error 6 10middot10-2 18 70middot10-7
Fe source 2 18middot10-2 51 4 30middot10-6 43
Error 6 36middot10-3 18 70middot10-8
Fe Concentration 2 45middot10-1 348 006 4 30middot10-6 38
Error 6 95middot10-2 18 10middot10-7
pH 2 30middot10-2 1103 4 15middot10-4 5
Error 6 27middot10-3 18 33middot10-5
GlucosePAHs 2 54middot10-1 45401 2 66middot10-4 7
Error 6 12middot10-3 12 93middot10-5
a Logarithmically transformed data to achieve homogeneity of variance
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
57
Cell density increments of the consortium for three different treatments of CNP molar
ratio are showed in Figure 2A According to statistical analysis of CDI there was significant
differences between CNP molar ratio (F26 = 238 p lt 001 Table 1) and SNK showed that
treatments with molar ratios of 100101 and 1002116 reached larger increases With
regard to the kinetic biodegradation constant (kB) the interaction between kB of the
treatments with each hydrocarbon was significant (F418 = 57 p lt 0001 Table 1) The SNK
test (Figure 2B) showed that the treatment 1002116 with naphthalene yielded the highest
value whereas the lowest were achieved with 100505 and 100101 for anthracene and
phenanthrene In addition within each PAH group the highest values were observed with
1002116 molar ratio Therefore although there are no differences for CDI between ratios
100101 and 1002116 1002116 molar ratio is the most effective for the PAH degradation
so that this ratio was considered as the optimal
171819202122232425
100101 1002116100505
bb
a
A
CNP molar ratio
CD
I
Naphthalene Phenanthrene Anthracene-35
-30
-25
-20
-15
-10
-05
00B
d
g
e
bc
f
ab
f
Log
k B (
h-1)
Figure 2 (A) Cell density increments of the consortium C2PL05 with the treatments 100505
100101 and 1002116 Error bars show the standard error (B) Differences between treatments
(100101 100505 and 1002116 ) and PAHs in the biodegradation kinetic constant (kB)
The letters show differences between groups (p lt 005 SNK) and the error bars the standard
deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
58
Figure 3A shows that the three different nitrogen sources added had significant effects
on CDI (F26 = 234 p lt 001 Table 1) The SNK test shows that the addition of NaNO3
significantly improved CDI The interaction between PAH and the nitrogen sources were
significant (F418 = 113 p lt 0001 Table 1) and the highest kB values were achieved with
NaNO3 for naphthalene phenanthrene and anthracene (Figure 3B) According to these
results NaNO3 is considered as the best form to supply the nitrogen source for both PAH
degradation and growth of the C2PL05 consortium
19
20
21
22
23
24
25
(NH4)
2SO
4NH4NO
3NaNO
3
a
b
a
A
Nitrogen source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
Bf
ba
e
bcb
dbc
a
kB (
h-1)
Figure 3 (A) Cell density increments of the consortium C2PL05 with the treatments NaNO3 NH4NO3
and (NH4)2SO4 Error bars show the standard error (B) Differences between treatments (NaNO3
NH4NO3 and (NH4)2SO4 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
59
CDI of the treatments performed with three different iron sources (Figure 4A) were
significantly different (F26 = 51 p lt 005 Table 1) Although no significant differences
between adding Fe2(SO4)3 or Fe(NO3)3 were observed the addition of Fe2(SO4)3 contributes
more to CDI than FeCl3 The kB (Figure 4B) showed significant differences in the interaction
between PAH and the different iron sources (F418 = 43 p lt 0001 Table 1) The highest kB
values were observed with Fe2(SO4)3 for the degradation of phenanthrene followed by FeCl3
degrading naphthalene and phenanthrene The lowest values of kB were observed with
Fe(NO3)3 degrading naphthalene and anthracene Nevertheless the most recalcitrant PAH
(phenanthrene and anthracene) showed the highest kB values with Fe2(SO4)3 in agreement
with the highest CDI values also obtained with Fe2(SO4)3
168
172
176
180
184
188
192
196
Fe(NO3)
3 Fe2(SO
4)
3FeCl
3
ab
b
a
A
Iron source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
B
c
a
b
c
b
d
b
a a
k B
(h-1
)
Figure 4 (A) Cell density increments of the consortium C2PL05 with the treatments FeCl3 Fe(NO3)3
and Fe2(SO4)3 Error bars show the standard error (B) Differences between treatments (FeCl3
Fe(NO3)3 and Fe2(SO4) ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
60
Concerning the effect of the iron concentration (Figure 5) supplied in the form of the
optimal Fe2(SO4)3 no significant differences in CDI were found for all three concentration
used (F26 = 348 p = 006 Table 1 Figure 5A) However the interaction between iron
concentration and kB of three PAH was significant (F418 = 38 p lt 0001 Table 1) reaching
the highest values for kB by using an iron concentration of 01 mmoll-1 degrading
naphthalene and phenanthrene (Figure 5B) The lowest values of kB were observed with 005
mmoll-1 and 02 mmoll-1 degrading phenanthrene and anthracene (Figure 4B) Since each
PAH showed the highest kB with 01 mmoll-1 this iron concentration was considered as the
most efficient for the PAH biodegradation process
005 01 02
38
40
42
44
46
48
50
a
a
a
A
Iron concentration (mmol l-1)
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
B
c
f
d
b
e
d
cb
a
k B (
h-1)
Figure 5 (A) Cell density increments of the consortium C2PL05 with the treatments 005 mmolmiddotl-1 01
mmolmiddotl-1 and 02 mmolmiddotl-1 Error bars show the standard error (B) Differences between treatments
(005 mmolmiddotl-1 01 mmolmiddotl-1 and 02 mmolmiddotl-1 ) and PAHs in the biodegradation kinetic
constant (kB) The letters show differences between groups (p lt 005 SNK) and the error bars the
standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
61
With reference to pH Figure 6A and statistical analysis (F26 = 1103 p lt 001 Table 1)
clearly show that the neutral pH of the medium favour the CDI of the consortium The kB of
the three different treatments (Figure 6B) also showed significant differences in the
interaction (F49 = 5 p lt 005 Table 1) The highest value of kB was observed for anthracene
degradation at neutral pH (Figure 6B) The other two PAH naphthalene and phenanthrene
did not show significantly differences between any treatments Therefore given that the
highest values of both parameters (CDI and kB) were observed at pH 7 this value will be
considered as the most efficient for the PAH biodegradation process
5 7 8
215
220
225
230
235
240
245
a
b
a
A
pH
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
25x10-2
30x10-2
B
b
a
ab ab
a
ab
c
ab ab
kB
(h-1
)
Figure 6 (A) Cell density increments of the consortium C2PL05 with the treatments pH 50 pH 70
and pH 80 Error bars show the standard error (B) Differences between treatments (pH 50 pH
70 and pH 80 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
62
The last factor analyzed was the addition of an easily assimilated carbon source
(Figure 7) Regarding to CDI values (Figure 7A) there were significant differences between
treatments (F26 = 45401 p lt 0001 Table 1) The addition of glucose as only carbon source
significantly improved CDI Figure 7B only show the kB of the treatments with PAH (100 or
50 of PAH) therefore the treatment with glucose as only carbon source was not included in
the ANOVA analysis The interaction between PAH and type of carbon source was
significant (F212 = 7 p lt 005 Table 1) The kB for the treatment with PAH and glucose
(5050) was significantly higher for phenanthrene and naphthalene (Figure 6B) although
there were no differences with the treatment for anthracene where PAH were the only carbon
source
PAHs (100)
PAHsGlucose (50)Glucose (100)
18
20
22
24
26
28
Carbon source
b
c
a
A
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-2
4x10-2
6x10-2
8x10-2
1x10-1
B
c
bb
b
b
a
k B (h
-1)
Figure 7 (A) Cell density increments of the consortium C2PL05 with the treatments PAHs (100)
PAHsglucose (5050) and glucose (100) Error bars show the standard error (B) Differences
between treatments (PAHs (100) and PAHs glucose (5050) ) and PAHs in the
biodegradation kinetic constant (kB) The letters show differences between groups (p lt 005 SNK)
and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
63
Discussion
It is important to highlight that the increments of the cell density is a parameter that brings
together all the microbial community whereas the biotic degradation constant is specific for
the PAH degrading microorganisms For that reason when the effect of the factors studied
on CDI and kB yielded opposite results the latter always prevailed since PAH degradation
efficiency is the main goal of the present optimisation study
With regard to the CNP molar ratio some authors consider that low ratios might limit
the bacterial growth (Leys et al 2005) although others show that high molar ratios such as
100101 are optimum for hydrocarbon polluted soils (Flathman et al 1994 Bouchez et al
1995 Eweis et al 1998) However in agreement with Leys et al (2005) our results
confirmed that the most effective molar ratio was the highest (1002116) This result
suggests that the supply of the inorganic nutrients during the PAH biodegradation process
may be needed by the microbial metabolism In addition the form used to supply these
nutrients can affect the metabolism of the microorganism (Carmichael amp Pfaender 1997) and
limit the amount of carbon that bacteria can assimilate limiting in turn the biodegradation
extent Our results showed that nitrate (sodium nitrate) as nitrogen source improved PAH
biodegradation as compared to ammonium This is likely due to the fact that nitrate is more
soluble and available for microorganisms than ammonium which has adsorbent properties
(Schlessinger 1991) The iron is other essential compound to stimulate the microbial activity
on PAH degradation (Dinkla amp Janssen 2003 Santos et al 2008)
On one hand iron acts as a cofactor of enzymes catalysing PAH oxidation (Dinkla amp
Janssen 2003) but it is also related with the production of biosurfactants (Santos et al
2008) These compounds are naturally produced by genera such as Pseudomonas and
Bacillus (Wei et al 2003) increasing the PAH solubility and therefore their bioavailability In
agreement with previous works (Dinkla amp Janssen 2003 Santos et al 2008) our results
confirmed that the addition of iron in a concentration of 01 mmoll-1 makes the
biodegradation more effective Santos et al (2008) stated that there is a limit concentration
above which the growth is inhibited due to toxic effects According to these authors our
results showed lower degradation and growth with the concentration 02 mmoll-1 since this
concentration may be saturating for these microorganisms However opposite to previous
works (Dinkla amp Janssen 2003 Santos et al 2008) the most effective iron form was
Fe2(SO4)3 for the PAH biodegradation likely due to the higher solubility which makes it more
available for the microorganism
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
64
The addition of easy assimilated carbon forms such as glucose for the PAH
degrading process can result in an increment in the total number of bacteria (Wong et al
2001) because PAH degrader population can use multiple carbon sources simultaneously
(Herwijnen et al 2006) However this increment in the microbial biomass was previously
considered (Wong et al 2001) because the utilization of the new carbon source may
increase the lag phase delaying the bacterial growth (Maier et al 2000) Our results
confirmed that PAH degradation was more efficient with the addition of an easy assimilated
carbon source probably because the augmentation of the total heterotrophic population also
enhanced the PAH degrading community Our consortium showed a longer lag phase during
the treatment with glucose than that observed during the treatment with PAH as only carbon
source (data not shown) These results are consistent with a consortium completely adapted
to PAH biodegradation and its enzymatic system requires some adaptation time to start
assimilating the new carbon source (Maier et al 2000)
Depending on the type of soil and the type of PAH to degrade the optimum pH range
can be very variable (Dibble amp Bartha 1979) Some acid resistant gram-positive bacteria
such as Mycobacterium sp show better PAH degradation capabilities under acid condition
because and low pH seems to render the mycobacterial more permeable to hydrophobic
substrates (Kim et al 2005) However other microorganisms belonging to Pseudomonas
genus prefer neutral pH conditions In agreement with previous works (ie Dibble amp Bartha
1979) our results confirmed that neutral pH is optimum for the biodegradation PAH
In summary the current work has shown that the optimization of environmental
parameters may significantly improve the PAH biodegradation process It is also important to
underline that the statistical analysis of data and the combined study of the bacterial growth
and the kinetics of the degradation process provide an accurate interpretation of the
optimisation results Concluding for an optimum bioremediation process is very important to
perform these previous bioassays to decrease the process development time and so the
associated costs
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Master en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
65
References
Alexander M 1994 Biodegradation and Biorremediation Academic Press New York
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse bacteria Int Biodeter
Biodegr 63 913-922
Bossert I amp Bartha R 1984 The fate of petroleum in soil ecosystems In Atlas RM (ed)
Petroleum microbiology Macmillan New York pp441-4473
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Carmichael LM amp Pfaender KF 1997 The effects of inorganic and organic supplements on
the microbial degradation of phenanthrene and pyrene in soils Biodegradation 8 1-
13
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge Appl Environ Microbiol 37 729-739
Dinkla EJT amp Janssen DB 2003 Simultaneous growth on citrate reduces the effects of
iron limitation during toluene degradation in Pseudomonas Microb Ecol 45 97-107
Eweis JB Ergas SJ Chang PY amp Schroeder ED 1998 Bioremediation Principles
McGraw-Hill Boston pp 136-236
Flathman PE Jerger DE amp Exner JH1994 Biorremediation-Field Experiences Lewis
Publishers Boca Raton pp 81-106 383-490
Gallego JL Garciacutea MJ Llamas JF Belloch C Pelaez AI amp Sanchez J 2007
Biodegradation of oil tank botton sludge using microbial consortia Biodegradation 18
269-281
Hall TA 1999 Bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 41 95-98
Heitkamp MA amp Cerniglia CE 1988 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from sediment below an Oil Field Appl Environ Microbiol 54
1612-1614
Kim YH Freeman JP Moody JD Engesse KH amp Cerniglia CE 2005 Effects of pH on
the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1
Appl Environ Microbiol 67 275-285
Kwok Chen-Ko amp Loh Kai-Che 2003 Effects of Singapore soil type on bioavalability of
nutrients in soil bioremediation Adv Environ Res 7 889-900
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
66
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Luning Prak DJ amp Pritchard PH 2002 Solubilization of polycyclic aromatic hydrocarbon
mixtures in micelar non-ionic surfactant solution Water Res 36 3463-3472
Maier MR Pepper LI amp Gerba PC 2000 Enviromental Microbiology Academic Press
Elsevier
Molina MC Gonzalez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz L 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Denaturing gradient gel
electrophoresis of PCR-amplified 16S Rdna a new molecular approach to analyse the
genetic diversity of mixed microbial communities In Akkermans ADL van Elsas JD
de Bruijn FJ (eds) Molecular microbial ecology manual Kluwer Academic Publishers
Dordrecht pp 1-23
Rolling-Wilfred FM Milner M Jones DM Lee K Daniel F Swanell-Richard JP amp Head
IM 2002 Robust hydrocarbon degradation and dynamic of bacterial communities
during nutrients-enhanced oil spillbiorremediation Appl Environ Microbiol 68 5537-
5548
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation an surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Vintildeas M Sabateacute J Guasp C Lalucat J y Solanas AM 2005 Culture-dependent and
independent aproaches establish the complexity of a PAH degrading microbial
consortium Can J Microbiol 51 897-909
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacillus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK Ma KK amp Fang M 2001 Isolation and optimization of
PAH-degradative bacteria from contaminated soil for PAH bioremediation Water Air
Soil Poll 13 1-13
Zaidi BR amp ImamSH 1999 Factors affecting microbial degradation of polycyclic aromatic
hydrocarbon phenanthrene in caribbean coastal water Mar Pollut Bull 38 738-749
Capiacutetulo
Aceptado en Water Air amp Soil Pollution (Febrero 2012)
Simarro R Gonzaacutelez N Bautista LF Molina MC amp Schiavi E
Evaluation of the influence of multiple environmental factors on the biodegradation
of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal
experimental design
Evaluacioacuten de la influencia de muacuteltiples factores ambientales en la biodegradacioacuten de dibenzofurano
fenantreno y pireno por un consorcio bacteriano usando un disentildeo experimental ortogonal
1b
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
69
Abstract
For a bioremediation process to be effective we suggest to perform preliminary studies in
laboratory to describe and characterize physicochemical and biological parameters (type and
concentration of nutrients type and number of microorganisms temperature) of the
environment concerned We consider that these studies should be done by taking into
account the simultaneous interaction between different factors By knowing the response
capacity to pollutants it is possible to select and modify the right experimental conditions to
enhance bioremediation
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
71
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic compounds composed of two
or more aromatics rings High molecular weight PAH (HMW-PAH) with four (ie pyrene) or
more aromatics rings and other heterocyclic aromatic compounds as dibenzofuran both with
high molecular mass are often more difficult to biodegrade that other low molecular weight
PAH (LMW-PAH) due to their lower solubility and biodegradability Many of them have toxic
mutagenic and carcinogenic properties and the effects of PAH as naphthalene or
phenanthrene in animals and humans their toxicity and carcinogenic activity has been
reported and well documented (Sudip et al 2002) In addition PAH are bioaccumulated in
the environment and trophic chains properties that increase with the numbers of rings There
is a natural degradation carried out by microorganism able to use PAH as carbon source
which represents a considerable portion of the bacterial communities present in polluted soils
(Heitkamp amp Cerniglia 1998) However this natural biodegradation may be affected by
environmental factors which optimization allows us to achieve a more efficient process
Temperature is a key factor in the physicochemical properties of PAH as well as in the
metabolism of the microorganisms Although it has been shown that biodegradation of PAH
is possible even at temperatures lower than 5 ordmC (Eriksson et al 2001) it is usually more
efficient at mild temperatures (15-25 ordmC) (Mohn amp Stewart 2000) The carbon nitrogen and
phosphorus (CNP) molar ratio is another important factor in biodegradation process
because affect the dynamics of the bacterial metabolisms changing the PAH conversion
rates and growth of PAH-degrading species (Leys et al 2004) The form in which these
essential nutrients are supplied affects the bioavailability for the microorganism being more
soluble and efficient the oxidated forms (such as nitrates) than reduced forms (such as
ammonium) (Schlessinger 1991)
Surfactants are compounds used to increase the PAH solubility although both
positive (Boochan et al 1998 Jin et al 2007) and negative effects (Boochan et al 1998
Laha amp Luthy 1992) on the biodegradation process has been reported The nature of the
effect depends on several factors such as the type and concentration of surfactant due to
the toxic properties of some of them (Jin et al 2007) and the increasing of toxicity of PAH
produced by increasing their solubility (Thibault et al 1996) Another factor considered is the
inoculum size related to the diversity and effectiveness of the biodegradation because in a
diluted inoculum the minority microorganisms which likely have an important role in the
biodegradation process can be removed (Szaboacute et al 2007) Moreover it has been
reported (Szaboacute et al 2007) that the addition of a readily metabolized carbon source (ie
glucose) improves the PAH degradation possibly due to the increased biomass although in
72
others cases (Wong et al 2000) this better bacterial growth reduced significantly PAH
degradation
We consider that the study of the individual effect of abiotic factors on the
biodegradation capacity of the microbial consortium is incomplete because the effect of one
factor can be influenced by other factors In this work the combination between factors was
optimized by an orthogonal experimental design fraction of the full factorial combination of
the selected environmental factors
Hence our two mains goals are to determine the optimal conditions for the
biodegradation of low (phenanthrene and dibenzophurane) and high (pyrene) molecular
weight PAH by a bacterial degrading consortium (C2PL05) and the study of the influence of
the factors (temperature CNP molar ratio type of nitrogen and iron source iron source
concentration carbon source surfactant concentration and inoculums dilution) in the
biodegradation In order to achieve these objectives we realized an orthogonal experimental
design to take into account all combination between eight factors temperature CNP molar
ratio nitrogen and iron source iron concentration addition of glucose surfactant
concentration and inoculum dilution at three and two levels
Material and methods
Chemicals and media
Dibenzofuran phenanthrene and pyrene (gt99 purity) were purchased from Sigma-Aldrich
Steinheim Germany) Stock mix of the three PAH was prepared by dissolving the necessary
amount in n-hexane (Fluka Steinheim Germany) In previously work (Bautista et al 2009)
we tested that the optimal surfactant for the consortium was the biodegradable and non
toxicTween-80 (Sigma-Aldrich Steinheim Germany) Bushnell-Haas Broth medium (BHB)
was purchased from Panreac (Barcelona Spain) and its original composition (02 g l-1
MgSO4middot7H2O 002 g l-1 CaCl2 2H2O 1 g l-1 KHPO4 1 g l-1 K2HPO4 1 g l-1 NH4NO3 005 g l-1
FeCl3) was modified according to the treatment (see Table 1)
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
73
Table 1 Experimental design
Treatment T
(ordmC) CNP (molar)
N source
Fe
source
Iron source concentration
(mM)
Glucose PAH ()
Surfactant concentration
Inoculum dilution
1 30 100505 (NH4)2SO3 Fe2(SO4)3 02 0100 CMC 10-3
2 20 1002116 (NH4)2SO3 FeNO3 005 0100 + 20CMC 10-2
3 25 100101 NaNO3 FeNO3 02 0100 + 20CMC 10-1
4 20 100505 NaNO3 Fe2(SO4)3 02 5050 + 20CMC 10-2
5 25 100505 NH4NO3 FeNO3 01 5050 CMC 10-2
6 30 100101 NH4NO3 Fe2(SO4)3 005 8020 + 20CMC 10-2
7 30 100101 NaNO3 FeCl3 01 0100 CMC 10-2
8 20 100505 NaNO3 FeCl3 005 8020 CMC 10-1
9 25 1002116 (NH4)2SO3 FeCl3 02 8020 CMC 10-2
10 20 1002116 NH4NO3 Fe2(SO4)3 01 0100 CMC 10-1
11 20 100101 NH4NO3 FeNO3 02 8020 CMC 10-3
12 25 100101 (NH4)2SO3 Fe2(SO4)3 005 5050 CMC 10-1
13 25 1002116 NaNO3 Fe2(SO4)3 01 8020 + 20CMC 10-3
14 30 1002116 NH4NO3 FeCl3 02 5050 + 20CMC 10-1
15 25 100505 NH4NO3 FeCl3 005 0100 + 20CMC 10-3
16 30 1002116 NaNO3 FeNO3 005 5050 CMC 10-3
17 30 100505 (NH4)2SO3 FeNO3 01 8020 + 20CMC 10-1
18 20 100101 (NH4)2SO3 FeCl3 01 5050 + 20CMC 10-3
Bacterial consortium
PAH-degrading consortium C2PL05 was isolated from a soil in a petrochemical complex in
Puertollano (Spain) and was identified and described in Molina et al (2009) All strains of
the consortium C2PL05 isolated by culture-dependent techniques were γ-Proteobacteria
and the strains presents belong to the genera Enterobacter Pseudomonas and
Stenotrophomonas (Molina et al 2009) In addition the diversity of the enriched microbial
consortium was characterised by a non culture-dependent molecular technique such as
denaturing gradient gel electrophoresis (DGGE) following the procedure described
elsewhere (Molina et al 2009) using the primers 341F-GC and 907R (GC clamp 5acute-CGC
CCG CCG CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995)
Experimental design
An orthogonal design form of L18 (37) (21) selected from the module of Statistica (Version 60)
was used to do the multi-factor combination A total of 18 experiments each in triplicate
were carried out in 100 ml Erlenmeyers flask with a total volume of 50 ml of Bushnell-Haas
Broth medium (BHB) (Panreac Barcelona Spain) with an original composition modified
74
according to the treatments requirements (see Table 1) The replicates were incubated in an
orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA) at 150 rpm under dark
conditions but prior to inoculate the consortium the flasks were shaken overnight to
equilibrate and solubilize most of the PAH In Table 1 shows a summary of environmental
conditions and incubation of each treatment Tween-80 concentration was 0012 mM the
critical micellar concentration (CMC) 100 of PAH was equivalent to 03 g l-1 (01 g l-1 of
each PAH) The initial cell concentration of the inoculum consortium was determined by the
most probably number (MPN) method (Wrenn amp Venosa 1983) The number of heterotrophic
microorganisms (315x106 cell ml-1) was measured with Luria Base broth (LB Panreac
Barcelona Spain) with glucose as carbon source and the PAH degrading microorganisms of
the consortium (695x105 cell ml-1) with BHB with PAH mix as carbon source
Cell density
Bacterial density during the PAH degrading process was monitored at 0 15 24 39 48 63
72 87 95 and 159 h by the increase in absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) Throughout the cell growth curve we
calculated the average of the cell densities increments (CDI) applying the equation 1
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and i
corresponds to each sample or sampling time The increments were normalized by
the initial absorbance measurements to correct the effect of the inoculum dilution
PAH extraction and analysis
At the end of each experiment (159 hours) PAH were extracted with dichloromethane and
the residue precipitated was dissolved in 1 ml of acetonitrile for high performance liquid
chromatography (HPLC) analysis using a ProStar 230 HPLC system (Varian Palo Alto CA
USA) with a reversed phase C18 column following the method previously described (Bautista
et al 2009) The residual concentration of each PAH was calculated from a standard curve
based on peak area at a wavelength of 254 nm The average percentage of phenanthrene
pyrene and dibenzofuran and average percentage of total PAH degradation (PD) for each
treatment are shown in Table 2
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
75
Statistical analyses
The effect of the individual parameters on the CDI and on the PD were analysed by a
parametric one-way analysis of variance (ANOVA) The variances were checked for
homogeneity by the Cochranacutes test Students-Newman-Keuls (SNK) test was used to
discriminate among different variables after significant F-test When data were not strictly
parametric Kruskal-Wallis test and Tukey-type multiple comparison test were used
The orthogonal design to determine the optimal conditions for PAH biodegradation is
an alternative to the full factorial test which is impractical when many factors are considered
simultaneously (Chen et al 2008) However the orthogonal test allows a much lower
combination of factors and levels to test the effect of interacting factors
Results and discussion
The consortium C2PL05 degrade phenanthrene pyrene and dibenfuran efficiently in 159 h
(Table 2) and also other PAH as naphthalene and anthracene (Molina et al 2009) The
study of the influence of each factor in the total PD (Figure 1) showed that only the carbon
source influenced in this parameter significantly (Table 3) Results concerning to carbon
source showed that PD were higher when PAH were added as only carbon source (100 of
PAH) The reason why the PD did not show statistical significance between treatments
except for the relative concentration of PAH-glucose may be due to significant changes
produced in PD at earlier times when PAH were still present in the cultivation media
However the carbon source incubation temperature and inoculum dilution were factors that
significantly influenced CDI (Table 3 Figure 2)
76
Table 2 Final percentage degradation of
phenanthrene (Phe) pyrene (pyr) and dibenzofuran
(Dib) and total percentage degradation (total PD) for
each treatment
percentage degradation Treatment Phe Pyr Dib Total PD
1 965 883 864 904 2 969 950 833 917 3 966 895 845 902 4 972 915 921 872 5 969 904 950 882 6 982 935 995 852 7 964 883 859 902 8 977 953 964 823 9 976 936 984 825 10 970 910 895 925 11 979 968 986 888 12 966 889 920 850 13 978 930 993 835 14 966 897 943 871 15 963 881 898 914 16 963 886 951 867 17 977 954 986 861 18 976 930 967 915
The conditions corresponding to listed treatments
are presented in Table 1
100
50
5
100
101
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
82
84
86
88
90
92 T (ordmC)
aa
a
aa
aa
aa
a
Tot
al P
D (
)
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
(SO
4)3
a
a
0acute05 0acute1
0acute2
Fe source
a
a
a
0 -
100
50 -
50
80 -
20
C Fe (mM)
a
b
c
CM
C
+ 2
0 C
MC
Gluc-PAHs
aa
10^-
1
10^-
2
10^-
3DilutionCMC
aa
a
Figure 1 Graphical analysis of average values of total percentage degradation (PD) under
different treatments and levels of the factors () represent the average of the total PD of the
treatments of each level Letters (a b and c) show differences between groups
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
77
Table 3 Analysis of variance (ANOVA) summary for the increments of cell density (CDI) and the total
percentage degradation (PD) of each factor MS is the mean of squares and df degrees of freedom
ANOVA of CDI ANOVA of total PD
Factor df MS F-value p-value df MS F-value p-value
T (ordmC) Error
2 056 1889 2 22 183 ns
51 002 51 12
Molar ratio CNP Error
2 003 069 ns 2 22 183 ns
51 005 51 12
N source Error
2 001 007 ns 2 214 177 ns 51 005 51 121
Fe source Error
2 003 066 ns 2 89 071 ns
51 005 51 126
Fe concentration Error
2 007 146 ns 2 118 095 ns 51 005 51 124
Glucose-PAH Error
2 024 584 2 1802
3085 51 004 51 395
8
CMC Error
1 001 027 ns 1 89 071 ns
52 005 52 125
Inoculum Dilutionb Error
2 331 a 2 113 091 ns 54 6614 51 125
a H-value obtained of Kruskal-Wallis test used for non parametric data Chi-square = 28 Overall
median = 044
p-value lt 001
p-value lt 0001
100
50
5
100
100
1
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
16
17
18
19
20
21
a
a
aa
a
aa
a
c
bCD
I
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
SO
4
Fe source
a
a
0acute05 0acute1
0acute2
C Fe (mM)
a
a
a
0-10
0
50-5
0
80-2
0
Gluc-PAH
a
b
c
CM
C
+ 2
0 C
MC
CMC
aa
10^-
1
10^-
2
10^-
3
00
05
10
15
20
25
30
35C
DI n
orm
aliz
ed
DilutionT (ordmC)
b
a
a
Figure 2 Graphical analysis of average values of cell density increments (CDI) and normalized cell
density increments (CDI normalized) of different treatments and levels of the factors () represent the
average of the CDI or CDI normalized of the treatments of each level Letters (a b and c) show
differences between groups
78
The temperature range considered in the present study might not affect the
biodegradation process since it is considered narrow by some authors (Wong et al 2000)
Nevertheless we observed significant differences in the process at different temperatures
showing an optimum at 25 ordmC for our microbial consortium growth (Figure 2) whereas when
consortium was incubated at 20 ordmC and 30 ordmC microorganisms remained in lag phase These
results were in agreement with the fact that respiration increases exponentially with
temperature (Q10 relationship) (Lloyd amp Taylor 1994) but increasing or decreasing
temperature beyond the optimal value will cause a reduction in microbial respiration We
suggest that moderate fluctuation of temperatures affect microbial growth rate but not
degradation rates because degrading population is able to degrade PAH efficiently in a
temperature range between 20-30 ordmC (Sartoros et al 2005)
The nutrient requirements for microorganisms increase during the biodegradation
process so a low CNP molar ratio can result in a reduced of the metabolic activity of the
degrader microorganisms and thus reduce their potential degrader (Leys et al 2004)
According to this author CNP ratios above 100101 provide enough nutrients to metabolize
the pollutants However our results showed that the CNP ratios supplied to the cultures
even the ratio 100505 did not affect the CDI and total PD This results indicate that the
consortium C2PL05 is able to degrade PAH even under low nutrients conditions due to its
high adaptation to the hard conditions of a chronically contaminated soil The results
concerning the addition of different nitrogen and iron sources did not show significant
difference in CDI and total PD Other works (Schelessinger 1991 Santos et al 2008) have
suggested that the addition of nitrogen in form of nitrates (Schelessinger 1991) and the iron
in form of sulphates or chlorides (Santos et al 2008) is more effective due to their high
solubility
The addition of readily biodegradable carbon source as glucose to a polluted
environment is considered an alternative to promote biodegradation The easy assimilation of
this compound result in an increase in total biomass (heterotrophic and PAH degrader
microorganisms) of the microbial population thereby increasing the degradation capacity of
the community Piruvate are a carbon source that promote the growth of certain degrading
strains as Pseudomonas putida (Lee et al 2003) whereas salicylate induces the synthesis
and activation of degradative enzymes (Chen amp Aitken 1999) Similarly to previous results
observed by Wong et al (2000) in the present study the addition of glucose to the cultures
had significant effects in total PD and CDI (Figure 1 Figure 2) Although the consortium
C2PL05 showed a significantly better growth with 80 of glucose the difference between
treatments (0100 5050 8020 of glucosePAH) showed that PD was higher when PAH
were added as only carbon source Previously it has been described that after a change in
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
79
the type of carbon source supplied to PAH-degrader microorganisms an adaptation period
for the enzymatic system was required reducing the mineralization rate of pollutants (Wong
et al 2000 Maier 2009 Simarro et al 2010) As glucose was added as additional carbon
source our results show an increase in CDI although the PD values decrease significantly
This indicated that glucose enhance the overall growth of consortium but decrease the
biodegradation rate of PAH-degrader population due to the adaptation of the corresponding
enzymatic system So in this case the addition of a readily carbon source retards the
biodegradation process The addition of surfactant to the culture media at concentration
above their CMC is essential to increase PAH degradation rate (Pantsyrnaya et al 2011)
However Yuan et al (2000) reported negative effects when the surfactant was added at
concentration above the CMC because the excess of micelles around PAH reduces their
bioavailability (Mulligan et al 2001) However our results showed that PD and CDI were not
affected by concentrations largely beyond the CMC Some non biodegradable surfactants
can be toxic to bacteria and therefore do not improve the biodegradation process (Bautista et
al 2009) Tween-80 was the optimal surfactant for the strains of the consortium C2PL05
(Bautista et al 2009) However the optimal type of surfactant is determined by the type of
degrading strains involved in the process (Bautista et al 2009) In addition it is important to
consider the possible use of surfactant as a carbon source by the strains preferentially to
PAHs which would reduce the rates of biodegradation (Kim amp Weber 2003)
Further dilution of the inoculum represents the elimination of minority species which
could result in a decrease in the degradation ability of the consortium if the eliminated
species represented an important role in the biodegradation process (Szaboacute et al 2007)
Our results concerning the inoculum concentration showed that this factor significantly
influenced in CDI but had no effect on total PD indicating that the degrading ability of the
consortium has not been altered by the dilution of the same In Gonzalez et al (2011) the
evolution and bacterial succession of the consortium C2PL05 by culture-dependent
techniques are described All of these identified strains were efficient in degradation of PAH
(Bautista et al 2009) but Enterobacter sp was dominant at the beginning of the degradation
process whereas Stenotrophomonas sp and Pseudomonas sp were less abundant In
addition DGGE fingerprint pattern studied and described in Molina et al (2009) showed a
low microbial diversity of the consortium C2PL05 typical of an enriched consortium from
chronically contaminated soil (Vintildeas et al 2005) The results present in this work suggest
that in cultures inoculated with the highest dilution of the consortium (10-3) the less abundant
microorganisms were eliminated reducing the competition for the dominant species which
can grow vigorously
80
The influence of some environmental factors on the biodegradation of PAH can
undermine the effectiveness of the process In this study the combination of all factors
simultaneously by an orthogonal design has allowed to establish considering the interactions
between them the most influential parameters in biodegradation process Finally we
conclude that the only determining factor in biodegradation by consortium C2PL05 is the
carbon source Although cell growth is affected by temperature carbon source and inoculum
dilution these factors not condition the effectiveness of degradation Therefore the optimal
condition for a more efficient degradation by consortium C2PL05 is that the carbon source is
only PAH
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Maacutester en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
81
References
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Boochan S Britz ML amp Stanley GA 1998 Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophila
Biotechnol Bioeng 59 482-494
Chen S-H amp Aitken MD 1999 Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
EnvironSci Technol 33 435ndash439
Chen J Wong MH Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAHs) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in Artic Tundra soil Appl EnvironMicrobiol 67 5107-
5112
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438-9446
Heitkamp MA amp Cerniglia CE 1998 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from Sediment below an oil field Appl EnvironMicrobiol 54
1612-1614
Jin D Jiang X Jing X amp Ou Z 2007 Effects of concenrtration head group and structure of
surfactants on the biodegradation of phenanthrene J Hazard Mater 144 215-221
Kim HS amp Weber WJ 2003 Preferential surfactant utilization by a PAH-degrading strain
effects on micellar solubilization phenomena Environ Sci Technol 37 3574-3580
Laha S amp Luthy RG 1992 Effect of non-ionic surfactants on the solubilization and
mineralization of phenanthrene in soil-water systems Biotechnol Bioeng 40 1367-
1380
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegradation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Leys MN Bastiaens L Verstraete W amp Springael D 2004 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Lloyd J amp Taylor JA 1994 On the temperature dependence of soil respiration Funct Ecol
8 315-323
82
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mulligan CN Young RN amp Gibbs BF 2001 Surfactant enhanced remediation of
contaminated soil a review Eng Geol 60 371-380
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Molecular microbial ecology manual
(Eds Akkermans ADL van Elsas JD Bruijn FJ) Kluwer Academic Publishers
Dordrecht pp 1-23
Pantsyrnaya T Blanchard F Delaunay S Georgen JL Geacuteudon E Guseva E amp Boudrant
J 2011 Effect of surfactants dispersion and temperature on solubility and
biodegradation of phenanthrene in aqueous media Chemosphere 83 29-33
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation and surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Sartoros C Yerushalmi L Beroacuten L amp Guiot S 2005 Effects of surfactant and temperature
on biotransformation kinetics of anthracene and pyrene Chemistry 61 1042-1050
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Sudipt KS Om VS amp Rakesh KJ 2002 Polycyclic aromatic hydrocarbons environmental
pollution and bioremediation Trends Biotechnol 20 243ndash248
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquatic Microbl Ecol 47 1-10
Thibault SL Anderson M amp Frankenberger WTJr 1996 Influence of surfactant on pyrene
desorption and degradation in soils Appl Environ Microbiol 62 283-287
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Poll 139 1-13
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
83
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon degrading bacteria by most-probably-number (MPN) Can J Microbiol
4 252-258
Yuan SY Wei SH amp Chang BV 2000 Biodegradation of polycyclic aromatic
hydrocarbons by a mixed culture Chemosphere 41 1463-1468
Capiacutetulo
Publicado en Bioresource Technology (2011) 102 9438-9446
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA
Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process
Efecto de los surfactantes en la biodegradacioacuten de HAP por un consorcio bacteriano y dinaacutemica de la comunidad
bacteriana durante el proceso
2
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
87
Abstract
The aim of this work was to evaluate the effect of a non-biodegradable (Tergitol NP-10) and
a biodegradable (Tween-80) surfactant on growth degradation rate and microbial dynamics
of a polycyclic aromatic hydrocarbon (PAHs) degrading consortium (C2PL05) from a
petroleum polluted soil applying cultivable and non cultivable techniques Growth and
degradation rate were significantly lower with Tergitol NP-10 than that with Tween-80
Toxicity did not show any significant reduction with Tergitol NP-10 whereas with Tween-80
toxicity was almost depleted (30) after 40 days Regarding to the cultured bacteria
Pseudomonas and Stenotrophomonas groups were dominant during PAH degradation with
Tergitol NP-10 whereas Enterobacter and Stenotrophomonas were dominant with Tween-80
DGGE analyses (PRIMER and MDS) showed that bacteria composition was more similar
between treatments when PAHs were consumed than when PAHs concentration was still
high Community changes between treatments were a consequence of Pseudomonas sp
Sphingomonas sp Sphingobium sp and Agromonas sp
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
89
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic pollutants composed of two
or more fused aromatic rings produced by natural and anthropogenic sources Besides
being toxic carcinogenic and mutagenic compounds the semi-volatile properties of some
PAH make them highly mobile throughout the environment (air soil and water) In addition
PAH have a high trophic transfer and biomagnification within the ecosystems due to the
lipophilic nature and the low water solubility that decreases with molecular weight (Clements
et al 1994) The importance of preventing PAH contamination and the need to remove PAH
from the environment has been recognized institutionally by the Unites States Environmental
Protection Agency (US-EPA) which has proposed 16 PAH as priority pollutants including
naphthalene phenanthrene and anthracene Currently governmental agencies scientist and
engineers have focused their efforts to identify the best methods to remove transform or
isolate these pollutants through a variety of physical chemical and biological processes
Most of these techniques involve expensive manipulation of the pollutant transferring the
problem from one site or phase to another (ie to the atmosphere in the case of cremation)
(Haritash amp Kausshik 2009) However microbial degradation is one of the most important
processes that PAH may undergo compared to others such as photolysis and volatilization
Therefore bioremediation can be an important alternative to transform PAH to less or not
hazardous forms with less input of chemicals energy and time (Haritash amp Kaushik 2009)
Most of the contaminated sites are characterized by the presence of complex mixtures
of pollutants Microorganisms are very sensitive to low concentrations of contaminants and
respond rapidly to environment perturbations (Andreoni et al 2004) Therefore microbial
communities chronically exposed to PAH tend to be dominated by those organisms capable
of use PAH as carbon and energy source (Gallego et al 2007) Even in areas previously
unpolluted there is a proportion of microbial community composed by PAH degrading
bacteria able to degrade PAH (Surridge et al 2009) These microbial communities subjected
to a polluted stress tend to be less diverse depending on the complexity of the composition
and the time of exposure (MacNaughton et al 1999) The biodegradation of hazardous
compounds by bacteria fungi and algae has been widely studied and the success of the
process will be due in part to the ability of the microbes to degrade all the complex pollutant
mixture However most of the PAH degradation studies reported in the literature have used
versatile single strains or have constructed an artificial microbial consortium showing ability
to grow with PAH as only carbon source by mixing together several known strains (Ghazali et
al 2004) Nevertheless pure cultures and synthetic microbial consortia do not represent the
natural behaviour of microbes in the environment since the cooperation among the new
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
90
species is altered In addition changes in microbial communities during pollutant
biotransformation processes are still not deeply studied Microbial diversity in soil
ecosystems can reach values up to 10 billion microorganisms per gram and possibly
thousands of different species although less than 10 can be culturables (Torsvik amp Ovreas
2002) Therefore additional information on biodiversity ecology dynamics and richness of
the degrading microbial community can be obtained by non-culturable techniques such as
DGGE In addition small bacteria cells are not culturable whereas large cells are supposed
to account 80 of the total bacterial volume (Nannipieri et al 2003) Therefore despite their
low proportion culturable bacteria can provide essential information about the structure and
functioning of the microbial communities With the view focused on the final bioremediation
culture-dependent techniques are necessary to obtain microorganisms with the desired
catabolic traits for bioaugmentation processes in polluted soils The PAH degradation is
limited by their low aqueous solubility but surfactants which are amphypatic molecules
enhance the solubility of hydrophobic compounds (Kolomytseva et al 2009) Previous works
(Bautista et al 2009) have shown that efficiency of a consortium named C2PL05 composed
by PAH degrading bacteria was significantly higher using surfactants
One of the main goals of the current work was to understand if culturable and non
culturable techniques are complementary to cover the full richness of a soil microbial
consortium A second purpose of the study was to describe the effect of different surfactants
(biodegradable and non-biodegradable) on growth rate PAH degradation rate and toxicity
reduction of a bacterial consortium (C2PL05) The microbial consortium C2PL05 was
isolated from a soil chronically exposed to petroleum products collected from a
petrochemical complex Finally the work is also aimed to describe the microbial dynamics
along the biodegradation process as a function of the surfactant used to increase the
bioavailability of the PAH
Material and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all 99 purity) were purchased from Sigmandash
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) Reagent grade
dichloromethane and n-hexane were supplied by Scharlau Chemie (Barcelona Spain)
Surfactants (Tween-80 and Tergitol NP-10) used were supplied by Sigma-Aldrich (Steinheim
Alemania) Bushnell-Haas Broth medium (BHB) was purchased from Panreac (Barcelona
Spain) and its composition is 02 g l-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 10 gmiddotl-1 KHPO4
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
91
10 gmiddotl-1 K2HPO4 10 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 Luria-Bertani media (LB) glucose and
phosphate buffer saline (PBS) were purchased from Panreac (Barcelona Spain)
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1 g of sieved soil (lt2 mm) was resuspended in
10 ml of PBS and incubated during 12 h in an orbital shaker (Innova 40 New Brunswick
Scientific Edison NJ USA) at 150 rpm and 25 ordmC under dark conditions After that 15 ml of
the supernatant was inoculated in 50 ml of BHB broth (pH 70) containing 1 wt Tween-80
as surfactant and naphthalene phenanthrene and anthracene (each at 250 mg l-1) as carbon
source Then the culture was incubated at 150 rpm and 25 ordmC under dark conditions until the
exponential phase was completed This was confirmed by monitoring the cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK) Then the consortium was stored at 4 ordmC to
stop growth At the beginning of each experiment 500 μl of the stored consortium (asymp 16 AU)
was inoculated in Erlenmeyer flasks
Experimental design and treatments conditions
To evaluate the influence of Tween-80 and Tergitol NP-10 (biodegradable and non-
biodegradable surfactant respectively) on the degrading capacity of the consortium C2PL05
as well as the evolution of its microbial community two different treatments each in triplicate
were carried out The replicates were performed in 100 ml Erlenmeyer flasks with 50 ml of
BHB medium (pH 70) Tween-80 or Tergitol NP-10 as surfactants (1 vv) a mixture of
naphthalene phenanthrene and anthracene in n-hexane (final concentration 500 mgmiddotl-1) and
500 microl of the C2PL05 consortium (88middot108 heterotrophic cellsmiddotml-1 and 44middot107 PAH degrading
cellsmiddotml-1 for the treatments with Tween-80 73middot105 heterotrophic cellsmiddotml-1 and 24middot103 PAH
degrading cellsmiddotml-1 for treatment with Tergitol NP-10) The replicates were incubated in an
orbital shaker (Innova 40) at 150 rpm and 25 ordmC under dark conditions during 45 days
Previously to inoculate the consortium the Erlenmeyer flasks were shaked overnight to
reach the solubility equilibrium of PAH and to allow the complete evaporation of n-hexane
Samples vigorously shaking to ensure homogeneity were withdrawn twice a day for 45 days
except for the initial 24 hours where the sampling frequency was higher Cell growth PAH
(soluble and precipitated) toxicity and number of heterotrophic and PAH degrading cells
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
92
were measures in all samples To study the dynamic of the microbial consortium through
cultivable and non-cultivable methods samples were withdrawn at 0 15 and 30 days
Bacterial growth MPN and toxicity assays
Bacterial growth was monitored by changes in the absorbance of the culture media at 600
nm using a Spectronic Genesys spectrophotometer According to the Monod equation
(Equation 1) the specific growth rate micro is essentially equal to micromax when substrate limitation
is avoided
SK
S
S
max
(Equation 1)
Therefore from the above optical density data the maximum specific growth rate (micromax)
was estimated as the logarithmized slope of the exponential phase applying the following
equation (Equation 2)
Xdt
dX (Equation 2)
where micromax is the maximum specific growth rate Ks is the half-saturation constant S
is the substrate concentration X is the cell density t is time and micro is the specific
growth rate In order to evaluate the ability of the consortium to growth with
surfactants as only carbon source two parallel treatments were carried out at the
same conditions than the two treatments above described but in absence of PAH
Heterotrophic and PAH-degrading population from the consortium C2PL05 were
enumerated during the PAH degrading process comparing the effect of Tergitol NP-10 and
Tween-80 as surfactants The estimation was performed by using a miniaturized MPN
technique in 96-well microtiter plates with eight replicate wells per dilution Total
heterotrophic microbial population was enumerated in 180 μl of Luria Bertani (LB) medium
with glucose (15 gmiddotl-1) and 20 microl of the microbial consortium PHA-degrading population were
counted in BHB medium (180 microl including the surfactant) 20 microl of a mixture of phenanthrene
anthracene and naphthalene in hexane (each at a final concentration of 500 mgmiddotl-1) and 20 microl
of the microbial consortium in each well The MPN scores were transformed into density
estimates accounting for their corresponding dilution factors
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
93
The toxicity was monitored during PAH degradation and estimations were carried out
using the Microtox assay with the bioluminescent bacterium Vibrio fischeri Three controls
considered as 0 inhibition were prepared with the photobacterium and 2 NaCl (vv) and
three blanks as 100 inhibition containing only 2 NaCl (vv) Samples were salted with
NaCl (2 vv final concentration) and the toxicity was expressed as the percentage of the V
fischeri inhibition after 15 min of incubation at 15 ordmC To study the toxicity of the medium
caused by PAH when the surfactants were not added toxicity evolution was measured from
a treatment with PAH as carbon source and degrading consortia but without surfactant under
same conditions previously described
PAH monitoring
In order to compare the effect of the surfactant on the PAH depletion rate naphthalene
phenanthrene and anthracene concentrations in the culture media were analysed using a
reversed-phase C18 column (Luna C18(2) 75 cm length x 46 mm ID 3 microm particle size
Phenomenex Torrance CA USA) following the method described elsewhere (Bautista et
al 2009) The concentration of each PAH was calculated from a standard curve based on
peak area at 254 nm The apparent first-order kinetic constant (kB) due to biotic processes
was calculated by applying Equation 3
iBiiAii
i CkCkdt
dCr (Equation 3)
where C is the PAH concentration kA is the apparent first-order kinetic constant due to
abiotic processes kB is the apparent first-order kinetic constant due to biological
processes t is the time elapsed and the subscript i corresponds to each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40) at 150 rpm and 25ordmC under dark
conditions PAH concentration in the control experiments were analyzed using the HPLC
system described previously The values of kA for each PAH were calculated by applying Eq
2 considering kB asymp 0 since no bacterial consortium was inoculated The amount of
precipitated and bioadsorbed PAH was measured after centrifugation of the samples Then
dichloromethane was added to the pellet and this extraction was repeated three times and
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
94
the fractions pooled The solvent was evaporated using a nitrogen flow and the extract was
dissolved into a known volume of acetonitrile for HPLC analysis
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
Samples from cultures of the bacterial consortium C2PL05 during the PAH degrading
process were collected to identify the effect of the surfactants (Tergitol NP-10 and Tween-80)
To get about 20-30 colonies isolated at each collecting time samples of each treatment were
streaked onto Petri plates with BHB medium and purified agar and were sprayed with a
mixture of naphthalene phenanthrene and anthracene in n-hexane (final concentration 500
mgl-1) as carbon source The Petri plates were incubated at 25 ordmC under dark conditions
The isolated colonies were transferred onto LB agar-glucose plates in order to increase
microbial biomass for DNA extraction and stored in 50 glycerol (vv) at -80 ordmC In total 91
degrading colonies from the treatment with Tween-80 and 83 degrading colonies from the
treatment with Tergitol NP-10 were isolated
Total DNA was extracted using Microbial DNA isolation kit (MoBio Laboratories
Solano Beach CA USA) to perform the molecular identification of the PAH-degrader
isolated cultured (DIC) Amplification of the 16S rRNA coding region of the DNA was
performed as described by Vintildeas et al (2005) using the primers 16F27 (5rsquo-
AGAGTTTGATCMTGGCTCAG-3rsquo) and 16R1488 (5rsquo-TTACCTTGTTACGACTTCAGG-3rsquo) and
sequenced using the same primers Sequences were edited and assembled using
ChromasPro software version 142 (Technelysium Pty Ltd Tewantin Australia)
All of the 16S rRNA gene sequences were edited and assembled by using BioEdit
software version 487 BLAST search (Madden et al 1996) was used to find nearly identical
sequences for the 16S rRNA sequences determined Sequences were aligned using the Q-
INS-i algorithm (Katoh amp Toh 2008) of the multiple sequence alignment software MAFFT
version 6611 aligning sequences in a single step Sequence data obtained and 34
sequences downloaded from GenBank were used to perform the phylogenetic trees
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates by using PAUP
version 40B10 Maximum parsimony (MP) was also analyzed using PAUP 40B10 as is
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
95
described in Molina et al (2009) Sequences of Aquifex piruphilus were used as out-group
according to previous phylogenetic affiliations (Vintildeas et al 2005)
Denaturing gradient gel electrophoresis from microbial consortium during PAH degrading
process
Non culture dependent molecular techniques such as denaturing gradient gel
electrophoresis (DGGE) were performed to know the effect of the surfactant on the total
biodiversity of the microbial consortium C2PL05 during the PAH degradation process and
compared with the initial composition of the consortium The V3 to V5 variable regions of the
16S rRNA gene were amplified using the primers set 16S 518F and 16S 338R-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primers 338R-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded onto a 10
(wtvol) polyacrilamide gels that was 075 mm tick with a denaturing gradient of 35-65
(100 denaturant contained 7 M urea and 40 formamide) DGGE was performed in 1xTAE
buffer (20 M Tris-acetate 100 mM Na2EDTA pH 74) using a DGGE 2401 system (CBS
Scientific Co Del Mar CA USA) at 80 V and 60 ordmC for 16 h Gels were stained for 45 min in
1xTAE buffer containing Syber-Gold (500 μlmiddotl-1) and viewed under UV light Predominant
bands in DGGE gel were excised with a sterile razor blade and diluted in 50 μl of deionized
water overnight at 4ordmC Due to impossibility of reamplified bands DNA of the bands was
cloned in the pGEM-T Easy Vector (Promega Madison WI) Sequence of this PAH-degrader
uncultured bacterium (DUB) were edited and assembled as described above and included in
the matrix to perform the phylogenetic tree as described previously using the identification
code DUB
Statistical analyses
The maximum specific growth rate (micromax) and the kinetic constant of PAH biodegradation (kB)
were evaluated by both one and two-way analysis of variance (ANOVA) using Statistica 60
software (Statsoft Inc Tulsa OK USA) to determine differences between PAH (naphthalene
phenanthrene and anthracene) and surfactants (Tween-80 and Tergitol NP-10) Prior to
analyses Cochranrsquos C-test was used to check the assumption of homogeneity of variances
Student-Newman-Keuls test (SNK) was used to discriminate among different treatments after
significant F-test Differences in microbial assemblages were graphically evaluated for each
factor combination (surfactant and time) with non-metric multidimensional scaling (MDS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
96
using PRIMER software SIMPER method was used to identify the percent contribution of
each band to the dissimilarity or similarity in microbial assemblages between and within
combination of factors Based on Viejo (2009) bands were considered ldquohighly influentialrdquo if
they contributed to the first 70 of cumulative percentage of average dissimilaritysimilarity
betweenwithin combination of factors
Results and discussion
Bacterial growth and toxicity media during biodegradation of PAH
Since some surfactants can be used as carbon sources cell growth of the consortium was
measured with surfactant and PAH and only with surfactant without PAH to test the ability of
consortium to degrade and grow with both surfactants (Figure 1A) The microbial consortium
C2PL05 growth was significantly lower with Tergitol NP-10 than that reached with Tween-80
which showed the best cell growth with a maximum density (Figure 1A) In addition the
growth curve with PAH and Tergitol NP-10 showed a longer latent phase (36 hours) than
with PAH and Tween-80 (lt 12 hours) The specific growth rate (micromax) of the consortium
C2PL05 was significantly higher (Table 1A) with Tween-80 than that with Tergitol NP-10 The
results showed that Tween-80 was biodegradable for consortium C2PL05 since that
surfactant was used as the only carbon source (Figure 1A) Finally when using Tergitol NP-
10 as the only carbon source growth was not observed so that this surfactant was not
considered biodegradable for the consortium
Toxicity test (bioluminescence inhibition in Vibrio fischeri) indicates that high values
observed during the PAH degrading process with Tergitol NP-10 is caused at the initial time
by both PAH and surfactant (Figure 1B) However when PAH are totally consumed (40-45
days) toxicity still remained high and constant which means that toxicity is only due to the
Tergitol NP-10 (Figure 1B) The toxicity of PAH + biodegradable surfactant (Tween-80)
treatment decreased as the PAH and the surfactant were consumed and was almost
depleted (30) after 40 days of cultivation The toxicity showed a slight increment at the
beginning of the degradation process (Figure 1B) as a consequence of the potential
accumulation of intermediate PAH degradation products (Molina et al 2009)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
97
00
02
04
06
08
10
12
14
16
18
0 5 10 15 20 25 30 35 40 45
30
40
50
60
70
80
90
100
Tox
icity
(
)
Time (day)
B
A
Abs
orba
nce 60
0 nm
(A
U)
Figure 1 (A) Cell density of the consortium C2PL05 with PAH and Tween-80 () with
Tween-80 () with PAH and Tergitol NP-10() and with Tergitol NP-10 () (B)
Toxicity of the cultivation media during degradation of PAH by the consortium C2PL05
grown with Tween-80 () Tergitol NP-10 () and of the control experiment PAHs
without surfactants ()
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
98
The residual total concentration of three PAH of the treatments with surfactants and
the treatments without any surfactants added is shown in Figure 2 The consortium was not
able to consume the PAH when surfactants were not added PAH biodegradation by the
consortium C2PL05 was higher and faster (15 days) with Tween-80 than with Tergitol NP-10
(40 days) In all cases when surfactant was used no significant amount of PAH were
detected in precipitated or bioadsorbed form at the end of each experiment which means
that all final residual PAHs were soluble
0 5 10 15 20 25 30 35 40 45
0
10
20
30
40
50
60
70
80
90
100
Res
idua
l con
cent
ratio
n of
PA
Hs
()
Time (days)
Figure 2 Residual total PAH concentration (wt) in the treatment with Tween-80
() Tergitol NP-10 () and without surfactant ()
According to previous works (Bautista et al 2009 Molina et al 2009) these results
confirm that this consortium is adapted to grow with PAH as only carbon source and can
degrade PAH efficiently when surfactant is added According to control experiments (PAH
without consortium C2PL05) phenathrene and anthracene concentration was not affected by
any abiotic process (kA asymp 0 h-1) in the case of naphthalene some degree of abiotic depletion
was measured during the controls yielding an apparent first-order abiotic rate constant of
27middot10-3 plusmn 7middot10-5 h-1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the treatments so this not influence in the high
biodegradation rate of naphthalene for Tween-80 treatments The biotic depletion rate (kB) of
the three PAH was significantly higher for Tween-80 than that calculated for Tergitol NP-10
(Table 1B) There were no significant differences between PAH for Tergitol NP-10 (2 x 10-3 plusmn
4 x 10-4) whereas in the case of Tween-80 the value of kB for naphthalene (3 x 10-2 plusmn 6 x 10-4)
was higher than that for phenanthrene and anthracene (1 x 10-2 plusmn 4 x 10-4)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
99
Table 1 Analysis of variance (ANOVA) for the effects of surfactants on the specific
growth rate micromax (A) and for the effects of the surfactants and PAH on the biotic
degradation rate kB (B) of the C2PL05 consortium SS is the sum of squares and df
the degrees of freedom
Effect (A) SS df F-value p-value
Surfactant 16 1 782 0001
Error 0021 2
Effect (B) SS df F-value p-value
PAH 15middot10-4 2 779 0001
Surfactant 82middot10-4 1 4042 0001
PAH x Surfactant 12middot10-4 2 624 0001
Error 203middot10-7 12
Molecular characterization of the cultured bacteria of the consortium C2PL05 and dynamics
during the PAH degradation
The identification of cultured microorganisms and their phylogenetic relationships are keys to
understand the biodegradation and ecological processes in the microbial consortia From the
consortium C2PL05 grown with Tween-80 91 strains were isolated and sequenced From
them 7 different genotypes of PAH-degrading cultures (DIC-1 JA DIC-2 JA DIC-5 JA DIC-6
JA DIC-7 JA DIC-8JA and DIC-9JA) were identified by 16S rRNA For the treatment with
Tergitol NP-10 83 strains were isolated and sequenced and 6 different genotypes were
identified (DIC-1 RS DIC-2 RS DIC-3 RS DIC-4 RS DIC-5 RS and DIC-6 JA) One of the
isolated cultures from Tergitol NP-10 showed an identical sequence to one of the strains
grown with Tween-80 therefore the previous code (DIC-6JA) was kept Table 2 show a
summary of the PAH-degrader cultures identification The aligned matrix contained 1576
unambiguous nucleotide position characters with 424 parsimony-informative Parsimony
analysis of the data matrix yielded 10 parsimonious trees with CI = 0609 and RI = 0873 In
the parsimonic consensus tree 758 of the clades were strongly supported by boostrap
values higher or equal to 70 (Figure 3) All cultivable strains identified were γ-
proteobacteria (gram-negative) and were located in three clades Pseudomonas clade
Enterobacter clade and Stenotrophomonas clade These results are consistent with those of
Vintildeas et al (2005) who observed a strong dominance of gram negative bacteria in PAH
contaminated soil during the bioremediation process In Pseudomonas clade (Figure 3) DIC
are located in three clearly groups So DIC-2RS and DIC-3RS were grouped with P
frederiksbergensis which has been previously described in polluted soils (ie Holtze et al
2006) showing ability to reduce the oxidative stress generated during the PAH degrading
process DIC-1JA DIC-2JA (Tween-80) and DIC-1RS (Tergitol NP-10) were nested in very
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
100
solid group characterized by the presence of the type strain P koreensis previously studied
as an agricultural soil species (Kwon et al 2003) and DIC-5RS was located in P putida
group well known by their capacity to degrade high molecular weight PAH (Samantha et al
2002) to produce surfactants (Kruijt et al 2009) and to resist high temperature and salinity
(Egamberdieva amp Kucharova 2009) So several species of Pseudomonas (ie P putida P
fluorescens) have been widely studied in bioremediation (Molina et al 2009) and the present
results confirmed that it was the most representative group with the non biodegraded
surfactant treatment DIC-7JA DIC-8JA and DIC-9JA (Tween-80) which were identified as E
cloacae (Table 2) belonged to the Enterobacter clade with a strongly statistic support (Figure
3) In this clade DIC-4RS (Tergitol NP-10) is genetically related with E ludwigii which has
been recently described as relevant medical species (Hoffman et al 2005) but completely
unknown his PAH degrading capacity Enterobacter genus has been traditionally studied by
its animal gut symbiotic function but rarely recognized as a soil PAH degrading group
(Toledo et al 2006) In this phylogenetic tree E cloacae and E ludwiggi were not resolved
This result is according to Roggenkamp (2007) who consider necessary to use more
molecular markers within Enterobacter taxonomical group in order to contrast the
phylogenetic relationships In addition Enterobacter genera may not be a monophyletic
group (Kampfer et al 2005) Therefore more phylogenetic studies need to be done to clarify
the species concept within this group Finally DIC-5JA (Tween-80) and DIC-6JA isolated
from experiments using both surfactants (Tween-80 and Tergitol NP) are clearly belong to
type strain Stenotrophomonas clade genetically close to S maltophiliaT (Table 2) which has
been described as PAH-degrader (Zocca et al 2004)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
101
Figure 3 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) from the consortium C2PL05 with Tergitol NP (DIC-1JA ndash DIC-9JA)
and Tween-80 (DIC-1RS ndash DIC-5RS) and PAH-degrader uncultured bacteria (DUB) obtained from
DGGE of the consortium with both surfactant at 0 15 and 30 days of the process Boostrap values of
neighbourjoining and parsimonus higher than 50 are showed on the branch of the tree (NJMP) No
incongruence between parsimony and neighbour joining topology were detected Pseudomonas
genus has been designated as P Pantoea genus as Pa Sphingobium as S and Sphingomonas as
Sp Xantomonas as X and Xyxella as Xy T= type strain
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
102
Table 2 Bacteria identification and percentage of similarity from the GenBank data base Degrading
uncultured bacteria (DUB) form DGGE bands and degrading isolates cultured (DIC)
Colonies identified by cultivable techniques
DIC simil Mayor relationship with bacteria
of GenBank(acc No) Phylogenetic group
DIC-1RSb 980 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ)
DIC-2RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-3RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-4RS b 990 Enterobacter ludwigii (AJ853891) Enterobacter cloacae (EU733519)
Enterobacteriaceae (γ)
DIC-5RS b 990 Pseudomonas putida (EU046322) Pseudomonadaceae (γ) DIC-6JA-6RS c 1000 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-1JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-2JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-5JA a 9964 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-7JA a 9985 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-8JA a 9993 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-9JA a 100 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ)
Identification by non-cultivable techniques
DUB Band
simil Mayor relationship with bacteria
of GenBank (acc No) Phylogenetic group
DUB-1RS a 1 970 Uncultured Nitrobacteria sp (AM990004) Caulobacteraceae (α) DUB-2RS b 21 980 Bradyrhizobium sp (HQ171485) Bradyrhizobiaceae (α) DUB-3RS b 24 940 Uncultured bacterium (AY939443) -- DUB-4RS b 24 100 Uncultured Pseudomonas sp (HM561497) Pseudomonadaceae (γ) DUB-10RSb 28 980 Uncultured Sphingomonas sp (HM438638) Sphingomonadaceae(α) DUB-11RSa 28 960 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-6RS b 29 980 Pseudomonas stutzeri (HQ130335) Pseudomonadaceae (γ) DUB-8RS b 29 980 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-5RS b 29 990 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-7RS b 29 980 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-9RS b 30 970 Bacterium (AJ295668) --
a DIC or DUB belonging to treatments with Tween-80 b DIC or DUB belonging to treatments with Tergitol NP-10 c DIC or DUB belonging to treatments with Tween-80 and Tergitol NP-10
With respect to the dynamics of the microorganisms isolated from the microbial
consortium C2PL05 (Figure 4) Pseudomonas (DIC-1RS DIC-2RS and DIC-5RS Figure 4A
4B) with a percentage around 60 and Stenotrophomonas (only DIC-6JA Figure 4A and
4D) with presence of 90 were dominant groups during the PAH degrading process with
Tergitol NP-10 at 0 and 30 days in the case of Pseudomonas and at 15 days in the case of
Stenothrophomonas Enterobacter (DIC-4RS Figure 4A 4D) only was present at the end of
the process with a percentage around 40 With Tergitol NP-10 Pseudomonas sp group
was dominant coincident with the highest relative contribution of PAH degrading bacteria to
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
103
total heterotrophic bacteria at the beginning (33 of contribution) and at the end of the
degradation process (41) However Enterobacter (DIC-7JA DIC-8JA and DIC-9JA Figure
4E and 4H) with a maximum presence of 98 at 0 days and Stenotrophomonas (DIC-6JA
Figure 4E and 4G) with a maximum presence of 85 at the end of the process were
dominant with the biodegradable Tween-80 Thus Enterobacter sp seems to start the PAH
degradation process and Stenotrophomonas to finish it but at 15 days three groups coexist
within a contribution ranging 20 to 50 (Figure 4E) Therefore in agreement with other
authors (Colores et al 2000) the results of the present work confirm changes in the
bacterial (cultured and non-cultured) consortium succession during the PAH degrading
process driven by surfactant effects According to Allen et al (1999) the diversity of the
bacteria cellular walls may explain the different tolerance to grow depending on the
surfactant used Previous works (Piskonen amp Itaumlvaara 2004) have shown the capacity of
some bacteria to use both surfactants (Tergitol NP-10 and Tween-80) as carbon sources
However in agreement with recent studies (Bautista et al 2009) the present work confirms
that Tergitol NP-10 is not degradable by the consortium C2PL05 These results showed a
drastic change of the consortium composition after the addition of surfactant
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
104
0 15 30
0102030405060708090
100
102030405060708090
100
D
C
B
A
0 15 30
F DIC-1JA DIC-2JA
E
G DIC-6JA DIC-5JA
0 15 30
H
Time (day)
DIC-7JA DIC-8JA DIC-9JA
Pse
udom
onas
ribot
ypes
(
)
DIC-1RS DIC-2RS DIC-3RS DIC-5RS
102030405060708090
100
Ste
notr
opho
mon
as
ribot
ypes
(
)
DIC-6JA
0 15 30
102030405060708090
100
Ent
erob
acte
r rib
otyp
es (
)
DIC-4RS
Time (days)
Tot
al s
trai
ns (
)
Figure 4 (A) Dynamics of the microbial consortium C2PL05 during PAH degradation process with
Tergitol NP-10 and (E) with Tween-80 as surfactants Isolated and identified genus were
Pseudomonas () Stenotrophomonas () and Enterobacter () Dynamics and succession of
the (B) Pseudomonas (C) Stenotrophomonas and (D) Enterobacter ribotypes with Tergitol NP-10
as surfactant Dynamics and succession of the (F) Pseudomonas (G) Stenotrophomonas and (H)
Enterobacter ribotypes
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
105
Biodiversity and evolution of the non-cultivable bacteria of the consortium during PAH
degradation
The most influential DGGE bands to similarity 70 of contribution according to the results of
PRIMER analyses were cloned and identified allowing to know the bands and species
responsible of similarities and dissimilarities SIMPER procedure (Clarke 1993) was used to
identify the percentage contribution () that each band made to the measures of the Bray-
Curtis similarity between treatments at each surfactant (Tween-80 and Tergitol-NP) and time
(initial time after 15 and 30 days) Bands were selected as lsquoimportantrsquo to be identified if they
contributed to the first 70 of cumulative percentage of average similarity between
treatments Summary of the identification process are shown in Table 2 Phylogenetic
relationship of these degrading uncultured bacteria was included in the previous
parsymonious tree (Figure 3) In total 11 uncultured bacteria were identified DUB-4RS
DUB-6RS DUB-8RS and DUB-11RS were located in the Pseudomonas clade but these
uncultured bacteria were no grouped with a particular species of the genus DUB-5RS DUB-
7RS were identified as Sphingobium sp and DUB-10RS as Sphingomonas sp and located
in the Sphingobium and Sphingomonas clade respectivelly DUB-2RS was nested in
Bradyrhizobium clade because was identified as Bradyrhizobium sp and this clade was
supported by the type strain B japonicum In the same way DUB-1RS identified as
Uncultured Nitrobacteria was located in the Nitrobacteria clade belonged to N
hamadeniensis type strain Finally DUB-3RS and DUB-9RS were not identified with a
particular genus so they were located in a clade composed by uncultured bacteria The
phylogenetic relationship of these degrading uncultured bacteria allows expanding
knowledge about the consortium composition and process development Some of them
belong to α-proteobacteria DUB-5RS and DUB-7RS were related to Sphingobium group and
DUB-10RS with Sphingomonas clade thought this relationship should be confirmed
considering the low boostrap values Sphingomonas is a genus frequently isolated as PAH
degrader (Jing et al 2007) and important in the degradation of phenanthrene metabolites
(Tao et al 2007) Similarly Sphingobium sp has been described as PAH degrader
specifically in phenanthrene degradation process (Jing et al 2007) DUB-2RS belonged to
Bradyrhizobiaceae phylogenetic group and although Bradyrhizobium are genera barely
described as PAH degrading bacteria some studies based on PAH degradation by chemical
oxidation and biodegradation process have described that this plant-associated bacteria are
involved in the degradation of extracting agent used in PAH biodegradation techniques in
soils (Rafin et al 2009) DUB-1RS is a genotype related to Nitrobacteria clade However
Nitrobacteria has not been described as PAH degrader but this bacteria transform nitrites in
nitrates from the oxidation of nitrites (Modrogan et al 2010) and it is likely involved in the
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
106
nitrites oxidation process when the bioavailability of PAH in the media are low and so it is
not toxic for this bacteria Finally DUB-8RS DUB-6RS and DUB-11RS showed a high
similitude with Pseudomonas strain though the phylogenetic relationship with Pseudomonas
clade of DUB-11RS should be confirmed
Analysis of DGGE gel (Figure 5) showed that treatment with Tergitol NP-10 had very
few changes during biodegradation process whereas when the consortium was grown with
the biodegradable surfactant Tween-80 more changes were observed Similarity (Table 3)
between treatments were compared and analyzed by type of surfactant (Tween-80 vs
Tergitol NP-10) or by sampling time (15 days vs 30 days) The MDS analysis (Table 3)
showed the lowest values of Bray Curtis similarity coefficient between the consortium at
initial time (T0 not exposed to PAH and surfactants) with the PAH and Tween-80 after 15
days (16) and 30 days (7) However the similarity of T0 with PAH and Tergitol NP-10 after 15
days (22) and 30 days (26) was much higher Similarity between time treatments (15 and 30
days) within Tergitol NP-10 (56) was higher than with Tween-80 (32) The similarity within
treatments with Tween-80 was mainly due to the bands 1 and 29 (Table 3 Uncultured
Nitrobacteria and Sphingobium and Pseudomonas respectively see Table 2) whereas the
similarity within Tergitol NP-10 treatment was due to bands 1 and 30 (Table 3 Uncultured
Nitrobacteria and Uncultured bacteria respectively see Table 2)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
107
Figure 5 Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen fragments
from the consortium C2PL05 with initial inoculum (lane 1) with Tween-80 at 15 (lane 2) and 30 (lane 4)
days with Tergitol NP-10 at 15 (lane 3) and 30 (lane 5) days and molecular weight markers (lane 0)
According to PRIMER analysis similar bands between treatments (15 and 30 days) with Tergitol NP-
10 () and between treatments (15 and 30 days) with Tween-80 () are shown
1 Uncultured Nitrobacteria sp(DUB-1RS) 21 Bradyrhizobium sp (DUB-2RS) 24 Uncultured bacterium (DUB-3RS)
Uncultured Pseudomonas (DUB-4RS) 28 Uncultured Sphingomonas sp (DUB-10RS)
Pseudomonas sp (DUB-11RS) 29 Pseudomonas stutzeri (DUB-6RS) Pseudomonas sp
(DUB-8RS) Sphingobium sp(DUB-5RS DUB-7RS)
30 Uncultured Bacterium (DUB-9RS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
108
Table 3 Bands contributing to approximately the first 70 of cumulative percentage
of average similarity () Bands were grouped by surfactant and time
Band Tween-80 TergitolNP-10 15 days 30 days 1 3828 2105 2707 3014 29 2969 1509
30 2469 19
24 881 3447
27 845
21 516
Cumulative similarity () 3168 4479 4479 3391 Cloning was not possible
The genera identified in this work have been previously described as capable to
degrade the three PAH completely and efficiently with a reduction of the toxicity (Bautista et
al 2009) In the case of the treatment with Tween-80 the lower biodiversity may be caused
by a few dominant species of these genera driven during the PAH degradation process by
antagonist and synergic bacterial interactions and not by differences in the functional
capacities However when consortium grows with a non-biodegradable surfactant there is
higher biodiversity of species and interaction because the activity of various functional
groups can be required to deal the unfavorable environmental conditions
Conclusions
The choice of surfactants to increase bioavailability of pollutants is critical for in situ
bioremediation because toxicity can persist when surfactants are not biodegraded
Nevertheless surfactants affect the dynamics of microbial populations in a stable PAH-
degrading consortium From the application point of view the combination of culturable and
non culturable identification techniques may let to optimize the bioremediation process For
bioaugmentation processes culturable tools help to select the more appropriate bacteria
allowing growing enough biomass before adding to the environment However for
biostimulation process it is important to know the complete consortium composition to
enhance their natural activities
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
109
Acknowledgment
Authors are deeply indebted to Raquel Sanz Laura Saacutenchez and Laura Garciacutea and for their
support during the development of the experiments Authors also gratefully acknowledged
the financial support from the Spanish Ministry of Environment (Research project 1320062-
11) and Fundacioacuten Alfonso Martiacuten Escudero Authors also thank Repsol-YPF for providing
the soil samples This work is framed within the Official Maacutester en Ciencia y Tecnologiacutea
Ambiental from Universidad Rey Juan Carlos
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
110
References
Allen CRC Boyd DR Hempenstall F Larkin MJ amp Sharma D 1999 Contrasting effects
of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons
to cis-dihydrodiols by soil bacteria Appl Environ Microbiol 65 1335-1339
Andreoni V Cavalca L Rao MA Nocerino G Bernasconi S DellrsquoAmico E Colombo M
amp Gianfreda L 2004 Bacterial communities and enzyme activities of PAH polluted
soils Chemosphere 57 401-412
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 30 1ndash10
Clements WH Oris JT amp Wissing TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Lepomis macrochirus
Archiv Environ Contam Toxicol 26 261ndash266
Colores GM Macur RE Ward DM amp Inskeep WP 2000 Molecular analysis of
surfactant-driven microbial population shifts in hydrcarbon-contaminated soil Appl
Environ Microbiol 66 2959-2964
Egamberdieva D A amp Kucharova Z 2009 Selection for root colonising bacteria stimulating
wheat growth in saline soils Biol Fert Soils 45 563ndash571
Gallego RJS Garciacutea-Martiacutenez MJ Llamas JF Belloch C Pelaacuteez AI amp Saacutenchez J
2007 Biodegradation of oil tank bottom sludge using microbial consortia
Biodegradation 18 269ndash281
Ghazali FM Rahman RNZA Salleh AB amp Basri M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hydrocarbons (PAH) A review J Hazard Mater 169 1-15
Hoffmann H Stindl S Stumpf A Mehlen A Monget D Heesemann J Schleifer KH amp
Roggenkamp A 2005 Description of Enterobacter ludwigii sp Nov a novel
Enterobacter species of clinical relevance Syst Appl Microbiol 28 206ndash212
Holtze MS Nielsen P Ekelund F Rasmussen LD amp Johnsen K 2006 Mercury affects
the distribution of culturable species of Pseudomonas Appl Soil Ecol 31 228ndash238
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor R 1969 Evolution of protein molecules in Mammalian protein
metabolism (H Munro ed) Academic Press New York
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
111
Katoh K amp Toh H 2008 Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMC Bioinformatics 9 paper
212
Kampfer P Ruppel S amp Remus R 2005 Enterobacter radicincitans sp Nov a plant
growth promoting species of the family Enterobactriaceae Syst Appl Microbiol 28
213ndash221
Kolomytseva MP Randazzo D Baskunov BP Scozzafava A Briganti F amp Ludmila A
2009 Role of surfactants in optimizing fluorene assimilation and intermediate
formation by Rhodococcus rhodochrous VKM B-2469 Bioresource Technol 100
839-844
Kruijt M Tran H amp Raaijmakers JM 2009 Functional genetic and chemical
characterization of biosurfactants produced by plant growth-promoting Pseudomonas
putida J Appl Microbiol 107 546-556
Kwon SW Jong WS Kim S Park IC Yoon SH Park DH Lim CK amp Go SJ 2003
Pseudomonas koreensis sp Nov Pseudomonas umsongensis sp Nov and
Pseudomonas jinjuensis sp Nov novel species from farm soils in Korea Int J Syst
Evol Microbiol 53 21ndash27
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang Y amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Modrogan C Diaconu E Orbulet OD amp Miron AR 2010 Forecasting Study for Nitrate Ion
Removal Using Reactive Barriers Rev Chim 6 580-584
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions Eur J Soil Sci 54 655-670
Piskonen R amp Itaumlvaara M 2004 Evaluation of chemical pretreatment of contaminated soil
for improved PAH bioremediation Appl Microbiol Biotechnol 65 627-634
Rafin C Veignie E Fayeulle A amp Surpateanu G 2009 Benzo[a]pyrene degradation using
simultaneously combined chemical oxidation biotreatment with Fusarium solani and
cyclodextrins Bioresource Technol 100 3157-3160
Roggenkamp A 2007 Phylogenetic analysis of enteric species of the family
Enterobacteriaceae using the oric-iocus Syst Appl Microbiol 30 180-188
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
112
Samantha SK Singh OV amp Jain RK 2002 Polycyclic aromatic hydrocarbons
environmental pollution and bioremediation Trends Biotechnol 20 243-248
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil in Singh
A Kuhad RC Ward OP (Eds) Adv Appl Biorem p 103-121 Springer Berlin
Tao X-Q Lu G-N Dang Z Yi X-Y amp Yang C 2007 Isolation of ohenanthrene-degrading
bacteria and characterization of phenanthrene metabolites Worl J Biotechnol 23
647-6554
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities Syst Appl Microbiol 29 244ndash252
Torsvik V amp Ovreas L 2002 Microbial diversity and function in soil from genes to
ecosystems Curr Opin Microbiol 5 240ndash245
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Mar Eco- Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Zocca C Gregori SD VisentiniF amp Vallini G 2004 Biodiversity amongst cultivable
polycyclic aromatic hydrocarbon-transforming bacteria isolated from an abandoned
industrial site FEMS Microbiol Lett 238 375-382
Capiacutetulo
Enviado a FEMS Microbiology Ecology en Diciembre 2012
Simarro R Gonzaacutelez N Bautista LF amp Molina MC
High molecular weight PAH biodegradation by a wood degrading
bacterial consortium at low temperatures
Biodegradacioacuten de hidrocarburos de alto peso molecular por un consorcio bacteriano
degradador de madera a bajas temperaturas
3
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
115
Abstract
The aim of this work was to evaluate the ability of two bacterial consortia (C2PL05 and
BOS08) extracted from very different environments to degrade low (naphthalene
phenanthrene anthracene) and high (pyrene and perylene) molecular weight polycyclic
aromatic hydrocarbons (PAH) at high (15-25ordmC) and low (5-15ordmC) temperature ranges
C2PL05 was isolated from a soil in an area chronically and heavily contaminated with
petroleum hydrocarbons and BOS08 from decomposing wood in an unpolluted forest free of
PAH Bacterial consortia were described by cultivable and no-cultivable techniques (DGGE)
PAH-degrading bacterial population measured by most probable number (MPN)
enumeration increased during the exponential phase Toxicity estimated by MicrotoxTM
method was reduced to low levels and the final PAH depletion determined by high-
performance liquid chromatography (HPLC) confirmed the high degree of low and high
molecular weight PAH degradation capacity of both consortia The PAH degrading capacity
was also confirmed at low temperatures and specially by consortium BOS08 where strains
of Acinetobacter sp Pseudomonas sp Ralstonia sp and Microbacterium sp were identified
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
117
Introcuduction
Polycyclic aromatic hydrocarbons (PAH) constitute a diverse class of organic compounds
formed by two or more aromatic rings in several structural configurations having
carcinogenic mutagenic and toxic properties Therefore environment contamination by PAH
is currently a problem of concern and it has been shown that bioremediation is the most
efficient practice retrieving the original conditions of the ecosystem (Haritash amp Kaushik
2009) However the high molecular weight PAH (HMW-PAH) such as pyrene
benzo[a]pyrene or benzo[b]fluoranthene are generally recalcitrant and resistant to microbial
attack due to their low solubility and bioavailability Therefore these compounds are highly
persistent in the environment and bioaccumulated in organisms (Lafortune et al 2009)
Studies on PAH biodegradation with less than three rings have been the subject of many
reviews (ie Sutherland et al 1995) However there is a lack of knowledge about the
HMWndashPAH biodegradation (Kanaly amp Harayama 2000)
Microbial communities play an important role in the biological removal of pollutants in
soils (MacNaughton et al 1999) Therefore changes in environmental condition may alter
species diversity of the soil microbiota and their metabolic rates (Margesin amp Schinner
2001) In areas chronically polluted by PAH there are abundant bacteria able to degrade
those toxic contaminants by using them as sole carbon and energy sources (Taketani et al
2010) Recent works (Tian et al 2008 Surridge et al 2009 Couling et al 2010) have
reported the potential ability to degrade PAH by microorganisms apparently not previously
exposed to those toxic compounds This is extensively known for lignin degrading white rot-
fungi that produce a set of extracellular enzymes such as oxidases and peroxidases (Wong
2009) with low substrate specificity that expand their oxidative action beyond lignin being
capable to degrade other complex phenolic compounds and PAH (ie Canet et al 2001)
Although less extensively than in fungus PAH degradation capacity have been also reported
in this type of environment in bacteria belonged to genera Pseudomonas (Zimmermann
1990 McMahon et al 2007) However according to Couling et al (2010) the wide-spread
capacity to degrade PAH by microbial communities even from unpolluted soils can be
explained by the fact that PAH are ubiquitously distributed by natural process throughout the
environment at low concentration enough for bacteria to develop degrading capacity
Regardless of these issues there are some abiotic factors such as temperature that
may greatly influence biodegradation process It has been shown (Mohn amp Stewart 2000)
that although biodegradation of PAH is more efficient in the range 20-30 ordmC it can be carried
out even in colder (lt5 ordmC) environments (Eriksson et al 2001) At low temperature diffusion
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
118
and solution rates and so bioavailability of PAH decreases (Haritash amp Kaushik 2009)
Simultaneously the microbial metabolism is slowed-down increasing the lag period (Atlas amp
Bartha 1972 Eriksson et al 2001) However and according to the hypothesis that
degrading microorganisms are present in most of ecosystems there are degrading bacteria
adapted to low temperatures (Yakimov et al 2003 Brakstad amp Bonaunet 2006) that can
express degrading capacity So the study of biodegradation at low temperatures is important
since the temperature of more than 90 of the seawater volume is below 5 ordmC In addition
PAH and anthropic discharges sometimes have occurred and may occur in sea water (Bode
et al 2006 Soriano et al 2006) or in cold and even extreme environments such as in
Alaska (Bence et al 1996)
The main goal of this work was to study the effect of low temperature on HMW-PAH
degradation rate by two different consortia isolated from two different environments one from
decay wood in an unpolluted forest (consortium BOS08) and other from a polluted soil
exposed to hydrocarbons The purpose of the present work was also to describe the
microbial dynamics along the biodegradation process as a function of temperature and type
of consortium used
Materials and methods
Chemicals and media
Naphthalene phenanthrene anthracene pyrene and perylene (all gt99 purity) purchased
from Sigma-Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) were prepared
in a stock solution in n-hexane (Fluka Steinheim Germany) to get a final concentration of
002 gl-1 for naphthalene phenanthrene and anthracene 001 gl-1 for pyrene and 0005 gl -1
for perylene Tween-80 purchased from Sigma-Aldrich was added according to previously
work (Bautista et al 2009) Composition of optimized Bushnell Haas Broth medium (BHB)
(Simarro et al 2010) was 02 g l -1 MgSO4middot7H2O 002 g l -1 CaCl2 2H2O 0088 g l -1 KHPO4
0088 g l -1 K2HPO4 209 g l -1 NaNO3 0015 g l -1 Fe2(SO4)3
Physicochemical characterization of soils and isolation of bacterial consortia
Consortia C2PL05 was isolated from a permanently polluted soil from a petroleum refinery
(Ciudad Real Spain) with a range of environmental temperatures from 10 ordmC in winter to 25
ordmC in summer The consortium BOS08 was extracted from dead wood in a pristine Atlantic
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
119
forest in Fragas do Eume Galicia Spain (latitude 43ordm 4175acute north longitude 8ordm 0683acute west)
with oaks as the dominant flora species and with a range of temperatures of 10 ordmC in winter
and 18 ordmC in summer To obtain the microbial consortia sieved soil and the wood sample
were suspended in PBS (110) and stirred overnight at 25 ordmC Then 15 ml of each extract
was inoculated in 50 ml of BHB (pH 70) with Tween-80 1 (vv) as surfactant and
naphthalene phenanthrene anthracene pyrene and perylene (each at 500 mg l -1) as carbon
sources Each culture were incubated in an orbital shaker at 150 rpm 25 ordmC and dark
conditions until the exponential phase was completed (asymp 5 days) monitoring cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK)
Sieved (lt2 mm) river sand was used as substrate Prior to use it was burned at 550
ordmC in a furnace to remove organic matter and microorganisms Water holding capacity (WHC)
of the river sand was measured following the method described by Wilke (2005)
Experimental design and treatments conditions
15 microcosms (triplicates by five different incubation times) were performed with consortium
C2PL05 at high temperature range (H) 16 hours with light at 25 ordmC followed by 8 hours in
the dark at 15 ordmC Another 15 microcosms with consortium C2PL05 were incubated at low
temperature range (L) 16 hours with light at 15 ordmC followed by 8 hours in the dark at 5 ordmC
The same experiments were performed with consortium BOS08 Microcosms were incubated
in suitable chambers equipped with temperature lightdarkness cycle and humidity (60)
control systems Each microcosms contained 90 g of sterilized sand 18 ml of BHB (60 of
WHC) with Tween-80 1 (vv) 2 ml of PAH stock solution in n-hexane (final amount of PAH
per tray of 20 mg of naphthalene 20 mg of phenanthrene 20 mg of anthracene 10 mg of
pyrene and 5 mg of perylene) and 35 ml of bacterial consortium (0088 AU = 275x104
cellsmiddotml -1 for C2PL05 and 0051 AU = 286 x 104 cellsmiddotml-1 for BOS08)
Bacterial growth MPN and toxicity assays
Bacterial density during the PAH degrading process was monitored at 0 11 33 66 101 and
137 days by changes in the absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) From the absorbance data the
intrinsic growth rate in the exponential phase was calculated by applying Equation 1
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
120
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time Increments were normalized by
absorbance measurements at initial time (day 0) to correct the inoculum dilution effect
Heterotrophic and PAH-degrading population from the consortia were estimated by a
miniaturized most probably number technique (MPN) in 96-well microtiter plates with eight
replicate wells per dilution (Wrenn amp Venosa 1996) Total heterotrophic microbial population
was estimated in 180 μl of Luria Bertani (LB) medium with glucose (15 gl -1) and 20 microl of the
microbial consortium PAH-degrading population in the inoculum was estimated in 180 microl of
BHB medium containing Tween-80 (1 vv) 10 microl of PAH stock mix solution as only carbon
source (n-hexane was allowed to evaporate prior to inoculation) and 20 microl of the microbial
consortium in each well
Toxicity during the PAH degradation was also monitored through screening analysis of
the samples following the MicrotoxTM method with the luminescent bacterium Vibrio fischeri
following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15 ordmC
Monitoring of PAH biodegradation
To confirm that consortium BOS08 was not previously exposed to PAH samples were
extracted with acetone and n-hexane according to Joslashrgensen et al (2005) and the
identification was performed by GC-MS analysis of the extract A gas chromatograph (model
CP3800 Varian Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary
column (15 m length 025 mm ID 025 μm film thickness) was coupled to a quadruple
mass-spectrometer detector (Model 1200L Varian) The stationary phase was composed by
phenyl (5) and dimethylpolysiloxane (95) as carried gas ice in the mobile phase
Temperature gradient program used was initial temperature of 80 ordmC for 2 min temperature
increase to 300 ordmC at the rate of 1 ordmC min-1 final temperature of 300 ordmC for 15 min with a
final duration of the method of 39 min In addition total petroleum hydrocarbons (TPH) in
both soils were extracted and quantified as is described previously
PAH from microcosms were extracted and analyzed at initial and final time to estimate
the total percentage of PAH depletion by gas cromatography using the gas cromatograph
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
121
equiped and protocol described previuosly For this 100 g of soil from each replicate were
dried overnight at room temperature and PAH were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inyect 05 μl in
the FDI chromatograph
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
To identify cultivable microorganisms samples from each microcosm were collected at zero
33 and 101 days of the biodegradation process To extract the microorganisms 15 g of soil
were suspended in PBS (110) and incubated overnight in an orbital shaker at 150 rpm
maintaining the same temperature and light conditions than during the incubation process
To get about 10 PAH-degrading colonies isolated 100 ml of the supernatant were placed
onto Petri plates with BHB medium and purified agar and were sprayed with a stock mix
solution of naphthalene phenanthrene anthracene pyrene and perylene (final concentration
500 mgL-1) as carbon source and incubated at the same temperature conditions
Total DNA of the PAH-degrading isolated cultures (DIC) was extracted using Microbial
DNA kit (MoBio Laboratories Solano Beach CA USA) and amplified using primers 16S F27
and 16S R1488 (Lane et al 1991) according to the ExTaq HS DNA polymerase protocol
(Molina et al 2009) Sequences were edited and assembled using ChromasPro software
version 142 (Technelysium Pty Ltd Tewantin Australia) to check for reading errors and
when possible resolving ambiguities BLAST search (Madden et al 1996 available at URL
httpncbinlmnihgovBLAST) was used to find nearly identical sequences for the 16S
rRNA sequences determined Sequences were aligned using the Q-INS-i algorithm (Katoh amp
Toh 2008a) of the multiple sequence alignment software MAFFT version 6611 (Katoh amp
Toh 2008b) aligning sequences in a single step
All identified sequence (by culture and no-culture techniques) and more similar
sequences downloaded from GenBank were used to perform the phylogenetic tree
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates using PAUP
40B10 (Swofford 2003) In addition maximum parsimony (MP) was also analyzed (Molina
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
122
et al 2009) Sequences of Aquifex piruphilus and Hydrogenobacter hydrogenophylus were
used as out-group
Denaturing gradient gel electrophoresis (DGGE) from microbial consortia during PAH
degrading process
A non culture-dependent molecular techniques as DGGE was performed to know the effect
of the temperature on total biodiversity of both microbial consortia during the PAH
degradation process by comparing the treatment at zero 33 and 101 day with the initial
composition of the consortia Total DNA was extracted from 025 g of the samples using
Microbial Power DNA isolation kit (MoBio Laboratories Solano Beach CA USA) and
amplified using the primers set 16S 338F-GC and 16S 518R according to ExTaq HS DNA
polymerase protocol (Promega Corp Madison WI USA) PCR product was loaded onto a
10 (wv) polyacrilamide gel with a denaturing gradient from 35 to 65 denaturant Gel
were stained with Syber-Gold and viewed under UV light and predominant bands in DGGE
gel were excised Due to impossibility to reamplify bands DNA of the bands was cloned in
the pGEM-T Easy Vector (Promega Madison WI) PAH-degrader uncultured bacterium
(DUB) were edited and assembled as described above and included in the matrix to perform
the phylogenetic tree Images of DGGE were digitalized and processed using the UN-Scan-It
gel analysis software version 60 (Silk Scientific US)
To identifiy the presence of fungi in the consortium BOS08 during the process total
DNA was extracted from the samples using Microbial Power DNA isolation kit (MoBio
Laboratories Solano Beach CA USA) and amplified with the primers set 18S ITS1F and
ITS4 according to Quiagen Multiplex PCR kit protocol DNA of Clitocybe metachroa was
extracted using DNeasy Plant Mini Kit (Quiagen) from the mushroom for use as PCR
positive PCR products were visualized under UV light on an agarose gel (1 ) using Syber-
Gold as intercalating agent
Statistical analysis
In order to evaluate the effects of inocula type and temperature on the final percentage of
PAH depletion and on the intrinsic growth rate (μ) bifactorial analysis of variance (ANOVA)
were used The variances were checked for homogeneity by the Cochranacutes test Student-
Newman-Keuls (SNK) test was used to discriminate among different treatments after
significant F-test representing this difference by letters in the graphs Data were considered
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
123
significant when p-value was lt 005 All tests were done with the software Statistica 60 for
Windows Differences in microbial assemblages were graphically evaluated for each factor
combination (time type of consortium and temperature) with a non-metric multidimensional
scaling (MDS) using PRIMER software (Clarke 1993) SIMPER method was used to identify
the percent contribution of each band from DGGE to the dissimilarity or similarity in microbial
assemblages between and within combination of factors Based on Viejo (2009) bands were
considered ldquohighly influentialrdquo if they contributed to the first 60 of cumulative percentage of
average dissimilaritysimilarity betweenwithin combination of factors
Results
Hydrocarbons in soils
Figure 1 shows GC-MS analysis of the extracted hydrocarbons from samples where both
consortia were isolated Soil samples where C2PL05 consortium was isolated contained 64
wt of total petroleum hydrocarbons (TPH) However no traces of PAH or any other
petroleum hydrocarbons were detected within samples where BOS08 consortium was
obtained
0 5 10 15 20 25 30 35
BO S08
C 2PL05
tim e (m in)
Figure 1 GC-MS total ion chromatogram from solvent extracted hydrocarbons in soils where
consortia C2PL05 and BOS08 were isolated
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
124
Cell growth intrinsic growth MPN and toxicity assays
Figure 2 (A B) shows the growth of both microbial consortia during PAH biodegradation
process Lag phases were absent and long exponential phases (until day 66 approximately)
were observed in all treatments except with the C2PL05 consortium at low temperature
(finished at day 11) In general higher cell densities were achieved in those microcosms
incubated in the higher temperature range Despite similar cell densities reached with both
consortia and both temperature levels the values of the intrinsic growth rate (μ) during the
exponential phase (Table 1) showed significant differences between consortia and
temperatures of incubation but not in their interaction (Table 2A) Differences between
treatments showed that the highest μ was obtained at high temperatures (25 ordmC-15 ordmC) and
with BOS08 consortium
Figure 2 (C D) showed that the initial number of PAH-degrading bacteria were at least
one order of magnitude lower than heterotrophic bacteria in both consortia The highest
heterotrophic bacteria concentration was reached after 33 days of incubation approximately
to a final value of 108- 109 cells g-1 soil (four orders of magnitude above the initial values)
The highest contribution of PAH-degrading bacteria to total heterotrophic bacteria was
observed at 33 days of incubation No differences were observed between temperature
ranges From 33 days both type of populations started to decrease but PAH-degrading
bacteria of consortia increased again at 101 days reaching values at the end of the process
similar to the initial ones
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
125
0 11 33 66 101 137
005
010
015
020
025
030
035
0 11 33 66 101 137
0 33 101 137102
103
104
105
106
107
108
109
0 33 101 137Time (day)Time (day)
Time (day)
Abs
orba
nce 6
00nm
(A
U)
Time (day)
DC
BA
cell
g so
il
Figure 2 Cell growth of consortia C2PL05 (A) and BOS08 (B) at high () and low () temperature
range during PAH biodegradation and MPN for consortia C2PL05 (C) and BOS08 (D) of heterotrophic
(squares) and PAH-degrading (circles) cultivated at high (filled symbols) and low (empty symbols)
temperature range
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
126
Table 1 Intrinsic growth rate (μ) and biodegradation percentage of phenanthrene (Phe) anthracene
(Ant) pyrene (Pyr) perilene (Per) and total PAH (Tot) at final time for consortia C2PL05 and BOS08 at
high (H) and low (L) temperature range Superscript letters (a to c) show differences between groups
(plt005 SNK) and plusmn SD the standard deviation
μ
Treatment d-1x10-3 plusmnSD x10-3
C2PL05 H 158 b 09 C2PL05 L 105 a 17
BOS08 H 241 c 17
BOS08 L 189 b 12
PAH biodegradation ()
Treatment Phe plusmn SD Ant plusmn SD Pyr plusmn SD Per plusmn SD Total plusmn SD
C2PL05 H 954 plusmn 04 993 plusmn 01 270 plusmn 62 986 plusmn 01 989 c plusmn 04
C2PL05 L 801 plusmn 61 459 plusmn 158 470 plusmn 118 538 plusmn 190 543 a plusmn 109
BOS08 H 938 plusmn 27 993 plusmn 04 472 plusmn 130 864 plusmn 61 866 bc plusmn 60
BOS08 L 940 plusmn 31 579 plusmn 31 542 plusmn 102 691 plusmn 137 677 ab plusmn 77
Table 2 Analysis of variance (ANOVA) of the effects on μ (A) total PAH biodegradation (B) and
biodegradation of pyrene and perilene (C) SS is the sum of squares and df the degree of freedoms
Factor df SS F
p-value
A) μ
Temperature a 1 36 x 10-3 5931 Consortium b 1 83 x 10-5 136
Temperature x Consortium 1 20 x 10-4 343 ns
Error 8 49 x 10-5 0001
B) Total PAH biodegradation ()
Treatment c 3 3526 73
Error 8 1281
C) Biodegradation of pyrene and perilene ()
Treatment c 3 11249 11 ns
PAH d 1 85098 251
Treatment x PAH 3 31949 31 ns
Error 16 54225
a high (15-25ordmC) or low (5-15ordmC) temperature range b consortium C2PL05 or BOS08 c C2PL05 at
high and temperature range or BOS08 at high and low temperature range d naphthalene
phenanthrene anthracene pyrene and perylene p lt 005 p lt 001 p lt 0001
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
127
With regard to toxicity values (Figure 3) complete detoxification were achieved at the
end of each treatment except for consortium C2PL05 (percentage of toxicity 40) incubated
at low temperature (Figure 3A) When consortium BOS08 was incubated at low temperature
there was a time period between 11 and 66 days that toxicity increased (Figure 3B)
0 11 33 66 101 137
0
20
40
60
80
100
0 11 33 66 101 137
BA
Time (day)
Tox
icity
(
)
Time (day)
Figure 3 Toxicity of microcosms with consortium C2PL05 (A) and BOS08 (B) incubated at high ()
and low () temperature range during PAH biodegradation process
Biodegradation of PAH
PAH biodegradation results are shown in Table 1 PAH depletion showed significantly
differences (Table 2B) within the consortium C2PL05 with highest values at high temperature
and the lowest at low temperature (Table 1) Those differences were not observed within the
BOS08 consortium and PAH depletion showed average values between values of C2PL05
depletion Regarding each individual PAH naphthalene was completely degraded at final
time 80 of phenanthrene was depleted in all treatments and anthracene and perylene
were further reduced at high (gt85) rather than low temperature (gt50) However pyrene
was significantly less consumed by the consortia than perylene (Table 1 and Table 2C)
Phylogenetic analyses
Phylogenetic relationships of the degrading isolated cultures and degrading uncultured
bacteria are shown in Figure 4 The aligned matrix contains 1349 unambiguous nucleotide
position characters with 505 parsimony-informative and 173 characters excluded Parsimony
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
128
analysis of the data matrix yielded 87 parsimonious trees with CI = 0756 RI = 0945 and a
length of 1096 Figure 4 also shows the topology of the neighbour joining tree
Inconsistencies were not found when analysing boostrap values of neighbour joining (NJ)
and maximum parsimony (MP)
Figure 4 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) and degrading uncultured bacteria (DUB) obtained from DGGE of the
consortia and cultivable identification process at day 0 33 and Boostrap values of neighbour joining
(NJ) and parsimonious (MP) are showed on the branch of the tree (NJMP) No incongruence between
parsimony and neighbour joining topology were detected Pseudomonas genus has been designated
as P Psychrobacter genus as Ps Acinetobacter as A and Ralstonia as R T= type strain
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
129
DIC-46-RS (Rhodococcus sp) DIC-47RS (Bacillus psychrodurans) and DUB-25RS
(Microbacterium sp) were not included in the phylogenetic tree due to their high phylogenetic
distance with most of the DIC and DUB Phylogenetic tree was composed by bacteria
belonged to γ- and β-Proteobacteria Group of γ- Proteobacteria was composed by
Acinetobacter clade Psychrobacter clade and Pseudomonas clade whereas β-
Proteobacteria group was only composed by Ralstonia clade Within Acinetobacter clade
although the identity approximation (BLAST option Genbank) reported A johnsonii and A
haemolyicus such as the species closest to some of the DIC and DUB the incorporation of
the types strains in the phylogenetic tree species do not showed a clear monophyletic group
Thus and as a restriction molecular identification of these strains (Table 3) was exclusively
restricted to genus level that is Actinobacter sp A similar criteria was taken for
Pseudomonas clade where molecular identifications carry out through BLAST were not
supported by the monophyletic hypothesis when type strains were included in the analysis
Psycrobacter clade sister group of Acinetobacter clade are represented by Psychrobacter
urativorans type strain (DQ143924T) in which DIC-14RS and DIC-23RS are nested β-
Proteobacteria is only composed by Ralstonia clade confirmed by RinsidiosaT (FJ772078T)
although DICs included in this clade are more related with the strain Ralsonia sp AF488779
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
130
Table 3 Identification and similarity () to bacteria from GenBank of cultivable strains
and DGGE bands (non-cultivable bacteria)
Days Consortium Temperature Strains Molecular Identification
(genera) 33
C2PL05
15 ordmC-5 ordmC
DIC-7RS DIC-8RS DIC-9RS DIC-11RS DIC-10RS DIC-12RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-13RS DIC-14RS DIC-15RS DIC-46RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Psychrobacter urativorans Pseudomonas sp Rhodococcus sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-16RS DIC-17RS DIC-18RS DIC-19RS DIC-20RS DIC-21RS DIC-22RS DUB-25RS DUB-26RS
Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-23RS DIC-47RS DUB-22RS DUB-23RS DUB-24RS DUB-25RS DUB-26RS
Psychrobacter urativorans Bacillus psychrodurans Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
101
C2PL05
15ordmC-5ordmC
DIC-24RS DIC-25RS DIC-26RS DIC-27RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-28RS DIC-29RS DIC-30RS DIC-31RS DIC-32RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-33RS DIC-34RS DIC-35RS DIC-36RS DIC-37RS DIC-38RS DIC-39RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
131
25 ordmC-15 ordmC
DIC-40RS DIC-41RS DIC-42RS DIC-43RS DIC-44RS DIC-45RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
Diversity and evolution of cultivated and uncultivated bacteria and dynamics during PAH
biodegradation
PCR analysis to identify fungal DNA in BOS08 was negative for the initial period of the
biodegradation process at both temperatures ranges Fungal DNA was only positive at high
temperatures and the end of the biodegradation process (101 and 137 days)
A minimum of 10 colonies were isolated and molecularly identified from the four
treatments at days 33 and 101 by cultivated methods The most influential bands of DGGE
to 60 of contribution to similarity (Figure 5 Table 4) according to the results of PRIMER
analysis were cloned and identified with the except of bands 2 4 27 and 36 that were not
cloned after several attempts likely due to DNA degradation The results of the identification
by cultivated and uncultivated methods (Table 3 Figure 5) show that different strains of
Acinetobacter (DUB-26RS uncultured Acinetobacter sp) and Microbacterium bands 24
(DUB-26RS uncultured Acinetobacter sp) and 22 (DUB-25RS Microbaterium sp)
respectively were always present in both consortia (Figure 5) both at high and low
temperatures However it should be also noted that Rhodococcus sp strains are unique to
C2PL05 consortium whereas Ralstonia sp and Bacillus sp were only found in BOS08
consortium being all of the above DIC strains (Table 3) In depth analysis of the community
of microorganisms through DGGE fingerprints and further identification of the bands allowed
to establish those bands responsible for the similarities between treatments (Table 4) and the
most influential factor MDS (Figure 6) shows that both time and temperature have and
important effects on C2PL05 microbial diversity whereas only time had effect on BOS08
consortium Both consortia tend to equal their microbial compositions as the exposed time
increase (Figure 6) The highest average of similarity (5327 ) was observed at day 101
being bands 36 4 (unidentified) and 24 (DUB-26RS Acinetobacter sp) responsible for that
similarity The lowest similarity (3543 ) was observed within the consortium C2PL05 (Table
4) being the high abundance of the band 20 (DUB-24RS Pseudomonas sp) and the lack of
the band 22 (DUB-25R Microbacterium sp) responsible of the dissimilarity Concluding it
can be observed that bands 20 (DUB-24RS Pseudomonas sp) 22 (DUB-25R
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
132
Microbacterium sp) 24 (DUB-26RS Acinetobacter sp) 36 and 4 (both unidentified) were
the most responsible for the similarity or dissimilarity between bacterial communities of
different treatments Another band showing lower contribution to these percentages but yet
cloned was band 12 from which two genotypes were identified (DUB-22RS and DUB-23RS)
as Pseudomonas sp Regarding to identification of DIC strains (Table 3) Rhodococcus sp
was exclusive of C2PL05 consortium and Ralstonia sp and Bacillus sp were only found in
BOS08 consortium
Table 4 Bands contribution to 60 similarity primer between treatments grouped by time type
of bacterial consortium and incubation temperature Average similarity of the groups determine
by SIMPER method
Time (day) Consortium Temperature
Band DUB 0 33 101 C2PL0 BOS0 High Low
22 DUB-25RS 2855 2789 2581 20 DUB-24RS 2993 2521 1797 2366
36 Unidentified 3546 1029 210
4 Unidentified 2855 1120 2362 1755 2315 175
27 Unidentified 139
2 Unidentified 1198
24 DUB-26RS 929
Cumulative similarity () 5710 5781 5595 6081 6134 5710 524Average similarity () 4433 4070 5327 3543 4660 4433 405
Unidentified bands from DGGE after several attempts to clone
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
133
Figure 5 Denaturant gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen
fragments from the consortium C2PL05 (line 1 to 5) and consortium BOS08 (line 6 to 10) Line 0
contains the molecular weight markers lines 1 and 6 correspond to initial time lines 2 and 7 to
high temperature range at day 33 lines 3 and 8 to high temperature range at day 101 lines 4
and 9 to low temperature range at day 33 and lines 5 and 10 to low temperature range at day
101
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
134
Figure 6 Multidimensional scaling (MDS) plot showing the similarity
between consortia BOS08 (BO) and C2PL05 (C2) incubated at low
(superscript L) and high (superscript H) temperature at day 0 33 and
101(subscripts 0 1 and 2 respectively)
Discussion
PAH degradation capability of bacterial consortia
Consortium BOS08 was isolated from a pristine soil since hydrocarbons and especially PAH
were not detected Opposite results were observed for samples where consortium C2PL05
was extracted with a large amount (64 wt) of petroleum compounds (ltC40) measured
However both consortia proved to be able to efficiently degrade HMW-PAH even at low
temperature range (5-15 ordmC) However both consortia have shown lower pyrene than
perylene depletion rates despite the former has lower molecular size and higher aqueous
solubility and bioavailability and lower hydrophobicity Previous work (Alves et al 2005)
have reported that UV and visible light can activate the chemical structure of some PAH
inducing changes in toxicity However whereas these authors classified phototoxicity of
pyrene and perylene as positive other phototoxic classifications (Mekenyan et al 1994)
consider pyrene as extremely toxic and perylene as moderately toxic So the high toxicity
level of pyrene due to phototoxic effect may explain the lower depletion rates of pyrene
opposite to that expected from their physicochemical properties above mentioned
Contrary to previous works (Spain amp ven Veld 1983 Jhonsen amp Karlson 2005) the
consortium BOS08 has not needed the pre-exposure to PAH to induce microbial adaptation
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
135
and consequently degradation of those pollutants In agreement with previous works
(Margesin amp Schinner 2001) our results have showed that the addition of PAH to the forest
consortium BOS08 was rapidly followed by an initial increase of PAH degrading bacteria
Considering the origin of consortium BOS08 extracted from a soil rich in organic matter and
decaying wood is possible that biodegradation process may be associated with wood
degrading bacteria and fungi However results confirmed that initial conditions when PAH
concentration was high fungi were not present Fungi appeared just at the end of the
biodegradation process (101 and 137 days) and only at high temperature when high PAH
concentration was already depleted and toxicity was low These results therefore confirm
that biodegradation process was mainly carried out by bacteria when PAH concentration and
toxicity were high
PAH degradation ability is a general characteristic present in some microbial
communities when community is exposed to PAH (Macleod amp Semple 2002 Jhonsen amp
Karlson 2005 Tian et al 2008) Microbial consortia were obtained from highly different
levels of contamination However although high differences were observed at the initial
microbial composition of both consortia they share some strains (Microbacterium sp and
Acinetobacter sp) The lower diversity found within the C2PL05 consortium (more details in
Molina et al 2009) obtained from a chronically and heavily polluted area with petroleum
hydrocarbons is typical of aged soils exposed to PAH These pollutants drive the selection of
specific bacteria that are able to degrade them (Vintildeas et al 2005)
Most of the identified species by DGGE (culture-independent rRNA approaches) in this
work were γ-proteobacteria (Pseudomonas and Acinetobacter) except DUB-26RS 98
similar to Microbacterium sp belonging to Actinobacteria phylum In agreement with previous
works (Harayama et al 2004) identification results retrieved by culture-dependent methods
showed some differences from those identified by the culture-independent rRNA
approaches DIC identified by culturable techniques belonged to a greater extend to
Proteobacteria phylum γ-Proteobacteria (Pseudomonas Pshycrobacter Acinetobacter) and
β-Proteobacteria (Ralstonia) Only two cultivable strains DIC-46RS and DIC-47RS identified
as Rhodococcus sp and Bacillus psychrodurans belonged to Actinobacteria and Firmicutes
phylum respectively Genera as Bacillus Pseudomonas and Ralstonia were identified within
the consortium BOS08 obtained from decaying wood in a pristine forest These genera are
typical from decomposing wood systems and have been previously mentioned as important
aerobic cellulose-degrading bacteria such as Bacillus sp (Lynd et al 2002) or degraders of
the highly oxidized oxalate (Pseudomonas sp Ralstonia sp) which is released by white-rot
fungi during degradation of lignocellulose (Dutton amp Evans 1996) Lignin is one of the most
slowly degraded components of dead plants and the major contributor to the formation of
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
136
humus as it decomposes The breakdown of lignin is mediated by extracellular enzymes
such as laccase lignin peroxidise and manganese peroxidase (Hatakka 1994 Hatakka
2001) The lack of specificity and the high oxidant activity of these enzymes make them able
to degrade different components as PAH (ie Pickard 1999) For this reason Bacillus
Pseudomonas and particularly Ralstonia identified within the consortium BOS08 and
typical from decomposing wood systems have been also previously identified as degrader of
aromatic compounds (Zhuang et al 2002 Chauhan et al 2008 Luo et al 2009) While
many eukaryotic laccases have been identified and studied laccase activity has been
reported in relatively few bacteria these include some strains identified in our decomposing
wood consortium BOS08 such as Ralstonia sp and Bacillus sp and others like Azospirillum
lipoferum Marinomonas mediterranea Amycolatopsis sp Streptomyces coelicolor
Arthrobacter cholorophenolicus and Rhodococcus opacus (McMahon et al 2007 Dawkar et
al 2009 Brown et al 2011)
HMW-PAH degradation at low temperatures
In the last 10 years research in regard to HMW-PAH biodegradation has been carried out
mainly through single bacterial strains or artificial microbial consortia and at optimal
temperatures (Kanaly amp Harayama 2000 Kanaly amp Harayama 2010) However there is a
lack of knowledge focused on HMW-PAH biodegradation at difficult conditions such as low
temperatures by full microbial consortia Temperature is a key factor in physicochemical
properties of PAH and in the control of PAH biodegradation metabolism in microorganisms
The diffusion rate of PAH into the aqueous phase increases with temperature and so PAH
bioavailability (Haritash amp Kaushik 2009) and PAH metabolism rate (Leahy amp Colwell 1990)
In agreement with previous results (Eriksson et al 2001) PAH biodegradation rates were
significantly higher at moderate temperatures (15-25 ordmC) because metabolic activity
diffusion and mass transfer was facilitated However there are also microorganisms with
capacity to efficiently degrade HMW-PAH even at lower temperatures (Margesin et al 2002)
as microorganisms present at both consortia (BOS08 and C2PL05)
Genera as Acinetobacter and Pseudomonas identified from both consortia growing at
low temperature have been previously reported as typical strains from cold and petroleum-
contaminated sites being capable to grow using solely hydrocarbons (MacCormack amp Fraile
1997 Eriksson et al 2003 Margesin et al 2003) According to previously works that
considered this genera as cold-tolerant (Margesin et al 2003 Ma et al 2006) our results
showed that they grow and efficiently degrade HMW-PAH at low temperature range (5-15 ordmC)
but with significantly lower rates than those at higher temperature In addition whereas time
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
137
was an influence factor in bacterial communities distribution temperature only affected to
C2PL05 consortium Possibly these results can be related with the environmental
temperature of the sites where consortia were extracted Whereas bacterial community of
BOS08 are adapted to temperatures below 20 ordmC all year C2PL05 consortium is adapted to
a range with maximum temperatures above 20 ordmC Hence although this consortium had cold-
tolerant species that degrade at low temperatures their probably less proportion than in the
BOS08 consortium resulted in differences between percentages of PAH depletion and
evolution of the bacterial community in function of temperature Therefore the cold-adapted
microorganisms are important for the in-situ biodegradation in cold environments
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (Projects 11-37320053-
B and 0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
138
References
amp Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int Biodet
Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bode A Gonzaacutelez N Lorenzo J Valencia J Varela MM amp Varela M 2006 Enhanced
bacterioplankton activity after the Prestige oil spill off Galicia NW Spain Aquatic
Microb Ecol 43 33-41
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0ndash5degC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Brown ME Walker MC Nakashige TG Iavarone AT amp Chang M 2011 Discovery and
characterization of heme enzymes from unsequenced bacteria Application to microbial
lignin degradation J Am Chem Soc 4518006-18009
Canet R Birnstingl JG Malcolm DG Lopez-Real JM amp Beck AJ 2001 Biodegradation
of polycyclic aromatic hydrocarbons (PAH) by native microflora and combinations of
white-rot fungi in a coal-tar contaminated soil Bioresource Technol 76113-117
Chauhan A Fazlurrahman Oakeshot JG amp Jain RK 2008 Bacterial metabolism of
polycyclic aromatic hydrocarbons strategies for bioremediation Indian J Microbiol 48
95-113
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158 3411-
3420
Dawkar VV Jadhav UU Telke AA amp Govindwar SP 2009 Peroxidase from Bacillus sp
VUS and its role in the decolorization of textile dyes Biotechnol Bioprocess Eng 14
361-368
Dutton MV amp Evans CS 1996 Oxalate production by fungi its role in pathogenicity and
ecology in the soil environment Can J Microbiol 42 881ndash895
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
139
Eriksson M Jong-Ok Ka amp Mohn WW 2001 Effects of low temperature and freeze-thaw
cycles on hydrocarbon biodegradation in Arctic Tundra soil Appl Environ Microbiol
675107-5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Harayama S Kasai Y amp Hara A 2004 Microbial communities in oil-contaminated seawater
Curr Opin Biotechnol 15 205-214
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycoilyclic aromatic
hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microb Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M Steinbuchel A(eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Johonsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-
does it depend on PAH exposure Microb Ecol 50 488ndash495
Joslashrgensen KS Jaumlrvinen O Sainio P Salminen J amp Suortti AM 2005 Quantification of
soil contamination In Margesin R Schinner F (eds) Manual of soil analysis
monitoring and assessing soil bioremediation Springer Berlin pp 97-119
Kanaly RA amp Harayama S 2000 Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059ndash2067
Kanaly RA amp Harayama S 2010 Advances in the field of high-molecular-weight polycyclic
aromatic hydrocarbon biodegradation by bacteria Microb Biotechnol 3 136ndash164
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Lafortune I Juteau P Deacuteziel E Leacutepine F Beaudet R amp Villemur R 2009 Bacterial
diversity of a consortium degrading high-molecular-weight polycyclic aromatic
hydrocarbons in a two-liquid phase biosystem Microb Ecol 57 455-468
Lane DJ 1991 16S23S sequencing In E Stackebrandt and M Goodfellow (ed) Nucleic
acid techniques in bacterial systematic John Wiley amp Sons Chischester UK
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environments
Microbiol Rev 54 305-315
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
140
Luo YR Tian Y Huang X Yan CL Hong HS Lin GH amp Zheng TL 2009 Analysis of
community structure of a microbial consortium capable of degrading benzo(a)pyrene
by DGGE Marine Poll Bull 58 1159-1163
Lynd LR Weimer PJ van Zyl WH amp Pretorius IS 2002 Microbial cellulose utilization
fundamentals and biotechnology Microbiol Mol Biol Rev 66 506ndash577
MacCormack WP amp Fraile ER 1997 Characterization of a hydrocarbon degrading
psychrotrophic Antarctic bacterium Antarct Sci 9 150-155
Macleod CJA amp Semple KT 2002 The adaptation of two similar soils to pyrene catabolism
Environ Pollut 119357-364
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Madden TL Tatusov RL Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts Extremophiles
7451ndash458
McMahon AM Doyle EM Brooksm S amp OacuteConnor KE 2007 Biochemical
charcaterization of the coexisting tyrosinase and laccase in the soil bacterium
Pseudomonas putida F6 Enzyme Microb Tech 401435-1441
Mekenyan OG Ankly GT Veith GD amp Call DJ 1994 QSAR for photoinduced toxicity I
Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere
28 567
Microbics Corporation 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mohn WW amp Stewart GR 2000 Limiting factors for hydrocarbon biodegradation at low
temperature in Artic soils Soil Biol Biochem 321161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Pickard MA Roman R Tinoco R Vazquez-Duhalt R 1999 Polycyclic aromatic
hydrocarbon metabolism by white rot fungi and oxidation by Coriolopsis gallica UAMH
8260 laccase Appl Environ Microbiol 65 3805-3809
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
141
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Soriano JA Vintildeas L Franco MA Gonzaacutelez JJ Ortiz L Bayona JM amp Albaigeacutes J 2006
Spatial and temporal trends of petroleum hydrocarbons in wild mussels from the
Galician coast (NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-
90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil In Singh
A Kuhad RC Ward OP (eds) Adv Appl Biorem 103-121 Springer Berliacuten
Sutherland JB Rafii F Khan AA amp Cerniglia CE 1995 Mechanisms of polycyclic
aromatic hydrocarbon degradation p 269ndash306 In L Y Young and C E Cerniglia
(ed) Microbial transformation and degradation of toxic organic chemicals Wiley-Liss
New York NY
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of Xiamen
China Marine Pollut Bull 56 1184-1191
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-95
Wong WSD 2009 Structure and action of ligninolytic enzymes Appl Biochem Biotechnol
157 174-209
Wrenn BA amp Venosa AD 1996 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
142
Yakimov MM Giuliano L Gentile G Crisafi E Chernikova TN Abraham W-R Luumlnsdorf
H Timmis KN amp Golyshin PN 2003 Oleispira antarctica gen nov sp nov a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water Int J
System Evol Microbiol 53779-785
Zhuang W-Q Tay J-H Maszenan AM amp Tay STL 2002 Bacillus naphthovorans spnov
from oil contaminated tropical marine sediments and its role in naphthalene
biodegradation ApplMicrobiol Biotechnol 58547-553
Zimmermann W 1990 Degradation of lignin by bacteria J Biotechnol 13119-130
Proteobacteria
Capiacutetulo
Manuscrito ineacutedito
Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez M amp Peacuterez L
Assessment the efficient of bioremediation techniques (biostimulation bioaugmentation
and natural attenuation) in a creosote polluted soil change in bacterial community
Evaluacioacuten de la eficacia de teacutecnicas de biorremediacioacuten (bioestimulacioacuten bioaumento y
atenuacioacuten natural) en un suelo contaminado con creosota cambios en la comunidad bacteriana
4
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
145
Abstract
The aim of the present work was to assess different bioremediation treatments
(bioaugmentation bioestimulation combination of both and natural attenuation) applied to a
creosote polluted soil with a purpose of determine the most effective technique in removal of
pollutant Toxicity microbial respiration degradation of creosote and PAH (antharcene
phenathrene and pyrene) as well as evolution of bacterial communities by non culture-
dependent molecular technique DGGE were analyzed Results showed that creosote was
degraded through time without significant differences between treatments but PAH were
better degraded by treatment with biostimulation Low temperatures at which the process
was developed negatively conditioned the degradation rates and microbial metabolism as
show our results DGGE results revealed that biostimulated treatment displayed the highest
microbial biodiversity However at the end of the bioremediation process no treatment
showed a similar community to autochthonous consortium The degrader uncultured bacteria
identified belonged to Pseudomonas Sphingomonas Flexibacter all of them involved in
degradation process Particularly interesting was the identification of two uncultured bacteria
belonged to genera Pantoea and Balneimonas did not previously describe as such
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
147
Introduction
Creosote is a persistent chemical compound derived from burning carbons as coal between
900-1200 ordmC and has been used as a wood preservative It is composed of approximately
85 polycyclic aromatic hydrocarbons (PAH) 10 phenolic compounds and 5 nitrogen
and sulfur PAH are a class of fused-aromatic compounds toxic mutagenic bioaccumulative
and persistent in the environment and so the United State Environmental Protection Agency
(US EPA) considered that the removal of these compounds is important and priority Against
physical and chemical methods bioremediation is the most effective versatile and
economical technique to eliminate PAH Microbial degradation is the main process in natural
decontamination and in the biological removal of pollutants in soils chronically contaminated
(MacNaughton et al 1999) in which degrading-bacteria are abundant (Taketani et al
2010) However recently works have reported (Tian et al 2008 Couling et al 2010) the
potential ability to degrade PAH of microorganisms from soils apparently not exposed
previously to those toxic compounds The technique based on this degradation capacity of
indigenous bacteria is the natural attenuation This technique avoid damage in the habitat
(Dowty et al 2001) allowing to retrieve the original conditions of the ecosystem converting
the toxic compounds into harmless (Kaplan amp Kitts 2004 Haritash amp Kaushik 2009)
However this method require a long period or time to remove the toxic components because
the number of degrading microorganisms in soils only represents about 10 of the total
population (Yu et al 2005a) Many of the bioremediation studies are focused on the
bioaugmentation which consist in the inoculation of allochthonous degrading
microorganisms (ie Atagana 2006) However bioaugmentation is a complicate technique
to study because a negative or positive effect depends on the interaction between the
inocula and the indigenous population due to the competition for resources mainly nutrients
(Yu et al 2005b) Other bioremediation techniques as biostimulation consist in to empower
the degrading capacity of the indigenous community by the addition of nutrients to avoid
metabolic limitations (ie Vintildeas et al 2005)
However inconsistent results have been reported with all these previuos treatments
Previous studies have shown that biodegradation rates can be increased (Mills et al 2004)
and have no effect influenced negatively with biostimulation (Yu et al 2005a Chen et al
2008) Similar enhance of biodegradation rates (Atagana et al 2006) and not significant
differences (Vintildeas et al 2005 Yu et al 2005b) have been described with bioaugmentation
It is necessary taking in to account that each contaminated site can respond in a different
way (Vintildeas et al 2005) therefore to carry out an in situ bioremediation process it will be
necessary to design a laboratory-scale assays to determine what technique is more efficient
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
148
on the biodegradation process and the effect on the microbial diversity In addition
previously works (Gonzalez et al 2011) showed that although PAH were completely
consumed by microorganisms toxicity values remained above the threshold of the non-
toxicity Although most of the work not perform toxicity assays these are necessary to
determine effectiveness of a biodegradation The main goal of the present study is to
determine through a laboratory-scale assays the most effective bioremediation technique in
decontamination of creosote contaminated soil evaluating changes in bacterial community
and the toxicity values
Materials and methods
Chemical media and inoculated consortium
The fraction of creosote used in this study was composed of 26 of PAH (naphthalene
05 phenanthrene 51 anthracene 122 pyrene 31 dibenzofurane 13 and
acenaphthene47) Creosote was diluted in acetonitrile (purchased form Sigma Aldrich
Steinheim Germany) in a stock solution of a final concentration of 0439 gmiddotml-1 containing
0117 g PAHmiddotml-1 The culture mediums LuriandashBertani (LB) and Bushnell-Haas Broth (BHB)
were purchased from Panreac (Barcelona Spain) Biostimulated treatments were amended
with BHB as inorganic nutrients source which composition was optimized for PAH-degrading
consortium (C2PL05 consortium) in a previously work (Simarro et al 2010) with the optimum
composition 02 gmiddotlminus1 MgSO4 7H2O 002 gmiddotlminus1 CaCl2 2H2O 0281 gmiddotlminus1 KHPO4 0281 gmiddotlminus1
K2HPO4 002 gmiddotlminus1 NH4NO3 0195 gmiddotlminus1 Fe2(SO4)3 According to Bautista et al(2009) Tween-
80 was the optimal surfactant for PAH biodegradation by bacteria and was added in a critical
micellar concentration (CMC) of 300 μlmiddotml-1 (0012 mM) Bioaugmented treatments were
inoculated with the PAH-degrading consortium C2PL05 extracted from a permanently PAH
contaminated soil from a refinery in Ciudad Real (Spain) and previously identified and
described in Molina et al(2009)
Experimental design
Five different treatments in microcosms designated as T1 to T5 (see Table 1) were carried
out each in duplicate for five sampling times zero 6 40 145 and 176 days from December
2009 to May 2010 In total 40 microcosms containing 550g of natural soil samples collected
from an uncontaminated area of Rey Juan Carlos University in Madrid (Spain) were carried
out The soil obtained from the first top 20 cm and sieved by 2 mm was located in plastic
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
149
trays and randomly arranged outdoor in terrace and protected with a plastic to avoid the rain
and snow on them Each tray except the treatment T1 contained 56 ml of a creosote
solution in n-hexano (0439 g ml-1) with final amount of creosote per tray of 25 g
Microcosms were maintained at 40 of water holding capacity (WHC) considered as
optimum during bioremediation process (Vintildeas et al 2005) For biostimulation microcosms
samples were hydrated with the required amount of the optimum BHB while in treatment no
biostimulated samples were hydrated with only mili-Q water Bioaugmented treatments were
inoculated with 5ml of the consortium C2PL05 (2015x107 plusmn 427x106 cellsmiddotg soil-1 of
heterotrophic microorganisms and 177x105 plusmn 101x105 cellsmiddotg soil-1 of creosote-degrading
microorganisms)
Table 1 Summary of the treatment conditions
Code Treatments Conditions
T1 Untreated soil (control) Uncontaminated soil
T2 Natural attenuation Contaminated soil with 56 ml creosote moistened 40WHC
with 1054 ml mili-Q water
T3 Biostimulation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1104 ml BHB
T4 Bioaugmentation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml mili-Q water 5 ml consortium
C2PL05
T5 Biostimulation
+ Bioaugmentation
Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml BHB inoculated with 5 ml
Characterization of soil and environmental conditions
The water holding capacity (WHC) was measured following the method described by Wilke
(2005) and the water content was calculated through the difference between the wet and dry
weigh after drying at 60ordmC during 1 hour pH was measured using a GLP 21 micro pHmeter
(Crison Barceona Spain) resuspending 1 g of the soil in mili-Q water (110) and incubating it
in an orbital shaker at 150 rpm at 25 ordmC during 1 h Temperature which the experiments were
developed was recorded on a temperature loggers (Tidbit Loggers Onset Computer
Pocasset Mass) located in the site
Total heterotrophic microorganisms (HM) and creosote-degrading microorganisms
(C-DM) of the microbial population of the natural soil was counted using a miniaturized most
probable number technique (MPN) in 96-well microtiter plates with eight replicates per
dilution (Wrenn amp Venosa 1996) The number of cells was calculated with Most Probable
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
150
Number Calculator software Version 404 (Klee 1993)To extract the microorganisms from
the soil 1 g of soil was resuspended in 10 ml of phosphate buffer saline (PBS) and was
shaker at 150 rpm at 25 ordmC during 24 h The HM were determined in 180 μl of LB medium
with glucose (15 gl-1) and C-DM were counted in 180 μl of BHB medium with 10 μl of
creosote stock solution as carbon source
Respiration and toxicity assays
To measure the respiration during the experiments 10 g of soil moistened with 232 ml of
mili-Q water (to maintain a water capacity of 40 WHC) was incubated in duplicate in a
desiccator during 14 days at 25ordmC Replicates contained 14 ml of NaOH 02 M to absorb the
CO2 produced by microorganisms The vials were periodically replaced and checked
calorimetrically with HCl (01M) and phenolphthalein as indicator The test was doing with
BaCl2 (01 M) in excess to ensure the precipitation of carbonates The numbers of moles of
CO2 produced were calculated as a difference between initial moles of NaOH in the
replicates and moles of NaOH checked with HCl (moles of NaOH free)
The toxicity evolution during the PAH degradation was also monitored through a short
screening of the samples with the Microtox TM method with the luminescent bacterium Vibrio
fischeri following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15ordmC
Monitoring the removal of creosote and polycyclic aromatic hydrocarbons
Organic compounds were extracted and analyzed from the microcosms samples at 0 6 40
145 and 176 days by gas chromatography-mass spectrometry (GC-MS) to estimate the
creosote and percentage of PAH depletion A gas cromatograph (model CP3800 Varian
Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary column (15 m
length 025 mm ID 025 μm film thickness) was coupled to a quadruple mass-spectrometer
detector (Model 1200L Varian) The stationary phase was composed by phenyl (5) and
dimethylpolysiloxane (95) as carried gas ice in the mobile phase Temperature gradient
program used was initial temperature of 80 ordmC for 2 min temperature increase to 300 ordmC at
the rate of 1ordmC min-1 final temperature of 300 ordmC for 15 min with a final duration of the
method of 39 min Organic compounds were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inject 05 μl in
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
151
the FDI chromatograph The concentration of each PAH and creosote was calculated from
the chromatograph of the standard curves
DNA extraction molecular and phylogenetic analysis for characterization of the total
microbial population in the microcosms
Non culture-dependent molecular techniques as denaturing gradient gel electrophoresis
(DGGE) was performed to identify non-culture microorganisms and to compared the
biodiversity between treatments and its evolution at 145 and 176 days of the process Total
community DNA was extracted from 25 g of the soil samples using Microbial Power Soil
DNA isolation kit (MoBio Laboratories Solano Beach CA USA) In total suitable yields of
high molecular-weight DNA (5-20 μgg of soil-1) were obtained The V3 to V5 variable regions
of the 16S rRNA gene were amplified using the primers set 16S 518R and 16S 338F-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primer 338F-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded on to a 10
(wtvol) polyacrylamide gels that was 075mm tick and the denaturing gradients used ranged
from 35 to 65 denaturant (more details in Gonzalez et al 2011) Gel were stained with
Syber-Gold and viewed under UV light and predominant bands were excised and diluted in
50μl of mili-Q water Due to impossibility of reamplified bands DNA of the bands was cloned
in the pGEM-T Easy Vector (Promega Madison WI) Plasmids were purified using the High
Pure plasmid Isolation Kit (Roche) and sequenced using the internal primers 338F and 518R
Creosote-degrader uncultured bacterium (DUB) were edited and assembled using version
487 of the BioEdit program (Hall 1999) BLAST search (Madden et al 1996) was used to
find nearly identical sequences for the 16S rRNA sequences determined All DUB identified
sequence and 25 similar sequences downloaded from GenBank were used to perform the
phylogenetic tree Sequences were aligned using the Q-INS-i algorithm (Katoh amp Toh 2008a)
of the multiple sequence alignment software MAFFT version 6611 (Katoh amp Toh 2008b)
aligning sequences in a single step Sequence divergence was computed in terms of the
number of nucleotide differences per site between of sequences according to the Jukes and
Cantor algorithm (1969) The distance matrix for all pair wise sequence combinations was
analyzed with the neighbour-joining method (NJ) of phylogenetic tree construction with 1000
bootstrap replicates by using version PAUP 40B10 (Swofford 2003) In addition maximum
parsimony (MP) was also analyzed (Molina et al 2009) Sequences of Sphirochatea
americans belonged to Sphirochaetes phylum were used as out-group (Gupta amp Griffiths
2002) Images of DGGE were digitalized and DGGE bands were processed using the UN-
Scan-It gel analysis software version 60 (Silk Scientific US)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
152
Statistical analysis
In order to evaluate the effects of treatments on intrinsic growth rate (μ) toxicity degradation
of organic compounds and respiration analysis of variance (ANOVA) were used The
variances were checked for homogeneity by the Cochranacutes test Student-Newman-Keuls
(SNK) test was used to discriminate among different treatments after significant F-test
representing these differences by letters in the graphs Data were considered significant
when p-value was lt 005 All tests were done with the software Statistica 60 for Windows
Differences in microbial assemblages by biostimulation by bioaugmentation and by time
(145 and 176 days) were graphically evaluated with a non-metric multidimensional scaling
(MDS) using PRIMER software (Clarke 1993) The previous period to 145 days was
considered a period of cold conditions and the time from 145 to 176 days a period of higher
temperatures SIMPER method was used to identify the percent contribution of each band to
the similarity in microbial assemblages between factors Bands were considered ldquohighly
influentialrdquo if they contributed to the first 60 of cumulative percentage of average similarity
betweenwithin combination of factors In addition Shannon index (Hacute) was calculated from
DGGE bands applying equation 2 to estimate the ecological diversity of each treatment at
136 and 145 days
Equation 2
where pi is the proportion in the gel of the band i with respect to the total of all bands
detected calculated as coefficient between band intensity and total intensity of all
bands (Baek et al 2007)
Results
Physical chemical and biological characteristics of the natural soil used for the treatments
pH of the soil was slightly basic 84 and the water content of the soil was 10 although the
soil had a high WHC (521) possibly due to their sandy character Initial proportion of C-DM
from natural soil represented only 088 of the total heterotrophic population with a number
of microorganisms two order of magnitude higher (201 x 107 plusmn 427 x 106 cells g soil-1)
Figure 1 shows that the evolution of the monthly average temperature observed during the
experiment and the last 30 years Average temperature decreased progressively from
October to January from 16 ordmC to a minimum average of 6 ordmC starting to increase
progressively to reach a mean value of 21 ordmC in June
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
153
October
November
DecemberJanuary
FebruaryMarch
April MayJune
468
10121416182022
0 day
40 day
145 day
176 day
6 dayT
empe
ratu
re (
ordmC)
Month
Figure 1 evolution of the normal values of temperature (square) and evolution of
the monthly average temperature observed (circle) during the experiment
Respiration of the microbial population
Table 2A shows the ANOVA results concerning to the accumulated values of CO2 produced
for each treatment in each time period (from 0- to 6 days from 40 to 145 days and from 145
to 176 days) Due to interval time was the only significant factor (Table 2A) differences in
percentage of accumulative CO2 by sampling times (6 40 145 and 176 days) were analyzed
and showed in Figure 2 Differences between sampling times showed that the accumulated
percentage of CO2 was significantly higher at 176 days than at other time
6 40 145 17600
10x10-4
20x10-4
30x10-4
40x10-4
50x10-4
a a
b
aCO
2 mol
esg
of
soil
Time (days)
Figure 2 accumulated CO2 issue at 6 40 145 and 176 days Error bars show the
standard deviation and the letters show significant differences between groups
(plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
154
Toxicity assays
Changes on the toxicity during the creosote degradation process (Figure 3A) showed that all
treatments had a similar evolution T1 (uncontaminated) was not toxic (lt20 ) but toxicity of
treatments with creosote increased constantly from initial value of 26 to a values higher
than 50 Only during last period of time (145 to 176 days) toxicity started to decrease
slightly Despite similar toxicity values reached with the treatments interaction between time
periods (0 to 6 days 40 to 145 days and 145 to 176 days) and treatments showed significant
differences (Table 2B) Differences between groups by both significant factors (Figure 3B)
showed that toxicity of all treatments in first time period was significantly lower than in the
other periods Differences in toxicity between the two last periods were only significant for
treatment T4 in which toxicity increase progressively from the beginning
0 6 20 40 56 77 84 91 98 1051121251321411760
10
20
30
40
50
60
70
80
90
100 BA
Tox
icity
(
)
Time (days)T2 T3 T4 T5
c
c
c
b
c
bc
bcbc
aa
aa
Treatment
Figure 3 (A) evolution of the toxicity () of the treatment T1 (square) T2 (circle) T3 (triangle) T4
(inverted triangle) and T5 (rhombus) during the experiment (B) percentage of toxicity of the treatment
in the interval times 1 (black bars) from 0- to 6 days interval 2 (with bars) from 6 to 40 days and
interval 3 (gray bars) from 40 to 176 days Error bars show the standard deviation and letters
differences between groups
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
155
Biodegradation of creosote and polycyclic aromatic hydrocarbons
The results concerning the chromatography performed on the microcosms at 0 40 145 and
176 days are shown in Figure 4 Creosote depletion during first 40 days was very low
compared with the intensive degradation occurred from 40 to 145 days in which the greatest
amount of creosote was eliminated (asymp 60-80) In addition difference between residual
concentration of PAH at final time by type of PAH (phenanthrene anthracene and pyrene)
and treatment were analyzed (Table 2C) Both factor were significantly influential although
was not the interaction between them Differences by PAH (Figure 4B) showed that
anthracene degradation was significantly higher than other PAH and differences by
treatments (Figure 4C) showed that difference were only significant between treatment T3
and T2 lower in the treatment T3
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
156
T1 T2 T3 T4 T50000
0005
0010
0015
0020
0025
0030
0035
0040
g cr
eoso
te
g so
il
Phenanthrene Anthracene Pyrene0
102030405060708090
100
C
aab
abb
a
bb
B
A
Ave
rage
res
idua
l con
cenr
atio
n of
PA
H (
)
T2 T3 T4 T50
102030405060708090
100
Tot
al r
esid
ual c
once
ntra
tion
of
PA
H (
)
Figure 4 (A) creosote depletion during the experiment at sampling times 6 days (black
bars) 40 days (with bars) 145 days (grey bars) and 176 days ( ) (B) average residual
concentration at 176 days of the identified PAH (phenanthrene anthracene and pyrene)
and (B) average residual concentration of the identified PAH as a function of applied
treatment (C) Error bars show the standard error and the letters show significant
differences between groups (plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
157
Table 2 Analysis of variance (ANOVA) of the effects on the μ of the
heteroptrophic population (A) μ of the creosote degrading microorganisms (B)
accumulated value of CO2 (C) toxicity (D) and residual concentration of PAH (E) SS is
the sum of squares and df the degree of freedoms
Factor df SS F P
C) Accumulated value of CO2 (n=40) Time interval 3 65-5 3112
Treatment 4 60-6 202 ns
Interval x Treatment 12 11-5 134 ns
Error 20 14-5
D)Toxicity (n=24) Time interval 2 907133 11075
Treatment 3 12090 098 ns
Interval x Treatment 6 122138 497
Error 12 49143
E) Residual concentration of the PAH (n=24) Treatment 3 95148 548
PAH 2 168113 1452
Treatment x PAH 6 17847 051 ns
Error 12 69486
p-value lt 005
p-value lt 001
p-value lt 0001
Diversity and evolution of the uncultivated bacteria and dynamics during the PAH
degradation
The effects of different treatments on the structure and dynamics of the bacterial community
at 145 days and 176 days were analyzed by DGGE (Figure 5) At 145 days 8 bands (3 4 10
810 16 17 26 and 27 see Figure 5) were cloned and 6 different genotypes (DUB 12-RS to
DUB-17RS) were identified whereas at 176 days 5 bands (4 112 113 22 and 26 see
Figure 5) and 6 different genotypes (DUB-12RS DUB-13RS DUB-18RS DUB-19RS DUB-
20RS and DUB-21RS) were identified Most influential bands considered as 60 of
contribution to similarity according to the results of PRIMER analysis is showed at the Table
3 Similarities between treatments at 145 and 176 days were compared and analyzed as a
function of the addition of nutrients (biostimulated vs no biostimulated treatments) and the
addition of degrading consortium C2PL05 (bioaugmentated vs no bioaugmentated
treatments) The addition of nutrients was the factor that best explained differences between
treatments and so results in Table 3 are as a function of the addition of nutrients At 145
days no-biostimulated treatments T1 T2 and T4 were only similar in 402 whereas
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
158
biostimulated treatments (T3 and T5) were 6567 (Table 3) The patter were slightly
opposite at 176 days where no-biostimulated treatments were more similar (7026 ) than
biostimulated treatments (average similarity 4384 ) In addition at 145 days (Figure 6A)
natural attenuation (T2) was the only similar treatment to microbial community from the
uncontaminated treatment (T1) However at 176 days (Figure 6B) bacterial communities
from all treatments were highly different to the treatment T1 and there was no defined group
In addition PRIMER analysis allowed us to estimate the Shannon diversity index (Hacute) for
each treatments at 145 and 176 days indicating that the bacterial diversity increased for the
treatments T1 (3328) T3 (4154) and T5 (3739) remarkably higher in the treatment T4
Table 3 Bands contribution to 60 similarity primer between treatments grouped by
treatments biostimulated and no biostimulated at 145 days and 176 days Average
similarity of the groups determined by SIMPER method
145 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
3 DUB-12RS
DUB-17RS 2875
16 DUB-17RS 1826
17 DUB-12RS
DUB-16RS 1414
18 Unidentified 3363
19 Unidentified 3363
Cumulative similarity () 6725 6115 Average similarity () 402 6567
176 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
11 Unidentified 2116 13 Unidentified 2078 1794
23 Unidentified 2225 2294
26 DUB-13RS 1296
Cumulative similarity () 6418 5383 Average similarity () 7026 4384
bands from DGGE unidentified after several attempts to clone
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
159
Figure 5 Denaturing gradient gel electrophoresis (DGGE) at 145 days (A) and 176 days (B) of PCR-
amplified 16S rDNA gen fragments from the consortium C2PL05 (lane B) control experiment (lane C)
treatment with natural attenuation T1 (lane T1)biostimulated treatment T2 (lane T2) bioaugmentated
treatment T3 (lane T3) bioaugmentated treatment T4 (lane T4) and biostimulated and
bioaugmentated treatment t5 (lane T5) Lane A is the molecular weigh marker Numbers are the
bands cloning
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
160
Figure 6 proximity analysis (MDS) based on the Bray-Curtis dissimilarity
matrix of each treatment from the bands obtained in DGGE at 145 days (A)
and 176 days (B)
Phylogenetic analyses
Phylogenetic relationships of the degrading uncultured bacteria are shown in Figure 7 The
aligned matrix contained 1373 unambiguous nucleotide position characters with 496
parsimony-informative Parsimony analysis of the data matrix yielded 87 parsimonious trees
with CI = 0671 RI = 0767 and a length of 1452 Figure 6 also shows the topology of the
maximum parsimony (MP) tree with the bootstrap values of the maximum parsimony and
neighbour joining analyses Inconsistencies were not found between parsimony and
neighbour joining (NJ) topology
Phylogenetic tree was composed by bacteria belonged to Proteobacteria (α- and γ-
Proteobacteria) and Bacteroidetes phylum From DUB-12RS to DUB-17RS were located in
the Pseudomonadaceae clade in which it can be observed five clearly species groups DUB-
13RS and DUB-15RS identified as Pseudomonas trivialensis (HM134251) and P poae
(HM640290) respectively were in an undifferentiated group supported by P trivialensis and
P poae type-strains DUB-14RS similar to P viridiflava (HM190224) formed a group
supported by P viridiflavaT (HM190229) DUB-12RS 98 similar to P fluorescens (GQ
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
161
496662) was grouped with P fluorescensT (D84013) DUB-16RS was identified as
uncultured Pseudomonas sp (HQ677222) and classified in an indefinite group Finally the
last group of the Pseudomonadaceae clade was formed by DUB17-RS 98 similar to P
parafulva (HQ406758) and grouped with P parafulvaT (D84015) DUB-21RS was nested in
the Enterobacteriaceae clade due to it was identified with 99 of similarity as Pantoea
Brenneri (HM163514) This clade is supported by types-strains of other species of Pantoea
as Pantoea agglomeransT (FJ613819) and other enteric bacteria as Enterobacter cloacaeT
(AJ251469) DUB nested in Enterobacteriaceae and Pseudomonadaceae clade were γ-
Proteobacteria In α-Proteobacteria class are included Rhizobiales and
Sphingomonadaceae clades In the first clade formed by uncultured Balneimonas and
Rihzobiales bacterium supported by Balneimonas floculansT was nested DUB-19-RS 99
similar to an uncultured Balneimonas strain (HM799006) In Sphingomonadaceae clade was
nested DUB-20RS identified as uncultured Sphingomonadales bacterium DUB-18RS was
similar in 99 to Uncultured Flexibacteriaceae bacterium and was nested in Cytophagaceae
clade belonging to Bacteroidetes phylum
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
162
Figure 7 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrading uncultured bacteria (DUB) obtained from DGGE of the treatments 145 and 176 days of the
process Boostrap values of neighbourjoining and parsimony higher than 50 are showed on the
branch of the tree (NJMP) No incongruence between parsimony and neighbour joining topology were
detected Pseudomonas genus has been designated as P Pantoea genus as Pa Balneimonas as B
and Bacteriovorax as Ba Hidrogenymonas as H Flexibacerium as F T= type strain
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
163
Discussion
The estimated time of experimentation (176 days) was considered adequate to the complete
bioremediation of the soil according to previous studies developed at low temperatures (15
ordmC ndash 5 ordmC) in which toxicity was reduced below 20 in 101 days and PAH were removed in
137 days above 60 (Simarro et al under review) However our results confirm that
toxicity evaluation of the samples is necessary to know the real status of the polluted soil
because despite creosote was degraded almost entirely (Figure 4A) at the end of the
experiment toxicity remained constant and high during the process (Figure 3A) Possibly the
low temperatures under which was developed the most of the experiment slowed the
biodegradation rates of creosote and its immediate products which may be the cause of
such toxicity In addtion the most removal of creosote (Figure 4A) and higher respiration
rates (Figure 2) occurred from 40 days when temperature began to increase Hence our
results according to other authors (Margesin et al 2002) show that biodegradation at low
temperatures is possible although with low biodegradation rates due to slowdown on the
diffusion rate PAH bioavailability and metabolisms rates (Haritash amp Kaushik 2009 Leahy amp
Colwell 1990)
As in a previously work (Margesin amp Schinner 2001) no significant differences were
observed between treatments in degradation of creosote The final percentage of creosote
depletion above 60 in all treatments including natural attenuation confirm that indigenous
community of the soil degrade creosote efficiently Concurring with these results high
number of creosote-degradaing microorganisms were enumerated in the natural soil at the
time in which the disturbance occurred There is much controversy over whether
preexposure to a pollutant is required for degradation (Johnsen amp Karlson 2005) or if it is a
characteristic intrinsically present in some species of the microbial community that is
expressed when community is exposed to a pollutant (Tian et al 2008 Spain amp van Veld
1983) According to Tian et al 2008) and similarly as in previuosly work in which a wood
degrading consotium from a free polluted soil degraded PAH efficiently bacterial consortium
from natural soil never preexposed to creosota was able to efficiently degrade the
contaminant
Traditionally is widely tested (Yachi amp Loreau 1999) and accepted that higher
diversity leads to greater protection against disturbances (Vilaacute 1998) because the
functionality is higher Bacterial diversity of the biostimulated treatments (T3 and T5) notably
increased during the biodegradation process and showed (T3) a significantly enhance of the
PAH depletion Hence the higher biodiversity of the biostimulated treatment could contribute
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
164
to the increased of PAH degradation Overall the soil microbial community was significantly
altered in the soil with the addition of creosote is evidenced by the reduction of the size or
diversity of the various population of the treatments precisely in treatments no biostimulated
Long-term exposure (175 days) of the soil community to a constant stress such as creosote
contamination could permanently change the community structure as it observed in DGGEN
AND mds Bioaugmentation (T4 and T5) not resulted in a significant increase of the reduction
of creosote or PAH possibly due to the high adaptability of the indigenous consortium to
degrade PAH The relationship between inoculated and autochthonous consortium largely
condition the results of bioaugmentation Some authors (ie Herwijnen et al2005 Andrenoi
amp Gianfreda 2007) purpose that this technique only has positive effects when indigenous
consortium is no capable to degrade The indigenous microbial community demonstrated
capacity to degrade creosote explains the ineffectiveness of bioaugmentation A study of the
bacterial communities during a bioremediation process is important because such as
demonstrate our results bioremediation techniques cause changes in microbial communities
Most of the DUB identified have been previously related with biodegradation process
of PAH creosote andor diesel 60 of the DUB identified (DUB-12RS to DUB17RS)
belonged to Pseudomonas genus widely studied in bioremediation (ie Ma et al 2006
Molina et al 2009) Our results showed that it was the unique representative group at 145
days and the most representative at 176 days of the biodegradation process However in
this work it has been identified some species of Pseudomonas grouped in P trivialis P poae
and P Viridiflava clades (DUB-13RS DUB-15RS and DUB-14RS respectively) less
commonly described in biodegradation process (ie Bogan et al 2003) α-Proteobacteria
class was composed by DUB-19RS (Uncultured balneimonas) and DUB-20RS (Uncultured
Sphingomonadales bacterium) DUB-18RS belonged to phylum Bacteroidetes previously
identified in degradation of high-molecular-mass organic matter in marine ecosystems in
petroleum degradation process at low temperatures and in PAH degradation during
bioremediation of creoste-contaminated soils (Cotrell amp Kiechman 2000a Brakstad et al
2006 Vintildeas et al 2005) Something important to emphasize is the identification of the
Pantoea brenneri (DUB-21RS Enterobacteriaceae clade) and an uncultured Balneimonas
bacteria (DUB-19RS Metylbacteriaceae Rhizobiales clade) as creosote degrader because
have not been previously described as such However very few reports have indicated the
ability to degrade PAH of some genera of the enteric bacteria group as Enterobacter (Molina
et al 2009) Klebsiella (Grant et al 1967) or Escherichia (Diaz et al 2001)
In conclusion temperature is a very influential factor in ex situ biodegradation process
that control biodegradation rates toxicity reduction availability of contaminant and bacterial
metabolisms and so is an important factor to take into account during bioremediation
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
165
process Biostimulation was the technique which more efficiently removed PAH compared
with natural attenuation In this work bioaugmentation not resulted in an increment of the
creosote depletion probably due to the ability of the indigenous consortium to degrade
Bioremediation techniques produce change in the bacterial communities which is important
to study to evaluate damage in the habitat and restore capability of the ecosystem
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
166
References
Andreoni V amp Gianfreda L 2007 Bioremediation and monitoring of aromatic-polluted
habitats Appl Microbiol Biotechnol 76 287-308
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Baek SH Kim KH Yin CR Jeon CO Im WT Kim KK amp Lee ST 2003 Isolation and
characterization of bacteria capable of degrading phenol and reducing nitrate under
low-oxygen conditions Curr Microbiol 47462-466
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Behrendt U Ulrich A amp Schumann P 2003 Fluorescent pseudomonas associated with the
phyllosphere of grasses Pseudomonas trivialis sp nov Pseudomonas poae sp nov
and Pseudomonas congelans sp nov Int J Syst Evol Microbiol 53 1461ndash1469
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0-5 ordmC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Bodour AA Wang JM Brusseau ML amp Maier RM 2003 Temporal changes in culturable
phenatrhene degraders in response to long-term exposure to phenantrhene in a soil
column system Environ Microbiol 5 888-895
Bogan BW Lahner LMamp Sullivan WR 2003 Degradation of straight-chain aliphatic and
high molecular weight polycyclic aromatic hydrocarbons by a strain of Mycobacterium
austroafricanum J Appl Microbiol 94 230-239
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Pollut Bull 57 695-702
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Austral Ecol 18 117-143
Cotrell MT amp Kirchman DL 2000 Natural assemblages of marine proteobacteria and
members of Cytophaga-Flavobacter cluster consuming low- and high molecular
weight dissolved organic matter Appl Environ Microbiol 66 1692-1697
Couling NR Towel MG Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158
3411-3420
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
167
Diaz E Fernandez A Prieto MA amp Garcia JL 2001 Bioremediation of aromatic
compounds by Eschericlia coli Microbiol Mol Biol Rev 65 523-569
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosm
simulation Marine Environ Res 52 195-211
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grant DJW 1967 Kinetic aspect of the growth of Klebsiella aerogenes with some
benzenoid carbon sources J Gen Microbiol 46 213-224
Hall TA 1999 bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 4195-98
Haritash AK Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJWuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kaplan CW Kitts CK 2004 Bacterial succession in a petroleum land treatment unit Appl
Environ Microbiol 70 1777-1786
Karen M amp Chistoserdov AY 2001 Phylogenetic analysis of the sucession of bacterial
communities in the Great South Bay (Long Island) Microb Ecol 35 85-95
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Klee AJ 1993 A computer program for the determination of the most probable number and
its confidence limits J Microbiol Methods 18 91-98
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Loacutepez Z Vila J Ortega-Calvo JJ amp Grifoll M 2008 Simultaneous biodegradation of
creosote-polycyclic aromatic hydrocarbons by a pyrene-degrading Mycobacterium
Appl Microbiol Biotechnol 78 165-172
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
168
MaY Wang L amp Shao Z 2006 Pseudomonas the dominant polycyclic aromatic
hydrocarbon-degrading bacteria isolated from Antarctic soils and the role of large
plasmids in horizontal gene transfer Environ Microbiol 8 455ndash465
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Methods
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
McConkey BJ Duxbury CL Dixon DG amp Greenberg BM 1997 Toxicity of a PAH
photooxidation product to the bacteria Photobacterium phosphoreum and the
duckweed Lemna gibba Effects of phenanthrene and its primary photoproduct
phenanthrenequinone Environ Toxicol Chem 16 892-899
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill App
Environ Microbiol 65 3566-3574
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2011 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Pollut 217 365-374Surridge
AKJ Wehner FC amp Cloete TE 2009 Bioremediation of polluted soil En Singh A
Kuhad RC Ward OP (eds) Adv Appl Biorem p103-121 Springer Berliacuten
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull 56 1184-1191
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
169
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol Progr Ser 390 55-65
Vilagrave M 1998 Efectos de la diversidad de especies en el funcionamiento de los ecosistemas
Orsis 13 105-117
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-97
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Yachi S amp Loreau M 1999 Biodiversity and ecosystem productivity in a fluctuating
environment The insurance hypothesis Proc Natl Acad Sci USA 96 1463-1468
Yu SH Ke L Wong YS amp Tam NFY 2005a Biodegradation of polycyclic aromatic
hydrocarbons (PAHs) by a consortium enrichment from mangrove sediments Environ
Int 32 149-154
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005b Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
bull Discusioacutengeneral
II
Discusioacuten general
173
Discusioacuten general
Temperatura y otros factores ambientales determinantes en un proceso de
biodegradacioacuten
El resultado final de la aplicacioacuten directa de teacutecnicas de biorremediacioacuten en un medio
contaminado estaacute fuertemente influenciado por los paraacutemetros ambientales Por este motivo
son numerosos los estudios (ej Chaicircneau et al 2005 Cheung amp Kinkle 2005 Leys et al
2005 Chen et al 2008) realizados para optimizar y en la medida de lo posible modificar
tanto los factores bioacuteticos como abioacuteticos Frecuentemente la optimizacioacuten se ha llevado a
cabo considerando exclusivamente un solo factor implicado por ejemplo la temperatura
(Torres et al 2005) la concentracioacuten de nutrientes y la relacioacuten CNP (Leys et al 2005) o
el tipo de nutrientes y los surfactantes adicionados (Cheung amp Kinkle 2005) Pocos son los
estudios en los que se valoran dos o tres factores conjuntamente (Kaumlstner et al 1998
Cheung amp Kinkle 2005) y menos auacuten en los que se combinan maacutes de cuatro paraacutemetros
variables Chen et al (2008) destacoacute la importancia de evaluar en el proceso de
optimizacioacuten tanto los efectos individuales como los derivados de la interaccioacuten entre
factores mediante un meacutetodo factorial completo La optimizacioacuten de un proceso de
biorremediacioacuten previo a la aplicacioacuten in situ es fundamental y un disentildeo ortogonal del
experimento va a permitir ademaacutes considerar los efectos sineacutergicos y antagoacutenicos
derivados de la interaccioacuten entre las variables bioacuteticas y abioacuteticas (Chen et al 2008) Los
resultados obtenidos en los dos trabajos de optimizacioacuten que componen el capiacutetulo 1
demuestran que los factores ambientales significativamente influyentes en la tasa de
biodegradacioacuten (kB) de HAP son diferentes cuando se fijan como constantes todos los
paraacutemetros excepto uno (capiacutetulo 1a) que cuando todos los paraacutemetros se consideran
variables y se combinan en un anaacutelisis ortogonal (capiacutetulo 1b) Sin embargo los resultados
obtenidos de un anaacutelisis factorial no invalidan la optimizacioacuten individual la cual es necesaria
y maacutes adecuada en casos en los que tan soacutelo interesa estudiar la influencia de un
determinado factor en el proceso de biodegradacioacuten En algunos casos determinados
paraacutemetros ambientales fijos e inamovibles (ej bajas temperaturas) dificultan el proceso de
biodegradacioacuten y mediante la optimizacioacuten individual y posterior modificacioacuten de otros
factores del medio (ej nutrientes fuente de carbono) se consigue aumentar la eficacia del
proceso Ademaacutes como resultado de la optimizacioacuten indiviadual de factores realizada en el
capiacutetulo 1a de la presente tesis se obtuvo un medio de crecimiento oacuteptimo (capiacutetulo 1) que
que se usoacute en ensayos y experimentos posteriores (capiacutetulos 3 y 4)
Discusioacuten general
174
Dada la elevada variabilidad de resultados que se pueden obtener en la eficacia de
biodegradacioacuten en funcioacuten de los factores ambientales y sus modificaciones proponemos
que los ensayos de optimizacioacuten del proceso para determinar las condiciones oacuteptimas del
mismo es fundamental para maximizar la eficacia (tiempo y costes) de la aplicacioacuten in situ
De entre todos los factores ambientales limitantes de la biodegradacioacuten de
hidrocarburos del petroacuteleo como son los HAP la temperatura es uno de los que maacutes
condiciona la eficacia del mismo (Chen et al 2008) En la presente tesis los procesos de
biodegradacioacuten realizados a bajas temperaturas (capiacutetulo 3 y 4) con el objetivo de evaluar la
influencia de este factor en la eficacia de degradacioacuten y en la comunidad bacteriana
muestran que la degradacioacuten del contaminante es menor a temperaturas inferiores a 15ordmC
(Margesin et al 2002) La notable ralentizacioacuten de las tasas de crecimiento bacteriano y
degradacioacuten a temperaturas bajas (capiacutetulos 3 y 4) fue debida a la menor solubilidad de los
HAP (Haritash amp Kaushik 2009) y al decrecimiento del metabolismo microbiano (Leahy amp
Colwell 1990) Los estudios centrados en la obtencioacuten de la temperatura oacuteptima durante los
procesos de degradacioacuten de HAP por un consorcio bacteriano (Capiacutetulos 1a 1b y 3) han
determinado que no existe un valor oacuteptimo sino maacutes bien un rango oacuteptimo que oscila entre
los 20ordmC y los 30ordmC Tal y como concreta Chen et al (2008) son las fluctuaciones amplias
de temperatura lo que dificulta el proceso de biodegradacioacuten Cuando el rango de variacioacuten
es estrecho y ademaacutes se encuentra dentro de los valores oacuteptimos la influencia es
significativamente despreciable (capiacutetulo 1b) Sin embargo hay que tener presente que
existen ecosistemas susceptibles de ser contaminados en zonas cuyas condiciones
climaacuteticas son extremas Histoacutericamente grandes desastres ecoloacutegicos se han producido en
aacutereas cuyas temperaturas medias estaacuten muy por debajo del rango oacuteptimo como es el caso
del petrolero Exxon Vadez en Alaska (Bence et al 1996) o el Prestige en Espantildea (Soriano
et al 2006) A pesar de la evidente importancia de este aspecto poco se sabe sin embargo
de la degradacioacuten de HAP a temperaturas friacuteas comprendidas entre los 5 ordmC-15 ordmC la cual
es posible gracias a la presencia de especies psicrotolerantes y psicroacutefilas (ldquocold-adaptedrdquo)
(Margesin amp Schinner 2001) Alguna de estas especies que han adquirido o que poseen
intriacutensecamente la capacidad para degradar hidrocarburos pertenecen a los geacuteneros
Pseudomonas Acinetobacter o Pshycrobacter (Eriksson et al 2003 Margesin et al 2003)
La identificacioacuten de estos geacuteneros en los consorcios bacterianos (C2PL05 y BOS08)
posiblemente ha sido determinante en los procesos de biodegradacioacuten a bajas temperaturas
(capiacutetulos 3 y 4) ya que aunque con menores tasas que a temperaturas altas la
biodegradacioacuten ha sido posible Estas especies son claves para el mantenimiento de dicha
comunidad ya que su actividad metaboacutelica durante periodos de bajas temperaturas o en
ambientes permanentemente friacuteos permite la mineralizacioacuten de los hidrocarburos y
subsecuente formacioacuten de otros compuestos maacutes sencillos y faacuteciles de degradar por el resto
Discusioacuten general
175
de las especies del consorcio o la comunidad (Pelz et al 1999) La utilizacioacuten de consorcios
bacterianos adaptados a climas friacuteos compuestos por especies con capacidad degradadora
puede ser una medida de actuacioacuten fundamental en aacutereas extremas Ademaacutes a partir de
estas cepas psicrotolerantes y psicroacutefilas se estaacuten aislando enzimas oxidativas capaces de
trabajar a bajas temperaturas con un importante potencial en procesos biotecnoloacutegicos
(Cavicchioli et al 2002)
Consorcios bacterianos durante un proceso de biodegradacioacuten factores que
determinan la sucesioacuten de especies
La sucesioacuten de especies en un consorcio durante un proceso de biodegradacioacuten depende
en gran medida de ciertas caracteriacutesticas celulares y metaboacutelicas de las especies que lo
componen sobre todo cuando la fuente de carbono son HAP de alto peso molecular
(Mueller et al 1997) Por ejemplo algunas especies de Pseudomonas (P aeruginosa
Soberon-Chavez et al 2005) tienen la capacidad de producir biosurfactantes para aumentar
la biodisponibilidad de HAP o bien como es el caso de las Gram-positivas la presencia de
una uacutenica membrana permite un transporte maacutes eficaz de los HAP al interior de la ceacutelula
(Mueller et al 1997) En la mayoriacutea de los casos las sustancias que se presentan como
recalcitrantes para una especie individual pueden metabolizarse a traveacutes de secuencias
cataboacutelicas complementarias que presentan las diferentes especies de un consorcio
(Fritsche 1985) De ahiacute que con los consorcios microbianos se puedan obtener tasas de
degradacioacuten mucho maacutes elevadas que con cepas individuales (Bautista et al 2009) Sin
embargo la estabilidad y eficacia de un consorcio bacteriano estaacuten determinadas por las
relaciones de supervivencia entre las especies que lo componen Un caso en el que las
asociaciones bacterianas son fundamentales son los procesos de biorremediacioacuten a bajas
temperaturas ya que tal y como Leahy amp Cowell (1990) exponen los consorcios bacterianos
cuentan con una capacidad enzimaacutetica maacutes amplia que especies aisladas y por tanto
mayor versatilidad y superioridad de supervivencia
Una modificacioacuten sobre el consorcio como es la dilucioacuten del mismo (capiacutetulo 1b)
puede afectar a las tasas de degradacioacuten finales precisamente porque modifican las
relaciones inicialmente establecidas entre las especies Igualmente este paraacutemetro puede
modificar el patroacuten de crecimiento sin que esto suponga un cambio significativo en la tasa de
degradacioacuten (capiacutetulo 1b) hecho que dependeraacute de la capacidad degradadora de la especie
favorecida (Szaboacute et al 2007) Por tanto la concentracioacuten del inoacuteculo introducido en un
medio contaminado puede condicionar la eficacia del proceso
Discusioacuten general
176
En los diferentes experimentos que componen los capiacutetulos de este proyecto doctoral
no se han realizado pruebas fisioloacutegicas para estudiar las rutas metaboacutelicas o la importancia
relativa del cometabolismo que condicionen la sucesioacuten o composicioacuten de especies de una
comunidad Sin embargo los anaacutelisis de la comunidad bacteriana a traveacutes de la
identificacioacuten de especies cultivables (capiacutetulos 2 y 3) y no cultivables (capiacutetulos 2 3 y 4)
mediante teacutecnicas moleculares indican que la comunidad bacteriana cambia y por tanto
existe una sucesioacuten y coexistencia determinada de especies en el tiempo Los resultados
obtenidos en el capiacutetulo 2 indican que las especies del consorcio cambian en funcioacuten de la
fuente de carbono disponible (HAP y subproductos de degradacioacuten de HAP) y la presencia
de determinados surfactantes (Tween-80 y HAP o solo HAP) por lo que eacutestos pueden ser
factores que intervienen en la sucesioacuten de especies en un consorcio En muchos procesos
de biodegradacioacuten es comuacuten la adicioacuten de ciertas fuentes de carbono para aumentar la
biomasa de los consorcios bacterianos o cepas concretas y acelerar por tanto el proceso de
biodegradacioacuten (Chen amp Aitken 1999 Lee et al 2003) Sin embargo dada la mencionada
influencia de la fuente de carbono sobre la composicioacuten de especies el resultado de esta
medida puede ser negativo en consorcios bacterianos en los que coexistan especies
degradadoras de una determinada fuente de carbono (ej HAP) con otras que no lo son
(capiacutetulo 1a y 1b) Este hecho es debido a que la adaptacioacuten a la nueva fuente de carbono
de los microorganismos degradadores de HAP se traduce en un aumento de la fase de
latencia y por tanto en un retraso de la tasa de degradacioacuten (Maier et al 2009) Este
fenoacutemeno se pudo observar con claridad cuando se suministroacute al consorcio degradador
C2PL05 glucosa como uacutenica fuente de carbono o en combinacioacuten con HAP (capiacutetulos 1a y
1b)
Nuevas especies bacterianas degradadoras de HAP
La identificacioacuten de especies en los numerosos trabajos de biodegradacioacuten realizados hasta
el momento verifican la existencia de una importante variedad de bacterias degradadoras
de HAP Sin embargo esto no implica que no haya taxa particularmente bien adaptados a
medios contaminados (Mueller et al 1997) y que frecuentemente esteacuten involucrados en
procesos de biodegradacioacuten Este es el caso de geacuteneros como Pseudomonas
Acinetobacter Sphingomonas y Stenothrophomonas identificados durante los ensayos que
componen los capiacutetulos 2 3 y 4 Ademaacutes de la identificacioacuten de especies pertenecientes a
estos geacuteneros ampliamente descritos en procesos de biodegradacioacuten (ej Pseudomonas
Sphingomonas Sphingobium Ralstonia Flexibacter Rhodococcus y Bacillus) cabe
destacar la importancia del aislamiento e identificacioacuten de secuencias englobadas en nuevos
geacuteneros degradadores ineacuteditos hasta el momento o cuya implicacioacuten en estos procesos es
Discusioacuten general
177
escasa Este es el caso de Enterobacter cloacae y E ludwigii (γ-Proteobacterias)
identificadas en el consorcio C2PL05 como degradadoras de HAP de bajo peso molecular
Incluso en un estudio previo (Bautista et al 2009) se ha determinado que la eficacia
degradadora de este geacutenero es mucho maacutes eficaz que otras especies degradadoras
frecuentemente descritas como Pseudomonas fluorescens o Stenotrophomonas maltophilia
Pantoea aglomerans (γ-Proteobacterias) es otra Enterobacteriaceae identificada por primera
vez como degradadora de (capiacutetulo 4) En escasas ocasiones (Toledo et al 2006) una
especie de la familia Enterobacteraceae ha sido identificada como degradadora de HAP o
de crudo (Zhang et al 2010) Asiacute mismo es la primera vez que bacterias Gram-positivas
pertenecientes a los geacuteneros Balneimonas sp (capiacutetulo 4) Bradyrhizobium sp y
Nitrobacteria sp (capiacutetulo 2) todas α-Proteobacterias y por otro lado el geacutenero
Microbacterium sp (Phylum Actinobacterias Capiacutetulo 3) se relacionan con procesos de
biodegradacioacuten de HAP y en procesos de mineralizacioacuten de sustancias recalcitrantes La
presencia de estos organismos debe quedar justificada por su capacidad degradadora dado
que han sido identificadas a partir de bandas de gran intensidad en DGGE teacutecnica que se
ha realizado con muestras procedentes de ensayos de biodegradacioacuten de HAP y creosota
(capiacutetulos 2 3 y 4) Es decir su mera presencia en el consorcio no parece justificable por
causas aleatorias sino maacutes bien por su implicacioacuten directa en los procesos metaboacutelicos
asociados a la degradacioacuten Por ejemplo el aislamiento e identificacioacuten en el capiacutetulo 2 de
especies del geacutenero Nitrobacteria podriacutea estar relacionada con la reduccioacuten de nitritos
presentes en el medio contaminado (capiacutetulo 2 Gonzaacutelez et al 2010)
Los resultados de identificacioacuten mediante teacutecnicas moleculares muestran la evidente
variedad de geacuteneros implicados en estos procesos La variabilidad observada fue mucho
menos intensa con las teacutecnicas moleculares dependientes de cultivo (capiacutetulo 2) ya que tan
solo entre un 1 y un 10 del total de bacterias del suelo son cultivables (Nannipieri et al
2003) Algunos autores (Menn et al 1993 Okpokwasili et al 1986) proponen que los genes
cataboacutelicos para la degradacioacuten de HAP probablemente se transmitan horizontalmente
mediante plaacutesmidos entre bacterias pertenecientes a grupos taxonoacutemicos muy diferentes
Mueller et al (1997) afirman que no es probable encontrar una clara relacioacuten entre grupos
taxonoacutemicos de bacterias y la produccioacuten de enzimas implicadas en la degradacioacuten de
hidrocarburos aromaacuteticos Por tanto no es extrantildeo que genes homoacutelogos (en este caso
degradativos) se expresen en bacterias que taxonoacutemicamente estaacuten muy poco relacionadas
(capiacutetulos 2 3 y 4) otorgando una alta variabilidad al conjunto de bacterias con capacidad
degradadora
Discusioacuten general
178
Preexposicioacuten a los HAP iquestes necesaria para una biodegradacioacuten eficaz HAP
Tradicionalmente algunos autores han sugerido que la preexposicioacuten de bacterias a un
determinado contaminante es necesaria para la adaptacioacuten y consecuente degradacioacuten
(Spain amp van Veld 1983) o para un aumento en la tasa del proceso (Haritash amp Kaushik
2009) Sin embargo autores como Johnsen amp Karlson (2005) se plantean si eacutesta es una
capacidad presente en las comunidades microbianas independientemente de su previa
exposicioacuten o si es una capacidad inducida por la exposicioacuten a elevados niveles de
contaminante Los procesos de biodegradacioacuten realizados con consorcios bacterianos
procedentes de zonas libres de contaminacioacuten por HAP (capiacutetulos 3 y 4) indican que eacutesta
es una capacidad intriacutenseca en las bacterias e independiente de la previa exposicioacuten y que
se manifiesta ante un periodo de contaminacioacuten Los geacuteneros identificados en el capiacutetulo 3
(Ralstonia Pseudomonas o Bacillus) son propios de sistemas con un alto contenido en
madera en descomposicioacuten en los que contribuyen a la degradacioacuten de lignocelulosa
celulosa y sus subproductos mediante enzimas oxidativas (Rastogi et al 2009) Las
enzimas lignoliacuteticas de los hongos saproacutefitos degradan compuestos con estructuras
quiacutemicas similares a la lignina como son los HAP (Hatakka 1994 2001 Barr amp Aust 1994
Meulenberg et al 1997) Por tanto las especies bacterianas con la bateriacutea enzimaacutetica para
degradar subproductos de lignina y celulosa pueden tambieacuten adaptarse y metabolizar HAP
(Tian et al 2008 Couling et al 2010) La capacidad degradadora de este tipo de
compuestos no solo se transmite de manera vertical sino que la transferencia horizontal de
genes puede ser tambien un factor determinante para la adquisicioacuten de esta capacidad entre
los microorganismos del consorcio o comunidad
Los resultados referentes a la alta capacidad degradativa que muestra el consorcio
BOS08 procedente de una zona limpia (capiacutetulo 3) gozan de una extraordinaria importancia
a nivel aplicado y ecoloacutegico La mayoriacutea de los trabajos que estudian el posible paralelismo
entre la degradacioacuten de lignina y la de compuestos aromaacuteticos se han llevado a cabo con
hongos maderables de la llamada ldquopodredumbre blancardquo El hecho de que un consorcio
bacteriano no adaptado a la degradacioacuten de HAP sea capaz de metabolizar eficazmente
HAP de alto peso molecular y ademaacutes disminuya la toxicidad del medio por debajo del
umbral de la toxicidad incluso a bajas temperaturas sin duda abre un campo de
investigacioacuten muy amplio dentro de la biorremediacioacuten Ecofisioloacutegicamente hablando
resultan tambieacuten de gran intereacutes estas espcies que han sido capaces de readaptar su
bateriacutea enzimaacutetica para metabolizar una fuente de carbono altamente recalcitrante y toacutexica
que no estaba presente en su medio natural
Discusioacuten general
179
Posibles actuaciones en un medio contaminado
Ante un caso de contaminacioacuten de un medio con HAP o sustancias que los contengan la
biorremediacioacuten resulta una de las teacutecnicas maacutes eficaces y respetuosas con el medio La
atenuacioacuten natural del contaminante por los microorganismos presentes en el propio medio
depende seguacuten Frosyth et al (1995) del tamantildeo de la poblacioacuten degradadora autoacutectona No
obstante los resultados obtenidos durante el proceso de biorremediacioacuten de un suelo
contaminado con creosota (capiacutetulo 4) indican que los resultados que puede ofrecer la
atenuacioacuten natural no dependen uacutenicamente del nuacutemero inicial de microorganismos
degradadores Las pruebas realizadas indicaron en el momento que se produjo la
contaminacioacuten la actividad degradadora era nula aunque tras un corto peridodo de
exposicioacuten al mismo comenzoacute la actividad de los microorganismos degradadores Esto
quiere decir que aunque en un primer momento la poblacioacuten degradadora sea miacutenima la
presencia del contaminante favorece su dominancia y hace patente su capacidad
degradadora Ademaacutes hay que tener en cuenta varias de las cuestiones abordadas en
apartados previos como son la rapidez y facilidad que tienen los microorganismos para
transferir esta capacidad incluso entre diferentes taxas (Menn et al 1993) o la alta
adaptabilidad a una nueva fuente de carbono Sin embargo la atenuacioacuten natural es una
teacutecnica muy ventajosa porque evita dantildeos en la comunidad bacteriana del medio a
diferencia de cualquier otra actuacioacuten que en menor o mayor medida modifican las
condiciones originales del ecosistema
Uno de los principales problemas de la biorremediacioacuten es el tiempo necesario para
la completa eliminacioacuten del contaminante del medio para lo cual se han desarrollado
estrategias de actuacioacuten con el uacutenico objetivo de acelerar y mejorar la eficacia del proceso
La bioestimulacioacuten tiene como principal objetivo potenciar la capacidad degradadora de los
microorganismos degradadores autoacutectonos mediante la adicioacuten de nutrientes inorgaacutenicos al
medio contaminado Sin embargo los resultados referentes a esta teacutecnica no son
concluyentes dada la elevada variabilidad de los mismo Los casos en los que la
bioestimulacioacuten favorece el proceso de biodegradacioacuten estaacuten estrechamente relacionados
con el impedimento de que los nutrientes se conviertan en un factor limitante para los
microorganismos ya que tal y como expone Leys et al (2005) los requerimientos de
nitroacutegeno y foacutesforo aumentan notablemente durante un episodio de contaminacioacuten Sin
embargo son numerosos los estudios que han obtenido resultados desfavorables con esta
teacutecnica debido a cuestiones relacionadas con altos iacutendices de salinidad (Braddock et al
1997) o tal y como se observa en el capiacutetulo 4 con los cambios que la bioestimulacioacuten
genera en la comunidad bacteriana que en muchos casos inducen a relaciones negativas
entre las especies de la comunidad debido a la competencia por los nutrientes (Rolling-
Discusioacuten general
180
Willfred et al 2002) Por otra parte la bioestimulacioacuten durante el proceso de
biorremediacioacuten del suelo contaminado con creosota (capiacutetulo 4) no favorecioacute
significativamente la biodegradacioacuten del contaminante Estos resultados se pueden atribuir a
una concentracioacuten de nutrientes suficientes en el medio o bien a la raacutepida y efectiva
capacidad degradativa de creosota que mostraron los microorganismos autoacutectonos
El bioaumento es una teacutecnica que pretende incrementar la eficacia del proceso de
biorremediacioacuten mediante el inoacuteculo a la poblacioacuten autoacutectona de una poblacioacuten
degradadora previamente definida como tal Sin embargo es un tratamiento complejo cuyos
resultados dependen de algo tan desconocido y variable como son las relaciones entre
especies y comunidades (Yu et al 2005) Por ello no hay gran nuacutemero de artiacuteculos en los
que se describan resultados favorables de esta teacutecnica pero podemos resumir que las
consecuencias del bioaumento dependen fundamentalmente de dos cuestiones Una de
ellas es que las relaciones de competencia que se establecen entre la comunidad
introducida y autoacutectona sean negativas para la poblacioacuten degradadora (Vintildeas et al 2005
Yu et al 2005) relaciones que principalmente estaacuten dirigidas por la competicioacuten por los
recursos (Yu et al 2005) La inexistencia de efectos significativos del bioaumento durante el
proceso de bodegradacioacuten de creosota (capiacutetulo 4) al igual que los descritos por Herwignen
et al (2005) indican que la presencia de una comunidad bacteriana autoacutectona con
capacidad degradadora o que se adapta raacutepidamente como es nuestro caso puede ser otra
de las cuestiones que hagan que el bioaumento no favorezca el proceso
Los ensayos de biorremediacioacuten realizados durante la presente tesis y los
consultados en las diferentes referencias bibliograficas nos llevan a concluir una vez maacutes
que los efectos de las diferentes teacutecnicas de biorremediacioacuten dependen de las condiciones
del medio contaminado y de la poblacioacuten bacteriana que alberga Por ello un estudio previo
que indique las caracteriacutesticas bioacuteticas (capacidad degradadora composicioacuten y evolucioacuten de
la comunidad bacteriana) y abioacuteticas (temperatura ambiente y caracteriacutesticas fisico-quiacutemicas
del suelo) del mismo asiacute como un breve ensayo a escala de laboratorio donde se apliquen
las diferentes teacutecnicas y seleccionando las maacutes adecuadas mejora en gran medida la
efectividad de la biorremediacioacuten in situ
Conclusiones generales
III
Conclusiones generales
183
Conclusiones generales
De los trabajos llevados a cabo en esta tesis doctoral se pueden extraer las siguientes
conclusiones generales
1 La optimizacioacuten de los factores abioacuteticos y bioacuteticos hace que el proceso de
biodegradacioacuten sea maacutes eficaz y permite modificarlo mediante estrategias de
biorremediacioacuten
2 Los factores que realmente influyen significativamente en un proceso se observan
mediante un estudio ortogonal de los mismos porque permite evaluar las
interacciones entre los factores seleccionados
3 No todos los ambientales son limitantes para la degradacioacuten de HAP Po ejemplo la
bioestimulacioacuten con nutrientes inorgaacutenicos no es efectiva en casos en los que la
cantidad de nutrientes en el medio es suficiente La adicioacuten de glucosa como fuente
adicional de carbono no es necesaria cuando el consorcio esta adaptado a los HAP
como fuente de carbono
4 Las actuaciones basadas en la adicioacuten de fuentes de carbono adicionales a los HAP
no son efectivas cuando los consorcios o cepas bacterianas estaacuten adaptadas a los
HAP porque esto supone un periodo de readaptacioacuten
5 La fuente de carbono disponible en cada momento durante un proceso de
biodegradacioacuten de HAP y otras sustancias en el medio como los surfactantes
condicionan la presencia de especies y por tanto la sucesioacuten de las mismas
6 La aparicioacuten de nuevas especies previamente no descritas como degradadoras
puede estar relacionada con la transferencia horizontal de genes degradativos que
en muchos casos ocurre entre grupos taxonoacutemicos poco relacionados lo que
ampliariacutea auacuten maacutes la expresioacuten de la capacidad degradativa en la comunidad
7 La identificacioacuten en un consorcio procedente de una zona limpia y rica en materia
orgaacutenica de especies fundamentales en sistemas de degradacioacuten de madera
sugiere que las enzimas oxidativas usadas por estas especies en la degradacioacuten de
subproductos de lignina y celulosa se emplean en la degradacioacuten de HAP Por tanto
Conclusiones generales
184
la previa exposicioacuten de los consorcios bacterianos o cepas individuales a un
contaminante no es necesaria cuando tienen una bateriacutea enzimaacutetica que se puede
adaptar y metabolizar el contaminante
8 El papel de las especies bacterianas adaptadas a la degradacioacuten de HAP en
ambientes friacuteos (Tordf lt 15ordmC) es fundamental para la biorremediacioacuten en climas
extremos Ademaacutes la actividad de estas especies en periodos de bajas temperaturas
permite el crecimiento de otras especies de la comunidad bacteriana a partir de los
subproductos de degradacioacuten
9 El bioaumento es una teacutecnica cuyos resultados estaacuten ampliamente influenciados por
las relaciones que se establecen entre la comunidad autoacutectona e introducida y soacutelo
se recomienda en aquellos casos en los que la comunidad autoacutectona no tenga
microorganismos degradadores o no sean capaces de desarrollar esta capacidad
Referencias bibliograacuteficas
IV
Referencias bibliograacuteficas
187
Referencias bibliograacuteficas
Aislabie J Foght J amp Saul D 2000 Aromatic hydrocarbon-degrading bacteria from soil near
Scott Base Antarctica Polar Biol 23 183-188
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Baek KH Yoon BD Kim BH Cho DH Lee IS Oh HM amp Kim HS 2007 Monitoring of
microbial diversity and activity during bioremediation of crude oil-contaminated soil
with different treatments J Microbiol Biotechnol 17 67-73
Barkay T amp Pritchart H 1988 Adaptation of aquatic microbial communities to pollutant
stress Microbiol Sci 5165-169
Barr DP amp Aust SD 1994 Mechanisms with rot fungi use to degrade pollutants Environ
Sci Technol 28 78A-87A
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Braddock JF Ruth ML Catterall PH Walworth JL amp McCarthynd KA 1997
Enhancement and inhibition of microbial activity in hydrocarbon contaminated arctic
soil implication for nutrients amended bioremediation Environ Sci Technol 31
2078-2084
Cavicchioli R Siddiqui KS Andrews D amp Sower KR 2002 Low temperature
extremophiles and their applications Curr Opin Biotechnol 13 253-261
Cerniglia1984 Microbial metabolism of polycyclic aromatic hydrocarbons Adv Appl
Microbiol 30 31-71
Cerniglia 1992 Biodegradation of polycyclic aromatic hydrocarbons Biodegradation 2-3
351-368
Referencias bibliograacuteficas
188
Chaicircneau CH Morel J Dupont J Bury E amp Oudot J 1999 Comparison of the fuel oil
biodegradation potential of hydrocarbon assimilating microorganisms isolated from a
temperate agricultural soil Sci Total Environ 227 237-247
Chaicircneau CH Rogeus G Yeacutepreacutemian C amp Outdot J 2005 Effects of nutrients
concentration on the biodegradation of crude oil and associated microbial
populations in the soil Soil Biol Biochem 37 1490-1497
Chauhan A Fazlurrahman Oakeshott JG amp Jain RK 2008 Bacterial metabolisms of
polycyclic aromatic hydrocarbons strategies for remediation Indian J Microbiol
4895-113
Chen S-H amp Aitken MD 1999Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
Environ Sci Technol 33 435ndash439
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of polycyclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Cheung P-Y amp Kinkle BK 2005 Effect of nutrients and surfactant on pyrene mineralization
and Mycobacterium spp populations in contaminated soil Soil Biol Biochem 37
1401-1405
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Clements WH Oris JT amp Wissin TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Leponis macrochirus
Arch Environ Contam Toxicol 26261-266
Colwell RR Mills AL Walker JD Garcia Tello P amp Campos V 1978 Microbial ecological
studies at the Metula spill in the Strait of Magellan J Fish Res Board Can 35573-
580
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Poll 158 3411-
3420
Das K amp Mukherjee AK 2006 Crude petroleum-oil biodegradation efficiency of Bacillus
subtillis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India Bioresour Technol 98 1339-1345
Delille D amp Pelletier E 2002 Natural attenuation of diesel-oil contamination in a subantartic
soil (Crozet island) Polar Biol 25 682-687
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge App Environ Mirobiol 37 729-739
Referencias bibliograacuteficas
189
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosms
simulation Marine Environ Res 52 195-211
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in artic tundra soil Appl Environ Microbiol 67 5107-
5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap
Evolution 39 783-791
Fiechter A 1992 Biosurfactants moving towards industrial application Trends Biotechnol
10 208-217
Fritsche JD 1985 Nature and significance of microbial cometabolism of xenobiotics J
Basic Bacteriol 25 603-619
Forsyth JV Tsao YM amp Bleam RD 1995 Biorremediation when is augmentation needed
In Hinchee RE Fredrickson J amp Alleman BC (Eds) Bioaugmentation for site
remediation Battelle Press Columbus pp 1-14
Ghazali FM Rahman RNZA Salleh AB amp Basr M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grimberg SJ Stringfellow WT amp Aitken MD 1996 Quantifying the biodegradation of
phenanthrene by Pseudomonas stutzeri P16 in the presence of a nonionic surfactant
Appl Environ Microbiol 62 2387-2392
Habe H amp Omori T 2003 Gentics of polycyclic aromatic hydrocarbon metabolisms in
diverse aerobic bacteria Biosci Biotechnol Biochem 67 225-243
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of polycyclic aromatic
hydrocarbons (PAHs) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microbial Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M amp Steinbuchel A (eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJ Wuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
Referencias bibliograacuteficas
190
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Internacional Agency for Research on Cancer 1972-1990 Monographs on the evaluation of
carcinogenics risks on human International Agency for Research on Cancer Lyons
France
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Johnsen AR Wick LY amp Harms H 2005 Principles of microbial PAH-degradation in soil
Environ Pollut 133 71-84
Johnsen AR Lipthay JR Sorensen SJ Ekelund F Christensen P Andersen O
Karlson U amp Jcobsen CS 2006 Microbial degradation of street dust polycyclic
aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil
Environ Microbiol 8535-545
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kanaly RA amp Harayama S 2000 Biodegradation of high molecular weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059-2067
Kaumlstner M Breueer-Jammali M amp Mahro B 1998 Impact of inoculation protocols salinity
and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil Appl Environ Microbiol 64 359-362
Kim Y H Freeman J P Moody J D Engesse K H amp Cerniglia C E 2005 Effects of pH
on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii
PYR-1 Appl Environ Microbiol 67 275ndash285
Koeber R Bayona JM amp Niessner R 1999 Determination of benzene[a]pyrene diones in
air particulates matter with liquid chromatography mass spectrometry Environ Sci
Technol 33 1552-1558
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Lee ML Novotny MV amp Bartle KD 1981 Analytical chemistry of polycyclic aromatic
hydrocarbons Academic Press Inc New York NY
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegrdation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Referencias bibliograacuteficas
191
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation by
Mycobacterium and Sphingomonas in soil Appl Microbiol Biotechnol 66 726-736
Lim LH Harrison RM amp Harrad S 1999 The contribution of traffic to atmospheric
concentration of polycyclic aromatic hydrocarbons Environ Sci Technol 33 3538-
3542
Liu Y Zhu L amp Shen X 2001 Polycyclic aromatic hydrocarbons in indoor and outdoor air of
Hangzhou China Environ Sci Technol 35 840-844
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Maliszewska-Kordybach B 1996 Polycyclic aromatic hydrocarbons in agricultural soils in
Poland preliminary proposals for criteria to evaluate the level of soil contamination
Appl Geochem 11 212-127
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts
Extremophiles 7451ndash458
Martiacuten Guirao L 2007 Aproximacioacuten ecotoxicoloacutegica a la contaminacioacuten por metales
pesados en la laguna costera del Mar Menor Tesis doctoral Universidad de Murcia
Murcia
Menn F-M Applegate BM amp Sayler GS 1993 NAH-plasmid mediated catabolisms of
anthracene and phenanthrene to naphtoic acids Appl Environ Microbiol 59 1938-
1942
Meulenberg R Rijnaarts HHM Doddema HJ amp Field A 1997 Partially oxidized polycyclic
aromatic hydrocarbons show an increased bioavailability and biodegradability FEMS
Microbiol 152 45-49
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Referencias bibliograacuteficas
192
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mueller JG Chapman PJ Blattman BO amp Pritchard PH 1990 Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis Appl
Environ Microbiol 56 1079-1086
Mueller JG Devereux R Santavy DL Lantz SE Willis SG amp Pritchard PH 1997
Phylogenetic and Physiological comparisions of PAH-degrading bacteria from
geographically diverse soils A van Leeuw J Microb 71 329-343
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions European J Soil Sci 54 655-670
Okpokwasili GC Somerville CC Grimes DJ amp Colwell RR 1986 Plasmid-associated
phenanthrene degradation by Chesapeake Bay sediment bacteria A Colloq Inst
Fran Rech Exploit Mer 3 601ndash610
Pelz O Tesar M Wittich RM Moore ERB Timmis KN Abraham WR 1999 Towards
elucidation of microbial community metabolic pathways unrevealing the network of
carbon sharing in a pollutant-degrading bacterial consortium by immunocapture and
isotopic ratio mass spectrometry Environ Microbiol 1167ndash174
Portaels F amp Pattyn SR 1982 Growth of mycobacteria in relation to the pH of the medium
Ann Microbiol 133 213-221
Puntus IF Filonov AE Akhmetov LI Karpov AV amp Boronin AM 2008 Phenanthrene
degradation by bacteria of the genera Pseudomonas and Burkholderia in model soil
systems Microbiology 77 7-15
Rastogi G Muppidi GL Gurram RN Adhikari A Bischoff KM Hughes SR Apel WA
Bang SS Dixon DJ amp Sani RK 2009 Isolation and characterization of cellulose-
degrading bacteria from the deep subsurface of the Homestake gold mine Lead
South Dakota USA J Ind Microbiol Biotechnol 36 585-598
Readman J W Fillmann G Tolosa I Bartocci J Villeneuve J -P Catinni C amp Mee L D
2002 Petroleum and PAH contamination of the Black Sea Marine Pollut Bull 44
48-62
Rolling Willfred FM Milner MG Jones DM Lee K Danniel F Swanell Richard JP amp
Head IM 2002 Robust hydrocarbons degradation and dynamics of bacterial
communities during nutrients-enhanced oil spill bioremediation Appl Environ
Microbiol 68 5537-5548
Rosenberg E amp Ron EZ 1999 High ndash and low- molecular mass microbial surfactant Appl
Microiol Biotechnol 52 154-162
Referencias bibliograacuteficas
193
Santos E C Jacques R J S Bento F M Peralba M-C R Selbach PA Saacute E L S
Camargo FAO 2008 Anthracene biodegradation and surface activity by an iron-
stimulated Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Shuttleworth KL amp Cerniglia E 1995 Environmental aspect of PAH biodegradation Appl
Biochem Biotechnol 54 291-302
Soberon-Chavez G Lepine F amp Deziel E 2005 Production of rhamnolipids by
Pseudomonas aeruginosa Appl Microbiol Biotechnol 68 718-725
Soriano JA Vintildeas MA Franco JJ Gonzaacutelez JM amp Albaigeacutes J 2006 Spatial and
temporal trends of petroleum hydrocarbons in wild mussels from the Galician coast
(NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquat Microb Ecol 47 1-10
Tian L Ma P amp Zhong J-J 2003 Impact of presence of salicylate or glucose on enzyme
activity and phenanthrene degradation by Pseudomonas mendocina Process
Biochem 38 1125-1132
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull56 1184-1191
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons
removal capacities Syst Appl Microbiol 29 244-252
Torres LG Rojas N Bautista G amp Iturbe R 2005 Effect of temperature and surfactantacutes
HLB and dose over the TPH-diesel biodegradation process in aged soils Process
Biochem 40 3296-3302
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated Soil App Environ Microbiol 71 7008-7018
Wagrowski DM amp Hites RA 1997 Polycyclic aromatic hydrocarbons accumulation in urban
suburban and rural vegetation Environ Sci Technol 31 279-282
Referencias bibliograacuteficas
194
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacilus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Pollut 139 1-13
Wu SC amp Gschwend PM 1986 Sorption kinetics of hydrophobic organic compounds to
natural sediments and soil Environ Sci Technol 20 717-725
Ye B Siddigi MA Maccubbin AE Kumar S amp Sikka HC 1996 Degradation of
polynuclear aromatic hydrocarbons by Sphyngomonas paucimobilis Environ Sci
Technol 30136-142
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005 Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
Zender M 1983 Physical and chemical properties of polycyclic aromatic hydrocarbons p 1-
26 In ABjorseth (ed) Handbook of polycyclic aromatic hydrocarbons Marcel
Dekker Inc New York NY
Zhang XX Cheng SP Zhu CJ amp Sun SL 2006 Microbial PAH-degradation in soil
degradation pathways and contributing factors Pedosphere 16 555-565
Zhang Z Gai L Hou Z Yang C Ma C Wang Z Sun B He X Tang H amp Xu P 2010
Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils Bioresource Technol 101 8452ndash8456
Agradecimientos
197
Agradecimientos
Todaviacutea recuerdo el primer diacutea que entre en el departamento en el laboratorio
aquello me parecioacute todo un mundo en el cual sin quererlo y sin estar convencida de
ello acabeacute metida de lleno Poco a poco fueron pasando los meses los antildeos
presenteacute el Practicum y me diacute cuenta de que queriacutea seguir adelante Unos cuantos
antildeos despueacutes he llegado a la meta lo cual no hubiera sido posible sin mucha gente
que me ha apoyado ayudado y empujado en los momentos en los que yo no podiacutea
maacutes A todos ellos gracias por hacer que esto haya sido posible
El primero de mis agradecimientos va dirigido a Natalia Fernando y Mari
Carmen Os tengo que dar las gracias por brindarme la oportunidad de formar parte
del grupo y por tantas cosas que con cada uno de vosotros he aprendido Despueacutes
de estos antildeos creo que hemos conseguido cosas maravillosas aunque hayamos
tenido imprevistos de todo tipo porque como ya sabemos si ponemos un circo nos
crecen los enanoshellippero aquiacute estamos Somos un grupo muy equilibrado
profesionalmente tenemos un poco de todo y por otro lado no es mal balance tres
histeacutericas frente a uno que pone la calma no se como no hemos acabado contigo
Fernando Natalia gracias por hacerme controlar el miura que llevo dentro y tener
tanta paciencia Carmen gracias por estar siempre ahiacute ya sea desde Espantildea desde
el otro lado del charco o nada mas ser mamaacute En todo momento a nivel personal y
profesional me he sentido arropada por vosotros gracias por vuestro apoyo y ganas
de seguir adelante Vosotros habeis sido los responsables de que quiera investigar
Si una persona en concreto se merece especial agradecimiento es mi Yoli
Aunque al principio de todo no nos conociacuteamos no hay mas que vernos ahora Por
un lado ha sido imprescindible la ayuda que me has dado trabajando cuando maacutes
perdida estaba Por todo tu apoyo ten presnete que me has ayudado a escribir cada
una de las liacuteneas que has leiacutedo Has sabido ser mi amiga y estar conmigo cuando
maacutes lo he necesitado y hacer que me olvidara de todo ya sea haciendo toriijas
pizzas viendo una peli tomando una copichuela o con nuestros preciados pinchitos
sobre todo estos uacuteltimos meses estresantes en los que no seacute como no te he vuelto
loca Gracias tambieacuten por hacerme reir hasta llorar por preocuparte cada diacutea de
198
estas uacuteltimas semanas de coacutemo voy por conocerte todas y cada una de las cosas
en las que estoy trabajando y un largo etc Te conoces mejor yo el estado de cada
uno de mis artiacuteculos las correcciones que tengo y las que me faltan Eres estupenda
y espero no dejar de descubrir nunca cosas sobre ti Mil gracias
Son muchas las personas que han pasado por el despacho Pepe aunque
estas muy muy lejos agardezco tu ayuda continua sobre todo en el Maacutester la mitad
de las cosas se me hubieran olvidado si no hubiera sido por ti que cabeza la miacutea
Tambieacuten tengo que recordar a Raquel Felipe y Cris el antiguo equipo Ecotox
pasamos muy buenos ratos que se echan de menos A mis actuales compantildeeros
Alfredo Pesca Julia Silvia y Carlos que aunque no estas en el despacho como si lo
estuvieras Gracias por amenizar las horas de laboratorio y los madrugones Silvia
especialmente a ti gracias por sacar siempre un rato para charlar y escucharnos
mutuamente aunque nos separen un porroacuten de cajas y un poto gigante ahiacute estas
siempre Espero seguir aquiacute mucho tiempo para apoyarte igual que tuacute lo has hecho
conmigo Cris no me olvido de ti que desde el principio y hasta ahora te has
preocupado de saber que tal me iba estabas al tanto de todo y me has animado a
seguir adelante Te deseo que las cosas te vayan genial porque te lo mereces
asique aacutenimo que no es por presionar pero en breve te toca a tiacute Me faltan palabras
para contar todo lo que Moacutenica y Andrea me han ayudado y ensentildeado desde un
primer momento Igualmente agredezco el apoyo que Patri y Ester me han dado al
igual que los buenos ratos cotilleando imprescindibles Tambieacuten tengo que
agradecer a Jose Luis Sanz de la Universidad Autoacutenoma de Madrid que me abriera
las puertas de su laboratorio para aprender la maravillosa teacutecnica del DGGE y unas
cuantas cosas maacutes Ine a tiacute si que te agradezco un montoacuten las horas que has
perdido de tu trabajo para ensentildearme Desde un primer momento simpre con la
sonrisa puesta auacuten sin concocerme de nada Han sido muchos los viajes que he
hecho y el tiempo empleado en ello pero ha merecido la pena Asique igualmente
formas parte de esta tesis porque cada uno de los artiacuteculos no hubieran estado
completos sin tu ayuda
Son muchas las personas que sin formar parte del gremio han estado siempre
presentes Mis padres y mi hermano ya sabeis que no podriacutea hacer nada sin
vosotros a mi lado Durante estos antildeos no habeis dejado de preocuparos por mi y de
apoyarme ni un solo instante maacutes auacuten cuando las cosas han sido tan complicadas
199
para miacute Nada hubiera salido bien sin vosotros una vez maacutes os doy las gracias por
ser tan maravillosos y por teneros Por otro lado mis amigos ellos si que andan
agenos al tema y sin embargo siempre han sabido cuando preguntar y que palabras
usar cuando mas lo he necesitado Tengo que hacer una mencioacuten especial al sentildeor
Jimmy (responsable graacutefico y de disentildeo de la tesis) a ti si que te ha caiacutedo una
buena desde aquella llamada en la que te dije ldquoha llegado el momentordquo A
parte del gran trabajo que has hecho vistiendo la tesis tuacute una de las personas maacutes
sosegadas que conozco has podido aguantar el histerismo de los diacuteas previos a
depositar la tesis Gracias Jimmy eres un sol pero que sepas que auacuten me queda la
defensa oacutesea presentacioacuten en power pointhellipyo no digo nada Tambieacuten
agaradezco al ldquogrupo parkeeerdquo las horas que pasamos en las cuales a parte de
mucho friacuteo tambieacuten pasamos muy buenos ratos Especialmente a Lauri gracias por
acercarte un buen diacutea y preguntarme iquesttodo bien Desde entonces tus achuchones
tus canciones y tu ldquoflower powerrdquo han hecho que me despeje cada tarde Gracias
tambieacuten por interesarte tanto por mi trabajo dentro de poco te lo podreacute presentar
Las uacuteltimas palabras van dirigidas a Javi A ti que has estado conmigo desde el
principio gracias por no dejar que me desquicie y darme siempre tranquilidad Son
muchas las horas que he dedicado a esto y siempre has estado recordaacutendome
cuando era el momeno de parar Gracias por saber comprender lo que hago aunque
a veces me queje tanto y por ayudarme a echarle un par de narices cuando maacutes
desanimada estaba Gracias por hacer que este mundo roto no estropee mi sonrisa
Todo el tiempo que no te he dedicado lo recuperaremos juntos en nuestra casa
A todos y cada uno de vosotros gracias
Raquel
Resumen Antecedentes
13
Antecedentes
Tal y como su propio nombre indica biorremediacioacuten significa ldquodar remediordquo mediante
teacutecnicas bioloacutegicas por lo que una definicioacuten acertada de biorremediacioacuten seriacutea el conjunto
de teacutecnicas que permiten resolver problemas de contaminacioacuten mediante el uso de
microorganismos (bacterias algas unicelulares etc) hongos plantas o enzimas derivadas
de ellos En el contexto de esta tesis la biorremediacioacuten se aplica a suelos u otros sistemas
contaminados con hidrocarburos aromaacuteticos policiacuteclicos (HAP o PAH siglas en ingleacutes
polyciclic aromatic hydrocarbons) Los HAP son compuestos que se generan por la
combustioacuten incompleta de combustibles foacutesiles por causas naturales y en mayor medida
antroacutepicas Si tenemos en cuenta que el sustento del sistema energeacutetico mundial son los
combustibles foacutesiles podemos hacernos una idea de la relevancia y elevada presencia de
estos compuestos en la vida cotidiana Considerando sus complejas propiedades y su
caraacutecter perjudicial para el ser humano y los ecosistemas (Internacional Agency for
Research on Cancer 1972-1990) los HAP suscitaron una creciente preocupacioacuten a partir
del pasado siglo siendo los primeros carcinoacutegenos ambientales reconocidos (Haritash amp
Kaushik 2009) Eacutesto dio lugar a numerosos estudios cientiacuteficos con el objetivo de
determinar sus efectos en el medio y el ser humano asiacute como a la buacutesqueda de soluciones
para su eliminacioacuten Frente a muchas otras teacutecnicas de eliminacioacuten de contaminantes
(teacutecnicas fiacutesicas yo quiacutemicas) la biorremediacioacuten presenta una caracteriacutestica clave que la
hace destacar sobre las otras teacutecnicas y es que se basa en procesos que respetan el medio
perturbado y permiten en la medida de lo posible su recuperacioacuten
Los hidrocarburos aromaacuteticos policiacuteclicos (HAP) Legislacioacuten espantildeola sobre medios
contaminados
La presente tesis se centra en el estudio de la biodegradacioacuten de los hidrocarburos
aromaacuteticos policiacuteclicos y por ello es esencial conocer a fondo queacute son cuaacuteles son sus
caracteriacutesticas y porqueacute suscitan este intereacutes Los HAP son compuestos quiacutemicos formados
por la fusioacuten de un determinado nuacutemero de anillos de su principal componente aromaacutetico el
benceno La estructura quiacutemica de alguno de los compuestos que han sido utilizados
durante el desarrollo de esta tesis aparecen en la Figura 1
Resumen Antecedentes
14
Figura 1 Hidrocarburos aromaacuteticos poliacuteciacuteclicos de bajo (naftaleno fenantreno y antraceno) y alto peso
molecular (pireno y perileno)
Los HAP se pueden clasificar en funcioacuten del nuacutemero de anillos benceacutenicos en HAP de
bajo (menos de tres anillos) y de alto peso molecular Tan soacutelo el naftaleno fenantreno y
antraceno (dos y tres anillos respectivamente) seriacutean considerados HAP de bajo peso
molecular (Cerniglia 1984 1992) La propiedades quiacutemicas de los HAP y por tanto su
destino en el medioambiente depende del nuacutemero de anillos aromaacuteticos que lo componen y
de su tipologiacutea molecular (Kanaly amp Harayama 2000) Por ejemplo el fenantreno y
antraceno son compuestos isoacutemeros (Figura 1) con el mismo peso molecular porque tienen
el mismo nuacutemero de anillos benceacutenicos pero en distinta disposicioacuten lo que les confiere
distintas caracteriacutesticas quiacutemicas En general a medida que aumenta su tamantildeo peso
molecular y angularidad aumenta su hidrofobicidad y estabilidad electroquiacutemica (Zander
1983) Tal y como algunos trabajos han demostrado eacutestos son dos factores primarios que
contribuyen a la persistencia de los HAP en el medio Por ejemplo de acuerdo con
Shuttleworth amp Cerniglia (1995) la vida media en suelos y sedimentos de un HAP de tres
anillos como el fenantreno podriacutea oscilar en un rango de entre 6 a 126 diacuteas mientras que
para moleacuteculas de cuatro a cinco anillos el tiempo aumentariacutea de 229 a maacutes de 1400 diacuteas
Ademaacutes debido a su naturaleza lipofiacutelica tiene un elevado potencial de bioacumulacioacuten en la
cadena troacutefica fenoacutemeno conocido como biomagnificacioacuten (Clements et al 1994) Se sabe
que los HAP ejercen un acusado efecto toacutexico y poseen propiedades mutageacutenicas
teratogeacutenicas y en algunos casos carcinogeacutenicas (Internacional Agency for Research on
Cancer 1972-1990) De hecho dieciseacuteis HAP han sido clasificados como contaminantes
prioritarios por la US Environmental Protection Agency (Agencia de proteccioacuten ambiental
Resumen Antecedentes
15
de Estados Unidos) y por la Comisioacuten Europea de Medio Ambiente (Maliszewska-Kordybach
1996)
Los HAP estaacuten presentes como constituyentes naturales de los combustibles foacutesiles y
se forman durante la combustioacuten incompleta de la materia orgaacutenica Las fuentes naturales
de produccioacuten de HAP son los incendios forestales y de pastizales yacimientos de petroacuteleo
o erupciones volcaacutenicas (Haritash amp Kaushik 2009) Sin embargo las fuentes antroacutepicas
son las que maacutes contribuyen a su formacioacuten mediante la quema de combustibles foacutesiles con
fines energeacuteticos en el tratamiento de la madera con creosota mediante el uso de
lubricantes y en el refino del petroacuteleo y actividades de transporte (Lee et al 1981) Aunque
los vertidos se produzcan en una zona determinada es posible que la carga contaminante
se extienda si alcanza un efluente o mediante su filtracioacuten a traveacutes del suelo pudiendo
alcanzar acuiacuteferos Otras cargas contaminantes se generan por descarga directa
procedentes de efluentes industriales en grandes superficies de suelos o mares o por la
liberacioacuten accidental de materia prima (Kanaly amp Harayama 2000) Se han detectado HAP
en el aire procedente fundamentalmente de la quema industrial de combustibles foacutesiles y el
traacutefico (Koeber et al 1999 Lim et al 1999) en suelos y en la parte superficial y profunda
de la columna de agua y sedimentos (Readman et al 2002 Johnsen et al 2005 2006) En
alimentos vegetales y plantas aparecen como consecuencia de la difusioacuten y posterior
sedimentacioacuten de los HAP atmosfeacutericos sobre la vegetacioacuten (Wagrowski amp Hites 1997) y
por la adsorcioacuten de HAP acumulados en el agua del suelo
El suelo constituye uno de los medios receptores de la contaminacioacuten maacutes sensibles y
vulnerables Sin embargo y auacuten dada la gravedad y extensioacuten creciente de la contaminacioacuten
con HAP no fue hasta la Conferencia de Naciones Unidas sobre el Medio Ambiente y el
Desarrollo celebrada en Riacuteo de Janeiro en 1992 cuando se reconocioacute y planteoacute de forma
trascendente la importancia de la proteccioacuten de los suelos y la definicioacuten de sus usos
potenciales La Agencia Europea de Medio Ambiente (AEMA) estimoacute en 1999 que el
nuacutemero de zonas o aacutereas contaminadas en Europa Occidental estaba entre 300000 y
1500000
Hasta la promulgacioacuten de la Ley 101998 de 21 Abril de Residuos Espantildea careciacutea de
cualquier instrumento normativo para legislar controlar y proteger lo referente a suelos
contaminados Con esta Ley las Comunidades Autoacutenomas son las encargadas de declarar
delimitar e inventariar los suelos contaminados de sus territorios ademaacutes de establecer las
bases para una determinada actuacioacuten Con el Real decreto 92005 del 14 de Enero se da
cumplimiento a lo dispuesto en la 101998 de Residuos y en eacutel se establece la relacioacuten de
actividades potencialmente contaminantes del suelo y los criterios y estaacutendares para la
Resumen Antecedentes
16
declaracioacuten de un suelo bajo la categoriacutea de ldquocontaminadordquo Uno de los aspectos maacutes
importantes desde el punto de vista de la biorremediacioacuten se recoge en el Artiacuteculo 7 del
Real Decreto 92005 por el cual ldquola declaracioacuten de un suelo como contaminado obligaraacute a la
realizacioacuten de las actuaciones necesarias para proceder a su recuperacioacuten ambientalrdquo
Ademaacutes antildeade que las teacutecnicas deben ser las maacutes apropiadas en cada caso garantizando
soluciones de caraacutecter permanente y prioriza las teacutecnicas de tratamiento in situ que eviten la
generacioacuten traslado y eliminacioacuten de residuos
Lo dispuesto en esta ley sin duda supone un enorme impulso a las teacutecnicas de
biorremediacioacuten ya que a traveacutes de ellas se favorece el tratamiento in situ y la recuperacioacuten
del ecosistema a su estadio original sin generacioacuten de residuos y con el menor impacto
ambiental posible
Factores que condicionan la biodegradacioacuten
Aunque la biodegradacioacuten bacteriana es una de las teacutecnicas maacutes eficaces en la
descontaminacioacuten in situ de medios contaminados con HAP la eficacia y tasas de
biodegradacioacuten dependen en gran medida del nuacutemero y tipo de microorganismo
degradador presente en el medio y de la naturaleza y estructura quiacutemica del contaminante a
degradar (Haritash amp Kaushik 2009) Ademaacutes a la hora de disentildear un sistema de
biorremediacioacuten debemos tener en cuenta que existen muacuteltiples factores ambientales que
van a condicionar la eficacia y la rapidez del proceso con el agravante de que durante la
aplicacioacuten in situ es difiacutecil y en algunos casos imposible poder controlar o modificar alguno
de estos factores La biorremediacioacuten es una teacutecnica eficaz y econoacutemica pero cuenta con la
desventaja del tiempo ya que en algunos casos la descontaminacioacuten del medio y su
recuperacioacuten pueden durar antildeos
Por tanto los estudios de optimizacioacuten en los que se combinen todos los factores
posibles considerando los efectos sineacutergicos y antagoacutenicos son esenciales en
biorremediacioacuten Entre los factores ambientales maacutes estudiados en la literatura destacamos
temperatura pH tipo y concentracioacuten de nutrientes inorgaacutenicos y fuentes de carbono
Temperatura y pH
La temperatura es una de las variables maacutes influyentes en el proceso de biodegradacioacuten
bacteriana ya que afecta tanto a las propiedades fisicoquiacutemicas de los HAP como al
Resumen Antecedentes
17
metabolismo microbiano La temperatura guarda una relacioacuten proporcional con los rangos
de difusioacuten y solubilidad de los HAP e inversamente proporcional con el coeficiente de
particioacuten suelo-agua (Wu amp Gschwend 1986) Mientras que el coeficiente de particioacuten de los
HAP decrece entre un 20-30 por cada incremento de 10ordmC en temperaturas comprendidas
entre los 5 ordmC - 45 ordmC el coeficiente de difusioacuten en agua aumenta entre 4-5 veces con un
incremento de la temperatura de 20 a 120 ordmC Esto se traduce en que cuanto menor es la
temperatura menor es la solubilidad de los HAP en la fase acuosa y consecuentemente
menor es su biodisponibilidad para ser mineralizados por los microorganismos (Haritash amp
Kaushik 2009)
Por otro lado las bajas temperaturas afectan negativamente al metabolismo
microbiano ralentizaacutendolo y aumentando la duracioacuten de la fase de latencia en la que hay
inactividad (Atlas amp Bartha 1972 Eriksson et al 2001) Tal y como se ha demostrado en
estudios previos (Leahy amp Colwell 1990) la velocidad de metabolizacioacuten normalmente se
duplica por cada aumento de 10 ordmC en temperaturas comprendidas entre los 10 y 40 ordmC Sin
embargo y a pesar de las desventajas que las bajas temperaturas presentan para la
biodegradacioacuten existe degradacioacuten de hidrocarburos en ambientes friacuteos cuyas temperaturas
oscilan entre los 0 ordmC ndash 10 ordmC (Margesin et al 2002) Algunos trabajos se han centrado en el
estudio de la biodegradacioacuten en zonas de agua marina y suelos bajo temperaturas
extremadamente bajas (Colwell et al 1978 Mohn amp Stewart 2000 Ericksson et al 2001
Delille amp Pelletiere 2002) obteniendo resultados positivos Sin embargo la mayoriacutea de los
estudios de biodegradacioacuten se han llevado a cabo en condiciones de laboratorio en un rango
de temperaturas comprendido entre los 20 ndash 35 ordmC sin observar a penas diferencias en las
tasas de biodegradacioacuten (Chen et al 2008) Por debajo de estas temperaturas la
degradacioacuten es maacutes complicada porque el metabolismo de los microorganismos se ralentiza
y la solubilizacioacuten de los HAP disminuye Aun asiacute hay bacterias adaptadas a estas
condiciones que hacen posible la degradacioacuten en ambientes con temperaturas extremas
Varias especies de Pseudomonas y Sphingomonas se han identificado como bacterias
degradadoras de HAP en la Antaacutertida (Aislabie et al 2000) Eacutestas y otras especies estaacuten
adaptadas a las temperaturas locales y a otras condiciones de estreacutes ya que durante el
deshielo sobreviven en suelos friacuteos y secos pobres en nutrientes y a menudo alcalinos Sin
embargo la capacidad de estas bacterias para crecer en suelos con condiciones climaacuteticas
suaves y la utilizacioacuten de HAP para su crecimiento implica que estas bacterias son
psicrotolerantes (Aislabie et al 2000) cuya temperatura oacuteptima es superior a los 20 ordmC pero
son capaces de sobrevivir cerca o por debajo de los 0 ordmC Ademaacutes existen algunas especies
cuyo crecimiento se desarrolla en ambientes que permanentemente esteacuten por debajo de los
5 ordmC este grupo de bacterias son psicroacutefilas La temperatura es un factor que difiacutecilmente se
puede controlar o manipular en proyectos de aplicacioacuten in situ por lo que es importante
Resumen Antecedentes
18
elaborar un estudio previo bajo las condiciones del ecosistema afectado Esto es
fundamental sobre todo en ambientes con temperaturas bajas en los que se puede estudiar
queacute otros factores modificar para suplir las desventajas de la temperatura como puede ser
inocular cepas bacterianas adaptadas a las bajas temperaturas aumentar el oxiacutegeno o
adicionar nutrientes En estas condiciones no toda la comunidad tiene por queacute ser eficaz en
la degradacioacuten de un contaminante aunque se ha propuesto que las bacterias y no los
hongos son las mayores colonizadoras y degradadoras (Kerry 1990) La identificacioacuten de
las especies de la poblacioacuten autoacutectona asiacute como la refrenciacioacuten de sus capacidades
metaboacutelicas son muy importantes en la biorremediacioacuten de suelos de ambientes friacuteos Esta
cuestioacuten es especialmente importante en la Antaacutertida ya que el Sistema del Tratado
Antaacutertico prohiacutebe la introduccioacuten de organismos aloacutectonos
Por otro lado el pH es un factor abioacutetico que de forma similar a la temperatura puede
afectar significativamente tanto a la actividad y diversidad microbiana como a la
mineralizacioacuten de los HAP Los rangos de pH oacuteptimos para el proceso de metabolizacioacuten
pueden ser muy variables ya que depende de las caracteriacutesticas del medio contaminado y
de la poblacioacuten microbiana que alberga (Dibble amp Bartha 1979) Las micobacterias son
bacterias neutroacutefilas cuyo pH oacuteptimo es superior 6 (Portaels amp Pattyn 1982) Sin embargo
a paritr de este pH se ha observado que la degradacioacuten de HAP por Mycobacterium es maacutes
eficaz cuando el pH tiende ligeramente a aacutecido (65) porque la membrana de aacutecidos
micoacutelicos es maacutes permeable a compuestos hidrofoacutebicos (Kim et al 2005) Otros autores
han mostrado que para otro tipo de bacterias comuacutenmente descritas en procesos de
biodegradacioacuten como Pseudomonas sp el rango oacuteptimo de pH oscila entre 55 y 78
notablemente mejor cuanto maacutes neutro (Dibble amp Bartha 1979) El uso de ciertos
surfactantes puede causar la basificacioacuten del medio (Bautista et al 2009) por lo que este
aspecto debe ser considerado a la hora de disentildear un proceso de biorremediacioacuten Tambieacuten
se pueden generar variaciones de pH durante el proceso como consecuencia de los
metabolitos intermedios derivados de los HAP Por ejemplo al comienzo de la degradacioacuten
se generan metabolitos con grupos hydroxiacutelicos que producen un aumento del pH (Habe amp
Omori 2003 Puntus et al 2008)
Nutrientes inorgaacutenicos
Ante una perturbacioacuten por un contaminante el requerimiento de nutrientes de las bacterias
degradadoras del ecosistema aumenta para poder metabolizar el aporte extra de carbono
que supone el contaminante Por este motivo en biorremediacioacuten es importante encontrar
una relacioacuten oacuteptima de carbononitroacutegenofoacutesforo (CNP) que tradicionalmente se han fijado
Resumen Antecedentes
19
en 100101 (ej Bouchez et al 1995) Sin embargo este aspecto es objeto de controversia
ya que otros autores (Leys et al 2005) han demostrado que la relacioacuten anteriormente
propuesta como oacuteptima puede ser insuficiente limitando el crecimiento bacteriano y por
tanto ralentizando la biodegradacioacuten La bioestimulacioacuten es una teacutecnica de biorremediacioacuten
que consiste en la adicioacuten de nutrientes inorgaacutenicos a los substratos contaminados La
disponibilidad de nutrientes es un aspecto muy importante en la eficacia de la
biodegradacioacuten Nutrientes como el nitroacutegeno el foacutesforo o el hierro son esenciales para el
metabolismo bacteriano en general y mucho maacutes en el caso de biorremediacioacuten de medios
contaminados por HAP Aunque la mayoriacutea de los trabajos indican que la adicioacuten de
nutrientes mejora el proceso algunos autores (Yu et al 2005) obtuvieron resultados
opuestos La diferencia entre unos resultados y otros radican en que la necesidad de
nutrientes depende del tipo de bacteria tipo de hidrocarburo y de las condiciones del medio
(Leys et al 2005) El hierro es un nutriente esencial necesario en el proceso de
biodegradacioacuten ya que por un lado es cofactor de las enzimas que catalizan la oxidacioacuten de
los HAP y por otro se ha relacionado con la produccioacuten de biosurfactantes para potenciar la
solubilidad de los HAP (Wei et al 2003) Sin embargo determinar la proporcioacuten oacuteptima de
este nutriente es fundamental pues altas concentraciones pueden ser toacutexicas (Santos et al
2008) Es tambieacuten una cuestioacuten a considerar la forma en la que se adicionan o se
encuentran los nutrientes en el medio ya que condiciona su biodisponibilidad Asiacute algunos
autores (Schlessinger 1991) proponen que las formas oxidadas como nitratos son maacutes
solubles que las formas reducidas como amonio que ademaacutes tiene propiedades
adsorbentes Establecer si un determinado problema medioambiental requiere un aporte
exoacutegeno de nutrientes es por tanto una cuestioacuten a discutir que probablemente dependa de
otras variables bioacuteticas y abioacuteticas
Fuentes de carbono laacutebiles
La adicioacuten a un medio contaminado de otras fuentes de carbono faacutecilmente biodegradables
se considera una alternativa que puede favorecer la biodegradacioacuten porque aumenta la
biomasa de la poblacioacuten microbiana y por tanto de la poblacioacuten degradadora Realmente se
puede entender como una forma de bioestimulacioacuten enfocada a aumentar y estimular el
crecimiento bacteriano o su actividad y por consiguiente la degradacioacuten Algunas de las
sustancias tratadas con este fin son el piruvato que estimula el crecimiento de ciertas cepas
bacterianas o el salicilato que induce la activacioacuten de enzimas degradadoras En el caso de
la glucosa su raacutepida asimilacioacuten y aumento de biomasa asociado se podriacutea traducir en un
aumento de la biodegradacioacuten (Ye et al 1996) Lee et al (2003) propusieron y
comprobaron que el piruvato potenciaba el crecimiento de la cepa degradadora
Resumen Antecedentes
20
Pseudomonas putida lo que se tradujo en un aumento de la tasa de biodegradacioacuten de
naftaleno Chen amp Aitken (1999) han comprobado que el salicilato induce la siacutentesis de
enzimas cataboacutelicas y por tanto su adicioacuten favorece la metabolizacioacuten de HAP siempre
que su concentracioacuten en el medio no supere una concentracioacuten liacutemite inhibitoria Wong et al
(2000) observoacute que la adicioacuten de glucosa favoreciacutea el crecimiento total de la poblacioacuten pero
las tasas de biodegradacioacuten fueron significativamente menores Estos resultados se deben
a que la cepa o consorcio degradador es capaz de mineralizar un HAP como uacutenica fuente de
carbono y la asimilacioacuten de glucosa inhibe la siacutentesis de enzimas implicadas en la
degradacioacuten del contaminante Es necesario valorar en cada caso de estudio coacutemo afecta la
adicioacuten de una nueva fuente de carbono ya que en el caso de bacterias no pre-adaptadas a
degradar HAP es posible que sus efectos sean positivos (Wong et al 2000) pero en
poblaciones microbianas histoacutericamente adaptadas a substratos contaminados la adicioacuten de
glucosa puede favorecer el crecimiento de microorganismos heteroacutetrofos no degradadores
Importancia y efecto de los surfactantes en la biodegradacioacuten de HAP
La baja solubilidad de los HAP y de la mayoriacutea de los compuestos del petroacuteleo limita la
capacidad de los microorganismos para acceder y degradar los compuestos contaminantes
Los surfactantes son tensioactivos que actuacutean disminuyendo la tensioacuten superficial del agua
para facilitar la disolucioacuten de los HAP en la fase acuosa En algunos estudios (Bautista et al
2009) se ha demostrado que el uso de surfactantes en procesos de biodegradacioacuten es
necesario para solubilizar los HAP Muchas bacterias degradadoras de HAP han
desarrollado la capacidad de generar biosurfactantes (surfactantes de origen microbiano)
como parte de su superficie celular o como moleacuteculas liberadas extracelularmente (Fiechter
1992) Algunas de estas especies pertenecen a los geacuteneros Pseudomonas (P aeruginosa
P fluorescens) Rhodococcus Mycobacterium Lactobacillus Acinetobacter o
Sphingomonas Los biosurfactantes se clasifican en funcioacuten de su masa molecular en
biosurfactantes de bajo peso molecular como glicoliacutepidos o lipopeacuteptidos y de alto peso
molecular que incluyen moleacuteculas maacutes complejas como polisacaacuteridos anfipaacuteticos proteiacutenas
lipopolisacaacuteridos y lipoproteiacutenas Se han observado resultados muy contradictorios en
cuanto a sus efectos sobre las tasas de biodegradacioacuten por un lado positivos (Jing et al
2007) pero tambieacuten inhibitorios (Laha amp Luthy 1991) Los biosurfactantes de alto peso
molecular son eficaces en la estabilizacioacuten de emulsiones de aceite en agua mientras que
los de bajo peso molecular son maacutes eficaces en la disminucioacuten de la tensioacuten interficial y
superficial (Rosenberg amp Ron 1999) En el caso de los surfactantes sinteacuteticos su eficacia
estaacute determinada por sus propiedades de carga (no ioacutenicos anioacutenicos o catioacutenicos) su
balance hidrofiacutelico-lipofiacutelico y su concentracioacuten micelar criacutetica (CMC) concentracioacuten a la cual
Resumen Antecedentes
21
la tensioacuten superficial es miacutenima y los monoacutemeros de surfactante se agregan formando
micelas Sin embargo algunos surfactantes pueden inhibir la mineralizacioacuten de los HAP por
cuestiones como la toxicidad del medio derivada de una elevada concentracioacuten de
surfactantes la cual resulta toacutexica para los microorganismos (ej Tergitol NP-10) o porque
al solubilizarse los HAP por accioacuten del surfactante aumenta toxicidad del medio (Liu et al
2001) En algunos casos ademaacutes los surfactantes no son biodegradables (Bautista et al
2009) De hecho Bautista et al (2009) comprobaron que el surfactante no ioacutenico Tergitol
NP-10 es un surfactante no biodegradable y toacutexico para los microorganismos en
comparacioacuten con el Tween-80 Dada la amplia variabilidad de resultados referentes a los
surfactantes es importante la eleccioacuten correcta en cada proceso considerando el tipo de
contaminante a eliminar y los microorganismos presentes en el medio
Biodegradacioacuten bacteriana cepas y consorcios microbianos degradadores de HAP
Son muchas las especies bacterianas descritas con capacidad degradadora de HAP la
mayoriacutea de ellas aisladas de aguas sedimentos y suelos previamente contaminados con
hidrocarburos La biodegradacioacuten de HAP de bajo peso molecular como el naftaleno
fenantreno y antraceno ha sido ampliamente estudiada Sin embargo son escasos los
estudios realizados sobre la biodegradacioacuten de HAP de alto peso molecular como el pireno
perileno acenafteno o fluoreno (Kanaly amp Harayama 2000) De acuerdo con Chauhan et al
(2008) especies de Pseudomonas y Ralstonia se relacionan en mayor medida con la
degradacioacuten de naftaleno y fenantreno Burkolderia y Stenotrophomonas con naftaleno
fenantreno y antraceno y otras especies pertenecientes a los geacuteneros Rhodococcus
Sphingomonas y Mycobacterium con HAP de mayor peso molecular como fluoranteno
benzo[a]pireno pireno benzo[b]fluoranteno Las especies bacterianas degradadoras
pertenecen a grupos filogeneacuteticos muy diversos y en muchos casos taxonoacutemicamente
alejados Trabajos previos (Vintildeas et al 2005 Molina et al 2009 Gonzaacutelez et al 2011)
muestran una gran parte de las bacterias degradadoras pertenecen al phylum
Proteobacteria en mayor proporcioacuten a las clases α- Proteobacteria (Sphingomonas
Bradyrizobium Nitrobacteria Balneimonas) y γ- (Pseudomonas Stenotrhophomonas
Enterobacter Pantoea Acinetobacter o Psychrobacter) Tambieacuten se han aislado especies
pertenecientes a la clase β- Proteobacterias (Ralstonia) y a los phylum Actinobacteria
(Microbacterium sp Rhodococcus sp) Firmicutes (Bacillus subtillis) y Bacteroidetes
(Flexibacter) aunque eacutestas en menor frecuencia Muchos de los trabajos de degradacioacuten
bacteriana se han realizado con cepas individuales (Grimberg et al 1996 Das amp Mukherjee
2006) extraiacutedas de suelos contaminados o bien con consorcios artificiales formados por
varias cepas degradadoras (Ghazali et al 2004) siendo muy pocos aquellos en los que se
Resumen Antecedentes
22
ha utilizado un consorcio bacteriano natural extraiacutedo directamente de un suelo Bautista et al
(2009) sentildeala que la capacidad de degradacioacuten de un consorcio artificial es mayor que la de
las cepas individuales Seguacuten algunos autores (Fritsche 1985 Mueller et al 1997) la mejor
eficiencia de degradacioacuten de un consorcio es debido a que la diversidad de especies permite
que cada una tenga un papel en el proceso de biodegradacioacuten facilitando la degradacioacuten de
HAP gracias al cometabolismo establecido entre las especies implicadas
Existe una importante controversia referente a la capacidad degradadora que
presentan los consorcios naturales ya que se ha observado que ciertos consorcios
extraiacutedos de zonas no contaminadas con HAP son capaces de metabolizar dichos
compuestos (Tian et al 2008 Couling et al 2010) Seguacuten estos autores es una
caracteriacutestica general presente en algunas comunidades microbianas que se expresa ante
una determinada perturbacioacuten Sin embargo Barkay amp Pritchart (1988) exponen que es una
caracteriacutestica que soacutelo estaacute presente en comunidades previamente expuestas y por lo tanto
preadaptadas como consecuencia de presiones selectivas Algunos autores (Jhonsen et al
2005) subrayan que la capacidad cataboacutelica se propaga faacutecilmente entre bacterias de un
mismo suelo contaminado como resultado de la transferencia horizontal de genes (ej
conjugacioacuten y transformacioacuten) Esto facilitariacutea auacuten maacutes que una comunidad no preadaptada
pueda hacer frente a una perturbacioacuten
Teacutecnicas de biorremediacioacuten
El objetivo uacuteltimo de la biorremediacioacuten es que el proceso de biodegradacioacuten se desarrolle
de la forma maacutes eficaz posible y por eso muchos trabajos se centran en la optimizacioacuten del
proceso mediante el desarrollo de teacutecnicas que aumenten la eficacia del mismo Teacutecnicas
como la bioestimulacioacuten anteriormente mencionada se centran en aumentar la capacidad
degradadora de la comunidad autoacutectona bacteriana mediante la adicioacuten de nutrientes
(nitroacutegeno foacutesforo potasio) de forma que la falta de nutrientes no suponga una limitacioacuten
para el metabolismo microbiano y por consiguiente para la biorecuperacioacuten de la zona
perturbada Otras teacutecnicas se basan en el aumento de la poblacioacuten degradadora mediante la
adicioacuten de cepas o consorcios con capacidad reconocida para metabolizar un determinado
compuesto es lo que se conoce como bioaumento En algunos trabajos los resultados
derivados de la bioestimulacioacuten y el bioaumento han sido positivos (Mills et al 2004
Atagana 2006) pero en trabajos como Chen et al (2008) o Yu et al (2005) los efectos de
ambas teacutecnicas en el proceso fueron negativos o simplemente no tuvieron efecto Se tiene
que tener en cuenta que ambas teacutecnicas generan cambios en las comunidades autoacutectonas
que afectan y modifican las relaciones de competencia Estos cambios pueden ser auacuten maacutes
Resumen Antecedentes
23
acusados en el caso del bioaumento pues la introduccioacuten de una comunidad foraacutenea puede
tener resultados difiacuteciles de predecir La atenuacioacuten natural es otra teacutecnica basada en la
mera actuacioacuten de la comunidad autoacutectona sin ninguacuten tipo de modificacioacuten de la comunidad
yo adicioacuten de sustancias Dowty et al (2001) entre otros defiende que cuando se trata de
restablecer el medio a las condiciones originales preservando la biodiversidad la
atenuacioacuten microbiana puede ser la mejor opcioacuten siempre que las poblaciones autoacutectonas
presenten capacidad degradadora
Resumen Objetivos
25
Objetivos
El objetivo general de la tesis es el conocimiento profundo de la biodegradacioacuten bacteriana
de hidrocarburos aromaacuteticos policiacuteclicos para la biorremediacioacuten y recuperacioacuten de medios
contaminados con estos compuestos toacutexicos El proyecto se ha centrado en la identificacioacuten
y conocimiento de la poblacioacuten bacteriana de consorcios procedentes de ambientes
(contaminados o no) y de su dinaacutemica ante determinadas condiciones durante el proceso de
biodegradacioacuten Para alcanzar este objetivo principal se fijaron objetivos especiacuteficos
desarrollados en cuatro capiacutetulos
1 Estudiar los factores abioacuteticos a fin de optimizar las condiciones de desarrollo en el
proceso de biodegradacioacuten de HAP en cultivos liacutequidos (capiacutetulo 1a) En un segundo
proyecto de optimizacioacuten el objetivo fue asemejar el proceso en laboratorio lo maacutes
posible a las condiciones naturales considerando los efectos derivados de la
interaccioacuten muacuteltiple de factores ambientales y bioloacutegicos (capiacutetulo 1b)
2 Analizar el efecto de la aplicacioacuten de distintos tipos de surfactantes (no ioacutenicos
biodegradables y no biodegradables) en la eficacia de degradacioacuten de HAP de un
consorcio bacteriano previamente adaptado (C2PL05) Asiacute mismo se quiso estudiar el
efecto del tipo de surfactante en la sucesioacuten y dinaacutemica del consorcio identificando los
microorganismos implicados a lo largo del proceso (capiacutetulo 2)
3 Estimar la capacidad degradadora de microcosmos inoculados con consorcios
procedentes de suelos con distinta historia de contaminacioacuten suelo croacutenicamente
contaminado (C2PL05) frente a un suelo procedente de un ambiente libre de
contaminacioacuten (BOS08) bajo condiciones climaacuteticas suaves y extremas Describir y
comparar las comunidades bacterianas que componen ambos consorcios (capiacutetulo 3)
4 Evaluar la eficacia de diversas teacutecnicas de biorremediacioacuten (atenuacioacuten natural
bioestimulacioacuten yo bioaumento) tanto en la eliminacioacuten del contaminante y la
toxicidad como en la capacidad de recuperacioacuten del ecosistema (capiacutetulo 4) Para el
desarrollo de este objetivo se llevoacute a cabo una simulacioacuten a pequentildea escala
(microcosmos) de un proceso de biorremediacioacuten in situ de suelos naturales
contaminados con creosota
Resumen Listado de manuscritos
27
Listado de manuscritos
Los capiacutetulos que integran este proyecto doctoral han sido redactados en ingleacutes para su
publicacioacuten en revistas cientiacuteficas de aacutembito internacional Por ello se presentan los
manuscritos originales de dichos artiacuteculos A continuacioacuten se detalla la traduccioacuten del tiacutetulo
los nombres de los coautores y el estado de publicacioacuten de los manuscritos
Capiacutetulo 1a Simarro R Gonzaacutelez N Bautista LF Sanz R y Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene
and anthracene) biodegradation process by a bacterial consortium
Water Air and Soil Pollution (2011) 217 365-374
Capiacutetulo 1b Simarro R Gonzaacutelez N Bautista LF y Molina MC
Evaluation of the influence of multiple environmental factors on the
biodegradation of dibenzofuran phenanthrene and pyrene by a bacterial
consortium using an orthogonal experimental design
Water Air and Soil Pollution (Aceptado febrero 2012)
Capiacutetulo 2 Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L y Villa
JA
Effect of surfactants on PAH biodegradation by a bacterial consortium and
on the dynamics of the bacterial community during the process
Bioresource Technology (2011) 102 9438-9446
Capiacutetulo 3 - Simarro R Gonzaacutelez N Bautista LF y Molina MC
High molecular weight PAH biodegradation by a wood degrading
consortium at low temperatures
FEMS Microbiology Ecology (Subscrito Diciembre 2011 En revisioacuten)
Resumen Listado de manuscritos
28
Capiacutetulo 4 - Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez L y Peacuterez
M
Assessment the efficient of bioremediation techniques (biostimulation
bioaugmentation and natural attenuation) in a creosote polluted soil
change in bacterial community
Manuscrito ineacutedito
Resumen Siacutentesis de capiacutetulos
29
Siacutentesis de capiacutetulos
La presente tesis doctoral se desarrolla dentro de un proyecto de investigacioacuten basado en la
biorremediacioacuten de suelos contaminados con hidrocarburos aromaacuteticos policiacuteclicos y
sustancias contaminantes que los contengan Este proyecto se esta llevando a cabo desde
hace seis antildeos por el grupo de Biorremediacioacuten del Departamento de Biologiacutea y Geologiacutea de
la Universidad Rey Juan Carlos Los artiacuteculos citados anteriormente componen los cuatro
capiacutetulos que se desarrollan en el cuerpo de la tesis
Anteriormente al desarrollo de los experimentos que componen los capiacutetuos de la
presente tesis se realizoacute un trabajo (Molina et al 2009) en el que se estudioacute la capacidad
de degradacioacuten de un consorcio bacteriano extraiacutedo de un suelo croacutenicamente contaminado
y se describioacute su poblacioacuten bacteriana mediante teacutecnicas dependientes e independientes de
cultivo El consorcio fue capaz de degradar los HAP (naftaleno fenantreno y antraceno) en
maacutes de un 98 en un periodo de 18 diacuteas y ademaacutes eliminoacute completamente la toxicidad del
medio en 41 diacuteas La identificacioacuten molecular permitioacute aislar e identificar 5 cepas bacteriana
(DIC-1 a DIC-6 DIC Degrading isolated Culture) todas γ-Proteobacterias pertenecientes a
los geacuteneros Enterobacter Pseudomonas y Stenotrophomonas (maacutes detalles en Molina et al
2009) Ademaacutes el anaacutelisis de la poblacioacuten mediante electroforesis en un gel con gradiente
desnaturalizante (DGGE Denaturing Gradient Gel Electrophoresis) confirmoacute que estos tres
geacuteneros eran dominantes La alta eficacia en la degradacioacuten de los HAP y la escasa
biodiversidad tiacutepica de suelos sometidos a elevadas concentraciones de contaminantes
durante largos peridos de tiempo indican que el consorcio C2PL05 estaacute totalmente
adaptado a la degradacioacuten de HAP
En el capiacutetulo 1 se optimizoacute el proceso de biodegradacioacuten a traveacutes de dos disentildeos
experimentales diferentes que se recogen en los subcapiacutetulos 1a y 1b En el capiacutetulo 1a
se evaluacutea y mejora la influencia de varios factores ambientales como la relacioacuten molar de
CNP la fuente de nitroacutegeno fuente y concentracioacuten de hierro pH y fuente de carbono El
anaacutelisis estadiacutestico de las tasas de degradacioacuten (Kb) y los incrementos de la densidad celular
indicoacute que todos los factores fueron significativamente influyentes en la Kb Esto permitioacute
establecer un valor oacuteptimo de estos factores y descartar en los siguientes ensayos aquellos
paraacutemetros como el pH cuyo valor oacuteptimo (pH 7) seguacuten nuestros resultados coincidiacutea con
otros estudios y estaba claramente definido en la bibliografiacutea A partir de los resultados de
esta primera parte se realizoacute un segundo ensayo de optimizacioacuten ortogonal multifactorial
(capiacutetulo 1b) que permitioacute la optimizacioacuten de 8 factores de forma conjunta La concentracioacuten
de surfactante y de inoacuteculo bacteriano son dos factores que no fueron incluiacutedos en el
anterior anaacutelisis pero a traveacutes de la bibliografiacutea se consideraron factores importantes en la
Resumen Siacutentesis de capiacutetulos
30
biodegradacioacuten de HAP Los resultados confirmaron que la temperatura la fuente de
carbono y la concentracioacuten de inoacuteculo fueron factores significativos en el incremento de la
densidad celular pero soacutelo la fuente de carbono influyoacute significativamente el porcentaje total
de degrad acioacuten Estos resultados (capiacutetulo 1) permitieron conocer cuaacuteles son las
condiciones oacuteptimas del cultivo para una degradacioacuten maacutes eficaz de HAP con el consorcio
bacteriano C2PL05
El uso de surfactantes en la biodegradacioacuten de HAP puede optimizar la eficacia del
proceso y en algunos casos su uso es imprescindible Sin embargo su utilizacioacuten implica
un elevado coste y en ocasiones pueden tener efectos negativos dependiendo de la
concentracioacuten y tipo de surfactante En el capiacutetulo 2 se evaluacutea el efecto de dos
surfactantes no ioacutenicos Tergitol NP-10 (no biodegradable) y Tween-80 (biodegradable) en
la capacidad degradadora del consorcio microbiano C2PL05 teniendo en cuenta la
velocidad de degradacioacuten de los HAP y la dinaacutemica de la poblacioacuten microbiana durante el
proceso (teacutecnicas cultivo-dependientes e independientes) La degradacioacuten bacteriana de
los HAP y la reduccioacuten de la toxicidad del medio fue significativamente mejor con el
surfactante no ioacutenico y biodegradable Tween-80 Ademaacutes el tipo de surfactante utilizado
para optimizar la biodegradacioacuten de HAP afectoacute significativamente a la dinaacutemica de la
comunidad bacteriana del consorcio siendo especies pertenecientes a los geacuteneros
Pseudomonas Sphingomonas Sphingobium y Agromonas responsables de estas
diferencias Teoacutericamente la uacutenica funcioacuten del surfactante en el proceso de
biodegradacioacuten es aumentar la solubilidad de los HAP pero sin embargo en este capiacutetulo
se ha puesto de manifiesto que modifican notablemente las poblaciones bacterianas y la
sucesioacuten de especies pudiendo afectar a la eficacia del proceso Un estudio previo que
desemboque en la eleccioacuten del surfactante maacutes adecuado asiacute como su concentracioacuten
favorece la efiacacia de la biorremediacioacuten
El capiacutetulo 3 se centra en el estudio de la capacidad degradadora de los
microorganismos El principal objetivo es comprobar si la capacidad de degradacioacuten se
adquiere necesariamente tras un periodo de exposicioacuten a un contaminante o si bien es una
caracteriacutestica intriacutensecamente presente en algunas bacterias Se considera que la
temperatura es uno de los factores maacutes influyentes en el proceso de biodegradacioacuten de
manera que a temperaturas friacuteas (lt15 ordmC) o extremas (lt5 ordmC) se dificulta el proceso porque
afecta a la solubilidad de los HAP y al metabolismo microbiano Sin embargo existen
especies que toleran o estaacuten adaptadas a las bajas temperaturas y que ademaacutes pueden
degradar HAP En este capiacutetulo se avaluoacute la capacidad degradadora de un consorcio
preadaptado a HAP (C2PL05) frente a un consorcio extraiacutedo de una zona priacutestina rica en
madera en descomposicioacuten (BOS08) Al mismo tiempo se simularon dos ambientes de
Resumen Siacutentesis de capiacutetulos
31
biodegradacioacuten uno a temperaturas suaves comprendidas entre los 15 ordmC-25 ordmC y otro maacutes
extremo con temperaturas entre los 5 ordmC-15 ordmC todo ello en un sustrato soacutelido (suelo) con
objeto de ajustarnos a las condiciones naturales Sin duda el resultado maacutes significativo fue
que el consorcio BOS08 no adaptado a la degradacioacuten de HAP fue capaz de degradar
eficazmente e incluso mejor que el consorcio C2PL05 cuando las temperaturas fueron bajas
Ademaacutes se observoacute que aunque hubo geacuteneros exclusivos de cada consorcio (Ralstonia
Bacillus) otros fueron comunes en ambos (Microbacterium Acinetobacter Pseudomonas)
Los resultados obtenidos confirman la hipoacutetesis de que la capacidad de degradacioacuten estaacute
presente de forma intriacutenseca en algunas especies y no depende de una pre-exposicioacuten al
contaminante
En la biorremediacioacuten de un suelo contaminado con HAP es muy importante tener en
cuenta la respuesta de la poblacioacuten bacteriana autoacutectona del suelo frente a un episodio de
contaminacioacuten En el capiacutetulo 4 se estudioacute el comportamiento de la comunidad bacteriana
de un suelo previamente no contaminado cuando es perturbado con creosota La
biorremediacioacuten in situ es un proceso maacutes complejo que cuando se estudia bajo condiciones
controladas de laboratorio ya que hay factores como la escasez de nutrientes o las bajas
temperaturas que dificultan el proceso (capiacutetulos 1 y 3) Sin embargo la aplicacioacuten de
tratamientos in situ como la bioestimulacioacuten o el bioaumento pueden mejorar la eficacia de la
biorremediacioacuten En este capiacutetulo se determinoacute la respuesta de la comunidad bacteriana
frente a la bioestimulacioacuten el bioaumento o a la atenuacioacuten natural evaluando el porcentaje
de degradacioacuten de creosota y los HAP que la componen la reduccioacuten de la toxicidad y al
mismo tiempo estudiando los cambios poblacionales El criterio para la eleccioacuten de la
teacutecnica maacutes eficaz se determinoacute en funcioacuten de la eficacia en la degradacioacuten y en la
reduccioacuten de la toxicidad Los resultados mostraron que aunque la creosota se redujo
considerablemente y sin diferencias significativas entre tratamientos la toxicidad del medio
permanecioacute alta durante todo el proceso La ausencia de diferencias significativas entre
tratamientos en cuanto a la eliminacioacuten de creosta se refiere indica que la comunidad
autoacutectona del suelo tiene mcroorgasnimos con capacidad degradadora aunque previamente
no hayan estado expuestos a HAP Las bajas temperaturas a las que se desarrolloacute el
experimento fue la causa de que la toxicidad del medio no se redujera Cabe destacar la
importancia de las identificaciones mediante teacutecnicas no cultivables de especies
pertenecientes a los geacuteneros Balneimonas y Pantoea previamente no descritas en procesos
de biodegradacioacuten de creosota o HAP
Resumen Metodologiacutea general
33
Metodologiacutea general
Todos los materiales y meacutetodos estaacuten descritos y con sus respectivas refrencias en cada
uno de los capiacutetulos que se indican a continuacioacuten Sin embargo en algunos casos y dado
que la publicacioacuten de los datos en muchos casos obliga a ajustarse a los formatos de cada
revista especializada algunos meacutetodos no se han explicado en detalle en los capiacutetulos Este
apartado ldquoMetodologiacutea generalrdquo tiene como objetivo profundizar en el fundamento de
algunos de los meacutetodos utilizados durante el desarrollo de este proyecto
Preparacioacuten de consorcios bacterianos
El consorcio bacteriano C2PL05 fue utilizado en los experimentos de los capiacutetulos que
componen esta tesis como consorcio degradador de HAP Este consorcio fue extraiacutedo de un
suelo croacutenicamente contaminado con HAP (Figura 2A) de una refineriacutea de petroacuteleo situada
en Puertollano Ciudad Real (Espantildea) Su capacidad degradadora se verificoacute en un cultivo
semicontinuo en matraces Erlenmeyer de 100 ml que conteniacutean 50 ml BHB con Tween-80
(1 vv) y naftaleno fenantreno (05 gmiddotlminus1) y antraceno (005 gmiddotlminus1) realizando refrescos del
medio cada 15 diacuteas
Cuando se indique (capiacutetulo 3) se preparoacute un consorcio de un suelo procedente de un
bosque (43ordm 4175acuteN 8ordm 0683acuteO Frgas do Eume Galicia Espantildea Figura 2B) totalmente
libre de contaminacioacuten por HAP al que se denominoacute BOS08 El suelo se obtuvo de la parte
maacutes superficial por lo que teniacutea un alto contenido en materia orgaacutenica y restos de madera
muerta
Figura 2 Suelo contaminado procedente de la refineriacutea (A) y suelo
procedente de bosque (B) de los cuales se extrajeron los consorcios
C2PL05 y BOS08 respectivamente
A B
Resumen Metodologiacutea general
34
Para la extraccioacuten de ambos consorcios bacterianos 1 g de suelo se resuspendioacute en
10 ml de solucioacuten salina PBS (pH 70) y se mantuvo en agitacioacuten constante a 150 rpm en
oscuridad y a 25ordmC durante 24 horas Posteriormente se formoacute un cultivo madre de cada
consorcio en 50 ml de BHB con la mezcla de HAP que se fuera a utilizar en el experimento
tween-80 (1 vv) como surfactante y 15 ml del extracto de cada consorcio Los cultivos se
incubaron en un agitador orbital a 150 rpm y 25ordmC hasta que alcanzara la fase exponencial
En este momento se inoculaba la cantidad de cultivo madre necesario en los microcosmos
de los experimentos en funcioacuten de la concentracioacuten de inoacuteculo deseada en los mismos
Disentildeos experimentales
En este apartado se explica el disentildeo y la composicioacuten de los experimentos que conforman
los capiacutetulos de esta tesis para facilitar su comprensioacuten Generalizando los capiacutetulos 1 (1a y
1b) y 2 tratan de optimizar el medio nutritivo suministrado al consorcio C2PL05 el tipo y
concentracioacuten de surfactante y otros factores ambientales para lo cual los microcosmos
eran cultivos liacutequidos incubados en Erlenmeyers en un agitador orbital Los capiacutetulos 3 y 4
se centran en el estudio de la biodegradacioacuten de HAP en sustrato soacutelido (arena de riacuteo y
suelo natural respectivamente) para reproducir en la medida de los posible las condiciones
naturales
En el capiacutetulo 1a se optimizaron 6 factores (3 posibles valores cada factor) de forma
individual y consecutiva En total se desarrollaron 18 tratamientos en cultivos liacutequidos (3
reacuteplicas) incubados en un agitador orbital a 150 rpm 25 ordmC y oscuridad (Figura 3) durante
168 horas En el capiacutetulo 1b el disentildeo ortogonal L18 (37) (21) permitioacute mediante el desarrollo
de 18 tratamientos (3 reacuteplicas cada uno) la optimizacioacuten de 8 factores 7 de ellos con 3
posibles valores (37) y un factor con dos valores (21) Un total de 54 cultivos se incubaron
durante 159 horas en las mismas condiciones que en el capitulo 1a variando la temperatura
seguacuten las necesidades del tratamiento En la Figura 4 y 5 se muestran los disentildeos
experimentales correspondientes a los capiacutetulos 1a y 1b respectivamente
Resumen Metodologiacutea general
35
Figura 3 Cultivos liacutequidos incubados en un agitador orbital
Optimizacioacuten
CNP
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
100101
1002116
100505
Optimizacioacuten
fuente de N
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
NaNO3
NH4NO3
(NH4)2SO3
Optimizacioacuten
fuente de Fe
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
FeCl3
Fe(NO3)3
Fe2(SO4)3
Optimizacioacuten
[Fe]
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
005 mM
01 mM
02 mM
Optimizacioacuten
pH
BHB tween-80
C2PL05Naftaleno fenantreno
antraceno
X 3
50
70
80
Optimizacioacuten
fuente de C
BHB tween-80
C2PL05
Naftaleno fenantreno
antraceno y glucosa (20 80 100)
X 3
HAP
HAPglucosa (5050)
Glucosa
2ordm 3ordm
4ordm 5ordm 6ordm
Figure 4 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 1a
Resumen Metodologiacutea general
36
Tordf
Optimizacioacuten CNP
OptimizacioacutenFuente N
OptimizacioacutenFuente Fe
Optimizacioacuten[Fe]
Optimizacioacuten[Tween-80]
Optimizacioacutendilucioacuten inoacuteculo
Optimizacioacutenfuente de C
20ordmC25ordmC30ordmC
1001011002116100505
NaNO3
NH4NO3
(NH4)2SO3
FeCl3Fe(NO3)3
Fe2(SO4)3
005 mM01 mM02 mM
CMC20 CMC
10-1
10-2
10-3
0100505020100
18 tratamientos
X 3
C2PL05Antraceno dibenzofurano pireno
BHB (modificado seguacuten tratamiento)
Figura 5 Disentildeo experimental correspondiente a al experimento que conforma el capiacutetulo 1b
En el capiacutetulo 2 se estudioacute la capacidad de degradacioacuten y la evolucioacuten del consorcio
C2PL05 en dos tratamientos (cada uno en triplicado) uno adicionado con Tween-80 y otro
con Tergitol NP-10 (1 vv) como surfactantes En total 6 cultivos liacutequidos se incubaron a
150 rpm 25 ordmC y oscuridad durante 45 diacuteas como se muestra en la Figura 3 El disentildeo
experimental de este capiacutetulo se resume graacuteficamente en la Figura 6
Tratamiento 1con Tween-80
Tratamiento 2con Tergitol NP-10
C2PL05BHB-Tergitol NP-10 (1)Naftaleno fenantreno antraceno
X 3
X 3
C2PL05BHB-Tween-80 (1)Naftaleno fenantreno antraceno
Figura 6 Disentildeo experimental correspondiente al experimento que conforma
el capiacutetulo 2
Resumen Metodologiacutea general
37
El capiacutetulo 3 se desarrolloacute en microcosmos con 90 g de arena de riacuteo esterilizada
(Figura 7) e incinerada en una mufla a 300 ordmC para eliminar cualquier tipo de
microorganismos o materia orgaacutenica que pudiera contener Se realizaron 4 tratamientos
distintos en funcioacuten de la temperatura de incubacioacuten (5-15 ordmC o 15-25 ordmC) y del consorcio
inoculado (C2PL05 o BOS08) cada tratamiento con tres reacuteplicas para cada uno de los 5
tiempos de muestreo lo que supuso un total de 60 microcosmos (Figura 8) Los nutrientes
se suministraron antildeadiendo 18 ml de medio BHB que proporcionaba una humedad relativa
del 60 y que ademaacutes conteniacutea Tween-80 (1 vv) Los microcosmos se inocularon con
35 ml de un cultivo madre del consorcio C2PL05 oacute BOS08 y se incubaron en caacutemaras bajo
condiciones controladas de temperatura (seguacuten tratamiento) humedad (60 constante) y
luz (16 horas de luz8 horas oscuridad)
Figura 7 Microcosmos del experimento para el capiacutetulo 3 en caacutemara de crecimiento
Resumen Metodologiacutea general
38
Tratamiento 1
Tratamiento 2
Tratamiento 3
Tratamiento 4
C2PL0515-25ordmCBHB oacuteptimoNaftaleno fenantreno antracenopireno y perileno
C2PL055-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS0815-25ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
BOS085-15ordmCBHB oacuteptimoNaftaleno fenantreno antraceno pireno y perileno
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
Arena esterilizada +
X 3
X 3
X 3
X 3
X 5 tiempos
X 5 tiempos
X 5 tiempos
X 5 tiempos
TOTAL = 60 MICROCOSMOS
Figura 8 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 3
El experimento que compone el capiacutetulo 4 de biorremediacioacuten in situ se desarrolloacute
bajo condiciones ambientales externas en una zona del campus preparada para ello Como
sustrato se utilizoacute suelo natural extraiacutedo de los primeros 20 cm y tamizado con una maya lt
2 mm El sustrato se depositoacute en bandejas de plaacutestico para evitar que el agente
contaminante se filtrara al suelo y se protegioacute de la lluvia tal y como se observa en la Figura
9 Cada uno de los cinco tratamientos (control atenuacioacuten natural bioestimulacioacuten
bioaumento y bioestimulacioacuten junto con bioaumento) se hizo en duplicado para cada uno de
los 4 muestreos realizados durante los 8 meses de experimentacioacuten (octubre-junio) Cada
microcosmos (bandeja) conteniacutea 550 g de suelo humedecidos (40) con agua o BHB como
fuente de nutrientes en el caso de los tratamientos con bioestimulacioacuten Los tratamientos
bioaumentados se enriquecieron con 5 ml de un cultivo madre del consorcio C2PL05 Como
agente contaminante se utilizoacute creosota antildeadiendo 25 ml de una disolucioacuten de creosota en
Resumen Metodologiacutea general
39
n-hexano (25 g creosota por bandeja) a todos los tratamientos excepto al control Resumen
del disentildeo en la Figura 10
Figura 9 Experimento para el capiacutetulo 4 bajo condiciones ambientales
externas en el Campus de la Universidad Rey Juan Carlos Moacutestoles
Tratamiento 1 Control
Tratamiento 2 Atenuacioacuten
natural
Tratamiento 3 Bioestimulacioacuten
Tratamiento 4 Bioaumento
Tratamiento 5 Bioestimulacioacuten
y Bioaumento
Suelo sin contaminar X 4 tiempos
CreosotaH2O-Tween-80 X 4 tiempos
CreosotaBHB oacuteptimo-Tween-80 X 4 tiempos
CreosotaH20 ndash Tween-80 X 4 tiemposC2PL05
CreosotaBHB oacuteptimo-Tween-80 X 4 tiemposC2PL05
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
Suelo natural +X 2
TOTAL = 40 MICROCOSMOS
Figura 10 Disentildeo experimental correspondiente al experimento que conforma el capiacutetulo 4
Resumen Metodologiacutea general
40
Anaacutelisis fiacutesico-quiacutemicos
La caracterizacioacuten del suelo contaminado del cual se extrajo el consorcio C2PL05 asiacute como
la explicacioacuten de las teacutecnicas y metodologiacuteas empleadas se detallan en Molina et al (2009)
No obstante en la Tabla 1 se presentan las propiedades fiacutesico-quiacutemicas de dicho suelo
contaminado
Tabla 1 Propiedades fisico-quiacutemicas y bioloacutegicas del suelo contaminado con HAP
Propiedades Unidades Media plusmn ES
Tamantildeo medio de partiacutecula μm3 291 plusmn 6 Composicioacuten (arenaslimosarcillas) v 291009000 plusmn 03603600
pH - 77 plusmn 01
Conductividad μSmiddotcm-1 74 plusmn 22
WHCa v 33 plusmn 7
(NO3)- μgmiddotKg-1 40 plusmn 37
(NO2)- μgmiddotKg-1 117 plusmn 01
(NH4)+ μgmiddotKg-1 155 plusmn 125
(PO4)3- μgmiddotKg-1 47 plusmn 6
Carbono total v 96 plusmn 21
TOCb (tratamiento aacutecido) v 51 plusmn 04
MPNc (heteroacutetrofos) x104 ceacutelulasmiddotg-1 97 plusmn 12
MPNc (degradador de HAP) x103 ceacutelulasmiddotg-1 93 plusmn 19
Toxicity EC50d gmiddot100ml-1 144 plusmn 80
Hidrocarburos extraiacutedos w 92 plusmn 18
a Capacidad de campo del agua (WHC Water holding capacity) maacutexima cantidad de agua que
puede contener un suelo b Carbono orgaacutenico total (TOC total organic carbon) c Nuacutemero maacutes
probable (MPN most probably number) teacutecnica cultivo-dependiente que estima el nuacutemero de
ceacutelulas capaces de crecer con una determinada fuente de carbono (ver apartado Anaacutelisis
bioloacutegicos) d EC50 es una medida de la eficacia de una determinada sustancia o de su toxicidad
y representa la cantidad de un compuesto necesaria para disminuir al 50 una funcioacuten En
nuestro caso indica la toxicidad del medio que disminuye a la mitad la actividad microbiana del
consorcio
La metodologiacutea utilizada para la extraccioacuten de HAP (capiacutetulos 1 2 y 3) y creosota
(capiacutetulo 4) se detalla en el apartado de material y meacutetodos de los capiacutetulos
correspondientes La cromatografiacutea liacutequida de alto rendimiento (HPLC high-performance
liquid chromatography) fue la teacutecnica utilizada para el anaacutelisis de los HAP en los capiacutetulos 1
y 2 siguiendo el protocolo descrito por Bautista et al (2009) El equipo de anaacutelisis HPLC
(Prestar 230 Varian Palo Alto CA USA) esta compuesto por una columna C18 en fase
reversa Luna C18 (2) (75 cm longitud x 46 mm diaacutemetro interno y 3 μm tamantildeo de partiacutecula
Phenomenex Torrance CA USA) y conectado a una matriz de fotodiodos de UVVis
Resumen Metodologiacutea general
41
(ultravioletavisible) y un detector de fluorescencia La fase moacutevil utilizada se compone de un
gradiente acetonitriloagua programado como se detalla a continuacioacuten gradiente isocraacutetico
6040 (0-2 min) gradiente de 7525 (2-14 min) gradiente isocraacutetico 7525 (14-15 min)
gradiente de 1000 (15-16 min) El volumen de inyeccioacuten de muestra es de 10 μl y el flujo de
elusioacuten en la columna de 08 mlmiddotmin-1 La deteccioacuten de los HAP se realiza a 254 nm El
posterior tratamiento de los datos se detalla en los respectivos capiacutetulos
El meacutetodo para la deteccioacuten de HAP en el capiacutetulo 3 y de creosota en el capitulo 4 fue
la cromatografiacutea de gases (GC Gas Chromatography) utilizando un cromatoacutegrafo de gases
(system Varian 3900 Palo Alto CA USA) con un detector con ionizador de llama (FID
Flame Ionization Detector) La metodologiacutea protocolo y posterior tratamiento de los datos se
detallan en el material y meacutetodos de los respectivos capiacutetulos
Anaacutelisis bioloacutegicos
La densidad celular es una teacutecnica utilizada en todos los ensayos que componen esta tesis y
por tanto la metodologiacutea y el posterior tratamiento de los datos estaacuten detalladamente
descritos en todos los manuscritos que conforman los capiacutetulos de la tesis
Las teacutecnicas cultivo dependientes desarrolladas en los ensayos han sido el NMP
descrito en los capiacutetulos 2 3 y 4 y el aislamiento de colonias aplicando la metodologiacutea
empleada por Molina et al (2009) y descrita en los capiacutetulos 2 y 3
Teacutecnicas moleculares
Extraccioacuten y amplificacioacuten de ADN
La extraccioacuten de ADN de muestras de cultivos liacutequidos y muestras de biomasa de una
colonia aislada (capiacutetulos 2 y 3) se realizoacute usando el kit de extraccioacuten fiacutesico-quiacutemico de ADN
bacteriano Microbial DNA isolation Kit (Laboratorios MoBio Solano Beach CA USA) Para
la extraccioacuten de ADN total de muestras de suelo (capiacutetulos 3 y 4) se usoacute el kit de extraccioacuten
fiacutesico-quiacutemico Power Soil DNA kit (Laboratorios MoBio Solano Beach CA USA) siguiendo
en ambos casos el protocolo recomendado por el fabricante
Resumen Metodologiacutea general
42
Para la amplificacioacuten de las secuencias de ADN se utilizaron varias parejas de
cebadores en funcioacuten de la teacutecnica posterior de anaacutelisis del producto de PCR La
amplificacioacuten del ADN se realizoacute con el fin de identificar las secuencias de las cepas
aisladas o para un posterior anaacutelisis del ADN total de una muestra mediante electroforesis
en gel con gradiente desnaturalizante (DGGE denaturing gradient gel electrophoresis)
Cuando fue necesario reamplificar material geneacutetico procedente de una banda de DGGE la
pareja de primers utilizada no presentaba cola de GC (guanina-citosina) En la Tabla 2 se
describen las caracteriacutesticas de los cebadores y en la Figura 11 se detallan las condiciones
del programa correspondiente a cada pareja de cebadores
Tabla 2 Caracteriacutesticas de los cebadores utilizados para la amplificacioacuten de ADN por PCR
Cebador Secuencia 5acute--3acute Nordm de bases
Tordf hibridacioacuten
(ordmC)
Programa de PCR (Figura
Teacutecnica de anaacutelisis del producto de
16F27 AGAGTTTGATCMTGGCTCAG 20 55 I Purificacioacuten Secuenciacioacuten16R1488 CGGTTACCTTGTTACGACTTCAGG 24 55 I
16F341 CCTACGGGAGGCAGCAG 17 54 II DGGE Clonacioacuten Ecoli 16R907 CCGTCAATTCCTTTRAGTTT 20 54 II
16F338 CTCCTACGGGAGGCAGCAG 19 55 II DGGE Clonacioacuten Ecoli 16R518 CGTATTACCGCGGCTGCTGG 20 55 II
ITS1F CTTGGTCATTTAGAGGAAGTAA 20 54 III Presencia material geneacutetico ITS4 TCCTCCGCTTATTGATATGC 20 54 III
Primer con posibilidad de antildeadir una secuencia de 40 bases (5acute-CGC CCG CCG CGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) rica en guanina (G) y citosina(C) unida al extremo 5acute- del
cebador necesaria para electroforesis en gel con gradiente desnaturalizantede
Resumen Metodologiacutea general
43
Figura 11 Condiciones de los programas de PCR I II y III a) Paso en el cual se procede a la
activacioacuten del principio activo de la polimerasa ExTaq-HS a una Tordf de activacioacuten de 94ordmC b) Tordf de
desnaturalizacioacuten c) Tordf de hibridacioacuten d) Tordf de polimerizacioacuten e) Tordf de extensioacuten f) Tordf final y de
conservacioacuten del producto de PCR
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 5 min
95 ordmC 1 min
54 ordmC 05 min
72 ordmC 15 min
72 ordmC 10 min
30 CICLOS
PROGRAMA PCR III
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
95 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR II
Desnata inicial Tordf desnatb
Tordfhibridc
Tordf pold Tordf exte
Tordf finalf
4 ordmC infin
94 ordmC 9 min
94 ordmC 1 min
55 ordmC 1 min
72 ordmC 15 min
72 ordmC 5 min
30 CICLOS
PROGRAMA PCR I
Resumen Metodologiacutea general
44
Electroforesis en gel con gradiente de desnaturalizacioacuten (DGGE) y clonacioacuten en
Escherichia coli
El estudio de la comunidad bacteriana se realizoacute mediante la teacutecnica DGGE ampliamente
descrita en los capiacutetulos 2 3 y 4 Las bandas maacutes predominantes fueron extraiacutedas del gel
eluiacutedas en de agua esterilizada y almacenadas a -20 ordmC para su posterior reamplificacioacuten y
clonacioacuten Las imaacutegenes de DGGE se analizaron graacutefica y estadiacutesticamente para diferenciar
entre las comunidades objeto de estudio y la influencia de los tratamientos en los cambios
de una comunidad El anaacutelisis graacutefico mediante el programa UN-Scan-It (v 60 Silk Scientific
US) permitioacute identificar el porcentaje de abundancia de cada banda con respecto de una
comunidad
La clonacioacuten en Ecoli se empleoacute debido a la imposiblidad de reamplificar el ADN
contenido en una banda cortada del gel de DGGE La metodologiacutea empleada para el
desarrollo de esta teacutecnica en los capiacutetulos 2 3 y 4 es la recomendada por el fabricante del
kit utilizado pGEM-T Easy Vector System II (Pomega)
Alineamiento de secuencias y anaacutelisis filogeneacuteticos
Las secuencias fueron editadas utilizando el programa Chromas Pro v142 que permite
ademaacutes visualizar y modificar posibles ambiguumledades en los nucleoacutetidos Las secuencias
fueron descargadas en las bases de datos disponibles (Genbank
(httpwwwncbinlmnihgovgenbank) y Ribosomal Sequence Data
(httprdpcmemsueduseqmatchseqmatch_introjsp)) a traveacutes de la opcioacuten BLAST con el
fin de aproximarnos a la identificacioacuten molecular de los organismos La secuencias fueron
alineadas utilizando el programa Bioedit v709 y posteriormente se elaboroacute una matriz de
datos a partir de la cual se establecieron las posibles relaciones filogeneacuteticos entre las
secuencias problema y aquellas descargadas de las bases de datos El programa utilizado a
tal efecto fue PAUP 40B10 (Swofford 2003)
Se utilizaron dos tipos de anaacutelisis para estimar las relaciones filogeneacuteticas y la
fiabilidad de las topologiacuteas obtenidas Por un lado se utilizoacute la Maacutexima Parsimonia estaacutendar
(Maxima Parsimonia de Fitch MP) un meacutetodo que elige el aacuterbol que requiere el menor
nuacutemero de cambios evolutivos para explicar las relaciones entre taxones a partir de la
informacioacuten generada por los sitios informativos el valor relativo de los diferentes caracteres
y de sus transformaciones Para evaluar la fiabilidad de las relaciones establecidas por
parsimonia se selecciono el meacutetodo Bootstraping (Felsenstein 1985) donde los caracteres
Resumen Metodologiacutea general
45
de las matrices se combinan al azar con las repeticiones necesarias considerando los
paraacutemetros establecidos en el anaacutelisis de parsimonia Asiacute el porcentanje con que aparece
un determinado grupo es una medida de la bondad de dicho grupo o rama Por otro lado la
diferencia entre secuencias (distancia geneacutetica) se computoacute en teacuterminos de nuacutemero de
nucleoacutetidos diferentes por sitio entre secuencias realizando un anaacutelisis de neighbour-joining
de acuerdo al algoritmo de Jukes amp Cantor (1969) Ambos tipos de anaacutelisis se llevaron a
cabo usando el software PAUP 40B10 (Swofford 2003)
Anaacutelisis estadiacutesiticos
Todos los capiacutetulos se disentildearon de forma que tras la finalizacioacuten del experimento los datos
pudieran ser tratados estadiacutesticamente El tratamiento estadiacutestico y los anaacutelisis realizados
con los datos de los ensayos estaacuten descritos en el apartado correspondiente de los
manuscritos que componen los artiacuteculos de la presente tesis Es necesario explicar
detalladamente el experimento que compone el capiacutetulo 1b disentildeado con un experimento
ortogonal del tipo L18 (37) (21) seleccionado del modulo de Statistica (Version 60) Este tipo
de disentildeo permitioacute hacer una combinacioacuten de muacuteltiples factores de forma reducida Es decir
un total de 18 experimentos representan todas las combinaciones posibles que se pueden
dar entre 8 factores siete de los cuales pueden tomar tres valores (37) diferentes (ej factor
Tordf valores 30ordmC 25ordmC y 20ordmC) y uno de ellos con dos valores (21) (ej factor concentracioacuten
de surfactante valores CMC y +20 CMC)
Para visualizar cambios en las comunidades microbianas (patrones univariantes) en
cada combinacioacuten de factores (ej tiempo tipo de consorcio temperatura) se realizoacute una
ordenacioacuten multivariante mediante un escalamiento multidimensional no-meacutetrico (MDS non-
parametric Multidimensional Scaling) usando el programa PRIMER (Clarke 1993) Este tipo
de anaacutelisis se realizoacute en los capiacutetulos 3 y 4 La ordenacioacuten se hizo sobre la base de la matriz
de dismilaridad de Bray-Curtis construida a partir de la transformacioacuten de los datos de
abundancia por la raiacutez cuarta para minimizar la influencia de los valores maacutes extremos
(Clarke 1993 Martiacuten Guirao 2007) Se usoacute el procedimiento SIMPER (Clarke 1993) para
identificar el porcentaje de contribucioacuten de cada banda a la disimilitud entre tratamientos
establecida en la matriz de Bray-Curtis Las bandas se consideraron influyentes cuando su
contribucioacuten se encontraba dentro de los primeros 70 (capiacutetulo 2) 60 (capiacutetulo 3) o 50
(capiacutetulo 4 Viejo 2009) del porcentaje medio de similaridaddisimilaridad acumulado entre y
dentro de la combinacioacuten de factores El criterio aplicado para escoger el porcentaje de
contribucioacuten limite se hizo en funcioacuten de la riqueza de bandas de forma que cuanto menor
fuera este paraacutemetro mayor el porcentaje liacutemite
Capiacutetulo
Publicado en Water Air amp Soil Pollution (2011) 217 365-374
Simarro R Gonzaacutelez N Bautista LF Sanz R amp Molina MC
Optimisation of key abiotic factors of PAH (naphthalene phenanthrene and
anthracene) biodegradation process by a bacterial consortium
Optimizacioacuten de los principales factores abioacuteticos de un proceso de biodegradacioacuten
de HAP (naftaleno fenantreno y antraceno) por un consorcio bacteriano
1a
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
49
Abstract
The aim of this work is to determine the optimum values for the biodegradation process of six
abiotic factors considered very influential in this process The optimization of a polycyclic
aromatic hydrocarbons (naphthalene phenanthrene and anthracene) biodegradation
process was carried out with a degrading bacterial consortium C2PL05 The optimized
factors were the molar ratio of carbonnitrogenphosphorus (CNP) the nitrogen source the
iron source the iron concentration the pH and the carbon source Each factor was optimized
applying three different treatments during 168 h analyzing cell density by spectrophotometric
absorbance at 600 nm and PAH depletion by HPLC To determine the optimum values of the
factors an analysis of variance (ANOVA) was performed using the cell density increments
and biotic degradation constants calculated for each treatment The most effective values of
each factor were a CNP molar ratio of 1002116 NaNO3 as nitrogen source Fe2(SO4)3 as
iron source using a concentration of 01 mmolmiddotl-1 a pH of 70 and a mixture of glucose and
PAH as carbon source Therefore high concentration of nutrients and soluble forms of
nitrogen and iron at neutral pH favour the biodegradation Also the addition of glucose to
PAH as carbon source increased the number of total microorganism and enhanced the PAH
biodegradation due to augmentation of PAH degrader microorganisms It is also important to
underline that the statistical treatment of data and the combined study of the increments of
the cell density and the biotic biodegradation constant has facilitated the accurate
interpretation of the optimization results For an optimum bioremediation process is very
important to perform these previous bioassays to decrease the process development time
and so the costs
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
51
Introduction
Polycyclic aromatic hydrocarbons (PAH) are persistent organic compounds with two or more
aromatic rings They are formed by incomplete combustion of fossil fuels and pyrolysis of
organic matter derived from human activities and as a result of natural events like forest fires
The toxic mutagenic and carcinogenic properties of PAH have concerned the Unites States
Environmental Protection Agency (US-EPA) proposing some of them as priority pollutants
(including naphthalene phenanthrene and anthracene) In addition the PAH solubility is very
low in aqueous medium (Luning Prak amp Pritchard 2002) affecting their degradation and
biomagnification within the ecosystems The microbial bioremediation removes or
immobilizes the pollutants reducing toxicity with a very low environmental impact Generally
microbial communities present in PAH contaminated soils are enriched by microorganisms
able to use them as only carbon source (Heitkamp amp Cerniglia 1988 Gallego et al 2007)
However this process can be affected by a few key environmental factors (Roling-Wilfred et
al 2002) that may be optimized to achieve a more efficient process The molar ratio of
carbon nitrogen and phosphorus (CNP) is very important for the metabolism of the
microorganisms and so for PAH degradation (Bossert amp Bartha 1984 Alexander 1994
Kwok amp Loh 2003) The molar ratio 100101 is frequently considered optimal for
contaminated soils (Bossert amp Bartha 1984 Alexander 1994) while other author have
reported negative or non-effects (Chaicircneau et al 2005) According to Leys et al (2005)
these contradictory results are due to the nutrients ratio required by PAH degrading bacteria
depends on environmental conditions type of bacteria and type of hydrocarbon In addition
the chemical form of those nutrients is also important being the soluble forms (ie iron or
nitrogen in form of phosphate nitrate and ammonium) the most frequent and efficient due to
their higher availability for microorganisms Depending on the microbial community and their
abundance another factor that may improve the PAH degradation is the addition of readily
assimilated such as glucose carbon sources (Zaidi amp Imam 1999)
Moreover the pH is an important factor that affects the solubility of both PAH and
many chemical species in the cultivation broth as well as the metabolism of the
microorganisms showing an optimal range for bacterial degradation between 55 and 78
(Bossert amp Bartha 1984 Wong et al 2001)
In general bioremediation process optimization may be flawed by the lack of studies
showing the simultaneous effect of different environmental factors Hence our main goal was
to set up the optimum values of six abiotic factors CNP molar ratio nitrogen source iron
source iron concentration pH and carbon source for the biodegradation of three PAH
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
52
(naphthalene phenanthrene and anthracene) at 25 ordmC In order to achieve the main objective
we analyzed the effects of the above factors on the microbial growth and the biotic
degradation rate
Materials and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all gt99 purity) were purchased from Sigma-
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) The consortium C2PL05
was not able to degrade PAH significantly without the addition of surfactants (data not
shown) Therefore surfactant Tween-80 (Sigma-Aldrich Steinheim Germany) was selected
as the most efficient biodegradable and non-toxic surfactant (Bautista et al 2009) for the
consortium C2PL05 Bushnell Haas Broth medium (BHB) was purchased from Panreac
(Barcelona Spain) and its composition is 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-
1 KHPO4 1 gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 This base composition was
modified in each experiment as required
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1g of soil (lt 2 mm) was resuspended in 10 ml
of phosphate buffer saline (PBS) and incubated during 12 h in an orbital shaker (Innova 40
New Brunswick Scientific Edison NJ USA) at 150 rpm and 25ordmC under dark conditions
After that 15 ml of the supernatant was inoculated in 50 ml of BHB broth (pH 70) 1 wt
Tween-80 as surfactant and naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1)
as carbon source The culture was incubated at 150 rpm and 25ordmC under dark conditions
until the exponential phase was completed This was confirmed by monitoring the cell density
by absorbance at 600 nm in a spectrophotometer (Spectronic GenesysTM UK) Then the
consortium was stored at 4 ordmC to stop its growth At the beginning of each experiment 500 μl
of the stored consortium was inoculated into the fermentation flasks To identify the microbial
consortium C2PL05 colonies from aliquots of the soil extract were isolated in BHB agar
plates with PAH as only carbon source to confirm that these colonies were PAH degraders
Eight colonies were isolated and transferred onto LB-glucose agar plates in order to increase
microbial biomass for DNA extraction Total DNA of the colonies was extracted using
Microbial DNA isolation kit (MoBio Laboratories) Amplification of the 16S rRNA coding
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
53
region of the DNA was performed as described by Vintildeas et al (2005) using the primers
16F27 and 16R1488 Sequences were edited and assembled using BioEdit 487 software
(Hall 1999) All isolated strains of the consortium C2PL05 were γ-proteobacteria and the
genera present were Enterobacter Pseudomonas and Stenotrophomonas In addition non
culture-dependent molecular techniques as denaturant gradient gel electrophoresis (DGGE)
was performed to know the total biodiversity of the microbial consortium C2PL05 16S rRNA
gen was amplified using the primers 341F-GC and 907R (GC clamp 5acute-CGC CCG CCG
CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995) About 6 of
polyacrylamide (3751 acrylamidebisacrylamide) gels with a 30-60 urea-formamide
denaturant gradient and 075 mm were used in 1xTAE buffer at 200V for 4h at 60 ordmC The
bands were excised and reamplificated to identify the DNA The two genera identified
coincided with genera Pseudomonas and Stenotrophomonas identified by culture-dependent
techniques (more details in Molina et al 2009)
Experimental design
A total of 6 abiotic factors were evaluated To obtain an optimum value three treatments
each in triplicate were performed for each factor The replicates were carried out in 100 ml
Erlenmeyer flasks with 50 ml of BHB medium (pH 70) Tween-80 (1wt) naphthalene
phenanthrene and anthracene (each at 500 mgmiddotl-1) and 500 microl of the C2PL05 consortium
The concentration of the inoculum was 315x106 cells ml-1 of the heterotrophic microorganism
and 695x105 cells ml-1 of the PAH degrading microorganism The number of the
microorganisms capable to degrade any carbon source present in the medium (heterotrophic
microorganisms) and microorganisms capable to degrade PAH as sole carbon source (PAH-
degrading bacteria) were measured by the most probably number (MPN) method (Wrenn amp
Venosa 1996) LB-glucose broth and BHB medium were used to determine heterotrophic
microorganism and PAH degrading microorganism respectively To maintain the same initial
number of cells in each experiment the absorbance of the inoculum was measured and
diluted if necessary before inoculation to reach an optical density of 16 AU The replicates
were incubated in an orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA)
at 150 rpm and 25 ordmC under dark conditions Previous to inoculate the consortium the
Erlenmeyer flasks were shacked overnight to solubilize most of the PAH Samples were
withdrawn at 0 15 24 39 48 64 72 159 and 168 h to monitor the PAH depletion and cell
growth
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
54
Treatment conditions
Composition of BHB base was 02 gmiddotl-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 1 gmiddotl-1 KHPO4 1
gmiddotl-1 K2HPO4 1 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 The compounds MgSO4 and CaCl2 and their
concentration were constant for all treatments and KHPO4 and K2HPO4 were modified only in
concentration The other components were modified both the concentration and compounds
according to the requirements of the optimized factors PAH at 1500 mgmiddotl-1 (500 mgmiddotl-1 of
naphthalene phenathrene and anthracene) was used as carbon source for all treatments
except for those in which the carbon source was optimized and PAH were mixed with
glucose in a proportion of 50 PAH-glucose or only glucose was added In all cases an
overall carbon concentration of 01176 mmoll-1 was used Once a factor was optimized its
optimum value was kept for the subsequent factor optimization
The levels of each factor studied were selected as described below For the CNP
molar ratio the values employed were 100101 frequently described as optimal (Bossert
and Bartha 1984) 100505 and 1002116 To optimize the nitrogen source NaNO3
NH4(NO3) and (NH4)2SO3 were used The optimal iron source was selected amongst FeCl3
Fe(NO3)3 and Fe2(SO4)3 The concentration levels of the optimal iron form were 005 01 and
02 mmoll-1 and three different pH values were also tested 50 70 and 80 The effect of the
carbon source was determined by adding PAH as only carbon source PAH and glucose
(50 of carbon atoms from each source) or glucose as only carbon source
Bacterial growth
Bacterial growth during the PAH degradation process was monitored at 0 15 24 39 48 64
72 159 and 168 h by spectrophotometric absorbance of the culture media at 600 nm in a
UV-Vis spectrophotometer (Spectronic GenesysTM UK) From the above optical density data
the average of the cell density increments (CDI) was calculated by applying the following
equation
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
55
Kinetic degradation
Naphthalene phenanthrene and anthracene concentrations in the culture media were
analysed using a ProStar 230 HPLC system (Varian Palo Alto CA USA) with a reverse
phase C18 column following the method described in Bautista et al (2009) The
concentration of each PAH was calculated from a standard curve based on peak area using
the absorbance at 254 nm Depletion rate of each PAH (-ri) during the experiments was fitted
to a first order kinetic model (Equation 2)
iBiiAii
i CkCkdt
dCr Eq 2
where C is the concentration of the corresponding PAH kA is the apparent first-order
kinetic constant due to abiotic processes kB is the apparent first-order kinetic constant
due to biological processes t is the time elapsed and the subscript i corresponds to
each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1 wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40 New Brunswick Scientific Edison
NJ USA) at 150 rpm and 25 ordmC under dark conditions PAH concentration in the control
experiment were analysed using the HPLC system described previously The values of kA for
each PAH was calculated by applying eq 2 considering kB asymp 0 since no bacterial consortium
was inoculated
Statistical analysis
In order to evaluate the effects of the treatments on the kinetic biodegradation constant (kB)
and cell density increments (CDI) bifactorials analysis of variance (ANOVA) were used The
variances were checked for homogeneity by applying the Cochranacutes test When indicated
data were transformed to homogenize variances Student-Newman-Keuls (SNK) test was
used to discriminate among different treatments after significant F-test All tests were
performed with the software Statistica 60 for Windows
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
56
Results
Control experiments (Figure 1) show that phenathrene and anthracene concentration was
not affected by any abiotic process since no depletion was observed along the experiment
so that kA asymp 0 h-1 However in the case of naphthalene some degree of abiotic depletion was
measured during the controls yielding an apparent first-order abiotic rate constant of 27x10-
3 plusmn 7x10-5 h1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the optimisation experiments
0 100 200 300 400 500 600 700
20
40
60
80
100
Rem
aini
ng P
AH
(
)
Time (hour)
Figure 1 Naphthalene ( ) phenathrene ( ) and anthracene ( )
depletion due to abiotic processes in control experiments
Table 1 Analysis of variance (ANOVA) summary for the cell density increments (CDI) and the
biotic degradation constant (kB) MS is the means of squares and df degrees of freedom
CDI kB
Factor df MS F-value p-value df MS F-value p-value
CNP ratio 2 27middot10-1 238 4 57middot10-2 566 Error 6 11middot10-2 18 10middot10-3
N source 2 21middot10-1 234 4 90middot10-6 113
Error 6 10middot10-2 18 70middot10-7
Fe source 2 18middot10-2 51 4 30middot10-6 43
Error 6 36middot10-3 18 70middot10-8
Fe Concentration 2 45middot10-1 348 006 4 30middot10-6 38
Error 6 95middot10-2 18 10middot10-7
pH 2 30middot10-2 1103 4 15middot10-4 5
Error 6 27middot10-3 18 33middot10-5
GlucosePAHs 2 54middot10-1 45401 2 66middot10-4 7
Error 6 12middot10-3 12 93middot10-5
a Logarithmically transformed data to achieve homogeneity of variance
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
57
Cell density increments of the consortium for three different treatments of CNP molar
ratio are showed in Figure 2A According to statistical analysis of CDI there was significant
differences between CNP molar ratio (F26 = 238 p lt 001 Table 1) and SNK showed that
treatments with molar ratios of 100101 and 1002116 reached larger increases With
regard to the kinetic biodegradation constant (kB) the interaction between kB of the
treatments with each hydrocarbon was significant (F418 = 57 p lt 0001 Table 1) The SNK
test (Figure 2B) showed that the treatment 1002116 with naphthalene yielded the highest
value whereas the lowest were achieved with 100505 and 100101 for anthracene and
phenanthrene In addition within each PAH group the highest values were observed with
1002116 molar ratio Therefore although there are no differences for CDI between ratios
100101 and 1002116 1002116 molar ratio is the most effective for the PAH degradation
so that this ratio was considered as the optimal
171819202122232425
100101 1002116100505
bb
a
A
CNP molar ratio
CD
I
Naphthalene Phenanthrene Anthracene-35
-30
-25
-20
-15
-10
-05
00B
d
g
e
bc
f
ab
f
Log
k B (
h-1)
Figure 2 (A) Cell density increments of the consortium C2PL05 with the treatments 100505
100101 and 1002116 Error bars show the standard error (B) Differences between treatments
(100101 100505 and 1002116 ) and PAHs in the biodegradation kinetic constant (kB)
The letters show differences between groups (p lt 005 SNK) and the error bars the standard
deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
58
Figure 3A shows that the three different nitrogen sources added had significant effects
on CDI (F26 = 234 p lt 001 Table 1) The SNK test shows that the addition of NaNO3
significantly improved CDI The interaction between PAH and the nitrogen sources were
significant (F418 = 113 p lt 0001 Table 1) and the highest kB values were achieved with
NaNO3 for naphthalene phenanthrene and anthracene (Figure 3B) According to these
results NaNO3 is considered as the best form to supply the nitrogen source for both PAH
degradation and growth of the C2PL05 consortium
19
20
21
22
23
24
25
(NH4)
2SO
4NH4NO
3NaNO
3
a
b
a
A
Nitrogen source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
Bf
ba
e
bcb
dbc
a
kB (
h-1)
Figure 3 (A) Cell density increments of the consortium C2PL05 with the treatments NaNO3 NH4NO3
and (NH4)2SO4 Error bars show the standard error (B) Differences between treatments (NaNO3
NH4NO3 and (NH4)2SO4 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
59
CDI of the treatments performed with three different iron sources (Figure 4A) were
significantly different (F26 = 51 p lt 005 Table 1) Although no significant differences
between adding Fe2(SO4)3 or Fe(NO3)3 were observed the addition of Fe2(SO4)3 contributes
more to CDI than FeCl3 The kB (Figure 4B) showed significant differences in the interaction
between PAH and the different iron sources (F418 = 43 p lt 0001 Table 1) The highest kB
values were observed with Fe2(SO4)3 for the degradation of phenanthrene followed by FeCl3
degrading naphthalene and phenanthrene The lowest values of kB were observed with
Fe(NO3)3 degrading naphthalene and anthracene Nevertheless the most recalcitrant PAH
(phenanthrene and anthracene) showed the highest kB values with Fe2(SO4)3 in agreement
with the highest CDI values also obtained with Fe2(SO4)3
168
172
176
180
184
188
192
196
Fe(NO3)
3 Fe2(SO
4)
3FeCl
3
ab
b
a
A
Iron source
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-3
4x10-3
6x10-3
8x10-3
1x10-2
B
c
a
b
c
b
d
b
a a
k B
(h-1
)
Figure 4 (A) Cell density increments of the consortium C2PL05 with the treatments FeCl3 Fe(NO3)3
and Fe2(SO4)3 Error bars show the standard error (B) Differences between treatments (FeCl3
Fe(NO3)3 and Fe2(SO4) ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
60
Concerning the effect of the iron concentration (Figure 5) supplied in the form of the
optimal Fe2(SO4)3 no significant differences in CDI were found for all three concentration
used (F26 = 348 p = 006 Table 1 Figure 5A) However the interaction between iron
concentration and kB of three PAH was significant (F418 = 38 p lt 0001 Table 1) reaching
the highest values for kB by using an iron concentration of 01 mmoll-1 degrading
naphthalene and phenanthrene (Figure 5B) The lowest values of kB were observed with 005
mmoll-1 and 02 mmoll-1 degrading phenanthrene and anthracene (Figure 4B) Since each
PAH showed the highest kB with 01 mmoll-1 this iron concentration was considered as the
most efficient for the PAH biodegradation process
005 01 02
38
40
42
44
46
48
50
a
a
a
A
Iron concentration (mmol l-1)
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
B
c
f
d
b
e
d
cb
a
k B (
h-1)
Figure 5 (A) Cell density increments of the consortium C2PL05 with the treatments 005 mmolmiddotl-1 01
mmolmiddotl-1 and 02 mmolmiddotl-1 Error bars show the standard error (B) Differences between treatments
(005 mmolmiddotl-1 01 mmolmiddotl-1 and 02 mmolmiddotl-1 ) and PAHs in the biodegradation kinetic
constant (kB) The letters show differences between groups (p lt 005 SNK) and the error bars the
standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
61
With reference to pH Figure 6A and statistical analysis (F26 = 1103 p lt 001 Table 1)
clearly show that the neutral pH of the medium favour the CDI of the consortium The kB of
the three different treatments (Figure 6B) also showed significant differences in the
interaction (F49 = 5 p lt 005 Table 1) The highest value of kB was observed for anthracene
degradation at neutral pH (Figure 6B) The other two PAH naphthalene and phenanthrene
did not show significantly differences between any treatments Therefore given that the
highest values of both parameters (CDI and kB) were observed at pH 7 this value will be
considered as the most efficient for the PAH biodegradation process
5 7 8
215
220
225
230
235
240
245
a
b
a
A
pH
CD
I
Naphthalene Phenanthrene Anthracene00
50x10-3
10x10-2
15x10-2
20x10-2
25x10-2
30x10-2
B
b
a
ab ab
a
ab
c
ab ab
kB
(h-1
)
Figure 6 (A) Cell density increments of the consortium C2PL05 with the treatments pH 50 pH 70
and pH 80 Error bars show the standard error (B) Differences between treatments (pH 50 pH
70 and pH 80 ) and PAHs in the biodegradation kinetic constant (kB) The letters show
differences between groups (p lt 005 SNK) and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
62
The last factor analyzed was the addition of an easily assimilated carbon source
(Figure 7) Regarding to CDI values (Figure 7A) there were significant differences between
treatments (F26 = 45401 p lt 0001 Table 1) The addition of glucose as only carbon source
significantly improved CDI Figure 7B only show the kB of the treatments with PAH (100 or
50 of PAH) therefore the treatment with glucose as only carbon source was not included in
the ANOVA analysis The interaction between PAH and type of carbon source was
significant (F212 = 7 p lt 005 Table 1) The kB for the treatment with PAH and glucose
(5050) was significantly higher for phenanthrene and naphthalene (Figure 6B) although
there were no differences with the treatment for anthracene where PAH were the only carbon
source
PAHs (100)
PAHsGlucose (50)Glucose (100)
18
20
22
24
26
28
Carbon source
b
c
a
A
CD
I
Naphthalene Phenanthrene Anthracene0
2x10-2
4x10-2
6x10-2
8x10-2
1x10-1
B
c
bb
b
b
a
k B (h
-1)
Figure 7 (A) Cell density increments of the consortium C2PL05 with the treatments PAHs (100)
PAHsglucose (5050) and glucose (100) Error bars show the standard error (B) Differences
between treatments (PAHs (100) and PAHs glucose (5050) ) and PAHs in the
biodegradation kinetic constant (kB) The letters show differences between groups (p lt 005 SNK)
and the error bars the standard deviation
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
63
Discussion
It is important to highlight that the increments of the cell density is a parameter that brings
together all the microbial community whereas the biotic degradation constant is specific for
the PAH degrading microorganisms For that reason when the effect of the factors studied
on CDI and kB yielded opposite results the latter always prevailed since PAH degradation
efficiency is the main goal of the present optimisation study
With regard to the CNP molar ratio some authors consider that low ratios might limit
the bacterial growth (Leys et al 2005) although others show that high molar ratios such as
100101 are optimum for hydrocarbon polluted soils (Flathman et al 1994 Bouchez et al
1995 Eweis et al 1998) However in agreement with Leys et al (2005) our results
confirmed that the most effective molar ratio was the highest (1002116) This result
suggests that the supply of the inorganic nutrients during the PAH biodegradation process
may be needed by the microbial metabolism In addition the form used to supply these
nutrients can affect the metabolism of the microorganism (Carmichael amp Pfaender 1997) and
limit the amount of carbon that bacteria can assimilate limiting in turn the biodegradation
extent Our results showed that nitrate (sodium nitrate) as nitrogen source improved PAH
biodegradation as compared to ammonium This is likely due to the fact that nitrate is more
soluble and available for microorganisms than ammonium which has adsorbent properties
(Schlessinger 1991) The iron is other essential compound to stimulate the microbial activity
on PAH degradation (Dinkla amp Janssen 2003 Santos et al 2008)
On one hand iron acts as a cofactor of enzymes catalysing PAH oxidation (Dinkla amp
Janssen 2003) but it is also related with the production of biosurfactants (Santos et al
2008) These compounds are naturally produced by genera such as Pseudomonas and
Bacillus (Wei et al 2003) increasing the PAH solubility and therefore their bioavailability In
agreement with previous works (Dinkla amp Janssen 2003 Santos et al 2008) our results
confirmed that the addition of iron in a concentration of 01 mmoll-1 makes the
biodegradation more effective Santos et al (2008) stated that there is a limit concentration
above which the growth is inhibited due to toxic effects According to these authors our
results showed lower degradation and growth with the concentration 02 mmoll-1 since this
concentration may be saturating for these microorganisms However opposite to previous
works (Dinkla amp Janssen 2003 Santos et al 2008) the most effective iron form was
Fe2(SO4)3 for the PAH biodegradation likely due to the higher solubility which makes it more
available for the microorganism
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
64
The addition of easy assimilated carbon forms such as glucose for the PAH
degrading process can result in an increment in the total number of bacteria (Wong et al
2001) because PAH degrader population can use multiple carbon sources simultaneously
(Herwijnen et al 2006) However this increment in the microbial biomass was previously
considered (Wong et al 2001) because the utilization of the new carbon source may
increase the lag phase delaying the bacterial growth (Maier et al 2000) Our results
confirmed that PAH degradation was more efficient with the addition of an easy assimilated
carbon source probably because the augmentation of the total heterotrophic population also
enhanced the PAH degrading community Our consortium showed a longer lag phase during
the treatment with glucose than that observed during the treatment with PAH as only carbon
source (data not shown) These results are consistent with a consortium completely adapted
to PAH biodegradation and its enzymatic system requires some adaptation time to start
assimilating the new carbon source (Maier et al 2000)
Depending on the type of soil and the type of PAH to degrade the optimum pH range
can be very variable (Dibble amp Bartha 1979) Some acid resistant gram-positive bacteria
such as Mycobacterium sp show better PAH degradation capabilities under acid condition
because and low pH seems to render the mycobacterial more permeable to hydrophobic
substrates (Kim et al 2005) However other microorganisms belonging to Pseudomonas
genus prefer neutral pH conditions In agreement with previous works (ie Dibble amp Bartha
1979) our results confirmed that neutral pH is optimum for the biodegradation PAH
In summary the current work has shown that the optimization of environmental
parameters may significantly improve the PAH biodegradation process It is also important to
underline that the statistical analysis of data and the combined study of the bacterial growth
and the kinetics of the degradation process provide an accurate interpretation of the
optimisation results Concluding for an optimum bioremediation process is very important to
perform these previous bioassays to decrease the process development time and so the
associated costs
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Master en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradation process
65
References
Alexander M 1994 Biodegradation and Biorremediation Academic Press New York
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse bacteria Int Biodeter
Biodegr 63 913-922
Bossert I amp Bartha R 1984 The fate of petroleum in soil ecosystems In Atlas RM (ed)
Petroleum microbiology Macmillan New York pp441-4473
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Carmichael LM amp Pfaender KF 1997 The effects of inorganic and organic supplements on
the microbial degradation of phenanthrene and pyrene in soils Biodegradation 8 1-
13
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge Appl Environ Microbiol 37 729-739
Dinkla EJT amp Janssen DB 2003 Simultaneous growth on citrate reduces the effects of
iron limitation during toluene degradation in Pseudomonas Microb Ecol 45 97-107
Eweis JB Ergas SJ Chang PY amp Schroeder ED 1998 Bioremediation Principles
McGraw-Hill Boston pp 136-236
Flathman PE Jerger DE amp Exner JH1994 Biorremediation-Field Experiences Lewis
Publishers Boca Raton pp 81-106 383-490
Gallego JL Garciacutea MJ Llamas JF Belloch C Pelaez AI amp Sanchez J 2007
Biodegradation of oil tank botton sludge using microbial consortia Biodegradation 18
269-281
Hall TA 1999 Bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 41 95-98
Heitkamp MA amp Cerniglia CE 1988 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from sediment below an Oil Field Appl Environ Microbiol 54
1612-1614
Kim YH Freeman JP Moody JD Engesse KH amp Cerniglia CE 2005 Effects of pH on
the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii PYR-1
Appl Environ Microbiol 67 275-285
Kwok Chen-Ko amp Loh Kai-Che 2003 Effects of Singapore soil type on bioavalability of
nutrients in soil bioremediation Adv Environ Res 7 889-900
Capiacutetulo 1a Optimisation of abiotic factors of PAH biodegradationprocess
66
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Luning Prak DJ amp Pritchard PH 2002 Solubilization of polycyclic aromatic hydrocarbon
mixtures in micelar non-ionic surfactant solution Water Res 36 3463-3472
Maier MR Pepper LI amp Gerba PC 2000 Enviromental Microbiology Academic Press
Elsevier
Molina MC Gonzalez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz L 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Denaturing gradient gel
electrophoresis of PCR-amplified 16S Rdna a new molecular approach to analyse the
genetic diversity of mixed microbial communities In Akkermans ADL van Elsas JD
de Bruijn FJ (eds) Molecular microbial ecology manual Kluwer Academic Publishers
Dordrecht pp 1-23
Rolling-Wilfred FM Milner M Jones DM Lee K Daniel F Swanell-Richard JP amp Head
IM 2002 Robust hydrocarbon degradation and dynamic of bacterial communities
during nutrients-enhanced oil spillbiorremediation Appl Environ Microbiol 68 5537-
5548
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation an surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Vintildeas M Sabateacute J Guasp C Lalucat J y Solanas AM 2005 Culture-dependent and
independent aproaches establish the complexity of a PAH degrading microbial
consortium Can J Microbiol 51 897-909
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacillus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK Ma KK amp Fang M 2001 Isolation and optimization of
PAH-degradative bacteria from contaminated soil for PAH bioremediation Water Air
Soil Poll 13 1-13
Zaidi BR amp ImamSH 1999 Factors affecting microbial degradation of polycyclic aromatic
hydrocarbon phenanthrene in caribbean coastal water Mar Pollut Bull 38 738-749
Capiacutetulo
Aceptado en Water Air amp Soil Pollution (Febrero 2012)
Simarro R Gonzaacutelez N Bautista LF Molina MC amp Schiavi E
Evaluation of the influence of multiple environmental factors on the biodegradation
of dibenzofuran phenanthrene and pyrene by a bacterial consortium using an orthogonal
experimental design
Evaluacioacuten de la influencia de muacuteltiples factores ambientales en la biodegradacioacuten de dibenzofurano
fenantreno y pireno por un consorcio bacteriano usando un disentildeo experimental ortogonal
1b
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
69
Abstract
For a bioremediation process to be effective we suggest to perform preliminary studies in
laboratory to describe and characterize physicochemical and biological parameters (type and
concentration of nutrients type and number of microorganisms temperature) of the
environment concerned We consider that these studies should be done by taking into
account the simultaneous interaction between different factors By knowing the response
capacity to pollutants it is possible to select and modify the right experimental conditions to
enhance bioremediation
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
71
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic compounds composed of two
or more aromatics rings High molecular weight PAH (HMW-PAH) with four (ie pyrene) or
more aromatics rings and other heterocyclic aromatic compounds as dibenzofuran both with
high molecular mass are often more difficult to biodegrade that other low molecular weight
PAH (LMW-PAH) due to their lower solubility and biodegradability Many of them have toxic
mutagenic and carcinogenic properties and the effects of PAH as naphthalene or
phenanthrene in animals and humans their toxicity and carcinogenic activity has been
reported and well documented (Sudip et al 2002) In addition PAH are bioaccumulated in
the environment and trophic chains properties that increase with the numbers of rings There
is a natural degradation carried out by microorganism able to use PAH as carbon source
which represents a considerable portion of the bacterial communities present in polluted soils
(Heitkamp amp Cerniglia 1998) However this natural biodegradation may be affected by
environmental factors which optimization allows us to achieve a more efficient process
Temperature is a key factor in the physicochemical properties of PAH as well as in the
metabolism of the microorganisms Although it has been shown that biodegradation of PAH
is possible even at temperatures lower than 5 ordmC (Eriksson et al 2001) it is usually more
efficient at mild temperatures (15-25 ordmC) (Mohn amp Stewart 2000) The carbon nitrogen and
phosphorus (CNP) molar ratio is another important factor in biodegradation process
because affect the dynamics of the bacterial metabolisms changing the PAH conversion
rates and growth of PAH-degrading species (Leys et al 2004) The form in which these
essential nutrients are supplied affects the bioavailability for the microorganism being more
soluble and efficient the oxidated forms (such as nitrates) than reduced forms (such as
ammonium) (Schlessinger 1991)
Surfactants are compounds used to increase the PAH solubility although both
positive (Boochan et al 1998 Jin et al 2007) and negative effects (Boochan et al 1998
Laha amp Luthy 1992) on the biodegradation process has been reported The nature of the
effect depends on several factors such as the type and concentration of surfactant due to
the toxic properties of some of them (Jin et al 2007) and the increasing of toxicity of PAH
produced by increasing their solubility (Thibault et al 1996) Another factor considered is the
inoculum size related to the diversity and effectiveness of the biodegradation because in a
diluted inoculum the minority microorganisms which likely have an important role in the
biodegradation process can be removed (Szaboacute et al 2007) Moreover it has been
reported (Szaboacute et al 2007) that the addition of a readily metabolized carbon source (ie
glucose) improves the PAH degradation possibly due to the increased biomass although in
72
others cases (Wong et al 2000) this better bacterial growth reduced significantly PAH
degradation
We consider that the study of the individual effect of abiotic factors on the
biodegradation capacity of the microbial consortium is incomplete because the effect of one
factor can be influenced by other factors In this work the combination between factors was
optimized by an orthogonal experimental design fraction of the full factorial combination of
the selected environmental factors
Hence our two mains goals are to determine the optimal conditions for the
biodegradation of low (phenanthrene and dibenzophurane) and high (pyrene) molecular
weight PAH by a bacterial degrading consortium (C2PL05) and the study of the influence of
the factors (temperature CNP molar ratio type of nitrogen and iron source iron source
concentration carbon source surfactant concentration and inoculums dilution) in the
biodegradation In order to achieve these objectives we realized an orthogonal experimental
design to take into account all combination between eight factors temperature CNP molar
ratio nitrogen and iron source iron concentration addition of glucose surfactant
concentration and inoculum dilution at three and two levels
Material and methods
Chemicals and media
Dibenzofuran phenanthrene and pyrene (gt99 purity) were purchased from Sigma-Aldrich
Steinheim Germany) Stock mix of the three PAH was prepared by dissolving the necessary
amount in n-hexane (Fluka Steinheim Germany) In previously work (Bautista et al 2009)
we tested that the optimal surfactant for the consortium was the biodegradable and non
toxicTween-80 (Sigma-Aldrich Steinheim Germany) Bushnell-Haas Broth medium (BHB)
was purchased from Panreac (Barcelona Spain) and its original composition (02 g l-1
MgSO4middot7H2O 002 g l-1 CaCl2 2H2O 1 g l-1 KHPO4 1 g l-1 K2HPO4 1 g l-1 NH4NO3 005 g l-1
FeCl3) was modified according to the treatment (see Table 1)
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
73
Table 1 Experimental design
Treatment T
(ordmC) CNP (molar)
N source
Fe
source
Iron source concentration
(mM)
Glucose PAH ()
Surfactant concentration
Inoculum dilution
1 30 100505 (NH4)2SO3 Fe2(SO4)3 02 0100 CMC 10-3
2 20 1002116 (NH4)2SO3 FeNO3 005 0100 + 20CMC 10-2
3 25 100101 NaNO3 FeNO3 02 0100 + 20CMC 10-1
4 20 100505 NaNO3 Fe2(SO4)3 02 5050 + 20CMC 10-2
5 25 100505 NH4NO3 FeNO3 01 5050 CMC 10-2
6 30 100101 NH4NO3 Fe2(SO4)3 005 8020 + 20CMC 10-2
7 30 100101 NaNO3 FeCl3 01 0100 CMC 10-2
8 20 100505 NaNO3 FeCl3 005 8020 CMC 10-1
9 25 1002116 (NH4)2SO3 FeCl3 02 8020 CMC 10-2
10 20 1002116 NH4NO3 Fe2(SO4)3 01 0100 CMC 10-1
11 20 100101 NH4NO3 FeNO3 02 8020 CMC 10-3
12 25 100101 (NH4)2SO3 Fe2(SO4)3 005 5050 CMC 10-1
13 25 1002116 NaNO3 Fe2(SO4)3 01 8020 + 20CMC 10-3
14 30 1002116 NH4NO3 FeCl3 02 5050 + 20CMC 10-1
15 25 100505 NH4NO3 FeCl3 005 0100 + 20CMC 10-3
16 30 1002116 NaNO3 FeNO3 005 5050 CMC 10-3
17 30 100505 (NH4)2SO3 FeNO3 01 8020 + 20CMC 10-1
18 20 100101 (NH4)2SO3 FeCl3 01 5050 + 20CMC 10-3
Bacterial consortium
PAH-degrading consortium C2PL05 was isolated from a soil in a petrochemical complex in
Puertollano (Spain) and was identified and described in Molina et al (2009) All strains of
the consortium C2PL05 isolated by culture-dependent techniques were γ-Proteobacteria
and the strains presents belong to the genera Enterobacter Pseudomonas and
Stenotrophomonas (Molina et al 2009) In addition the diversity of the enriched microbial
consortium was characterised by a non culture-dependent molecular technique such as
denaturing gradient gel electrophoresis (DGGE) following the procedure described
elsewhere (Molina et al 2009) using the primers 341F-GC and 907R (GC clamp 5acute-CGC
CCG CCG CGC CCC GCG CCC GTC CCG CCC CCG CCC-3acute) (Muyzer et al 1995)
Experimental design
An orthogonal design form of L18 (37) (21) selected from the module of Statistica (Version 60)
was used to do the multi-factor combination A total of 18 experiments each in triplicate
were carried out in 100 ml Erlenmeyers flask with a total volume of 50 ml of Bushnell-Haas
Broth medium (BHB) (Panreac Barcelona Spain) with an original composition modified
74
according to the treatments requirements (see Table 1) The replicates were incubated in an
orbital shaker (Innova 40 New Brunswick Scientific Edison NJ USA) at 150 rpm under dark
conditions but prior to inoculate the consortium the flasks were shaken overnight to
equilibrate and solubilize most of the PAH In Table 1 shows a summary of environmental
conditions and incubation of each treatment Tween-80 concentration was 0012 mM the
critical micellar concentration (CMC) 100 of PAH was equivalent to 03 g l-1 (01 g l-1 of
each PAH) The initial cell concentration of the inoculum consortium was determined by the
most probably number (MPN) method (Wrenn amp Venosa 1983) The number of heterotrophic
microorganisms (315x106 cell ml-1) was measured with Luria Base broth (LB Panreac
Barcelona Spain) with glucose as carbon source and the PAH degrading microorganisms of
the consortium (695x105 cell ml-1) with BHB with PAH mix as carbon source
Cell density
Bacterial density during the PAH degrading process was monitored at 0 15 24 39 48 63
72 87 95 and 159 h by the increase in absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) Throughout the cell growth curve we
calculated the average of the cell densities increments (CDI) applying the equation 1
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and i
corresponds to each sample or sampling time The increments were normalized by
the initial absorbance measurements to correct the effect of the inoculum dilution
PAH extraction and analysis
At the end of each experiment (159 hours) PAH were extracted with dichloromethane and
the residue precipitated was dissolved in 1 ml of acetonitrile for high performance liquid
chromatography (HPLC) analysis using a ProStar 230 HPLC system (Varian Palo Alto CA
USA) with a reversed phase C18 column following the method previously described (Bautista
et al 2009) The residual concentration of each PAH was calculated from a standard curve
based on peak area at a wavelength of 254 nm The average percentage of phenanthrene
pyrene and dibenzofuran and average percentage of total PAH degradation (PD) for each
treatment are shown in Table 2
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
75
Statistical analyses
The effect of the individual parameters on the CDI and on the PD were analysed by a
parametric one-way analysis of variance (ANOVA) The variances were checked for
homogeneity by the Cochranacutes test Students-Newman-Keuls (SNK) test was used to
discriminate among different variables after significant F-test When data were not strictly
parametric Kruskal-Wallis test and Tukey-type multiple comparison test were used
The orthogonal design to determine the optimal conditions for PAH biodegradation is
an alternative to the full factorial test which is impractical when many factors are considered
simultaneously (Chen et al 2008) However the orthogonal test allows a much lower
combination of factors and levels to test the effect of interacting factors
Results and discussion
The consortium C2PL05 degrade phenanthrene pyrene and dibenfuran efficiently in 159 h
(Table 2) and also other PAH as naphthalene and anthracene (Molina et al 2009) The
study of the influence of each factor in the total PD (Figure 1) showed that only the carbon
source influenced in this parameter significantly (Table 3) Results concerning to carbon
source showed that PD were higher when PAH were added as only carbon source (100 of
PAH) The reason why the PD did not show statistical significance between treatments
except for the relative concentration of PAH-glucose may be due to significant changes
produced in PD at earlier times when PAH were still present in the cultivation media
However the carbon source incubation temperature and inoculum dilution were factors that
significantly influenced CDI (Table 3 Figure 2)
76
Table 2 Final percentage degradation of
phenanthrene (Phe) pyrene (pyr) and dibenzofuran
(Dib) and total percentage degradation (total PD) for
each treatment
percentage degradation Treatment Phe Pyr Dib Total PD
1 965 883 864 904 2 969 950 833 917 3 966 895 845 902 4 972 915 921 872 5 969 904 950 882 6 982 935 995 852 7 964 883 859 902 8 977 953 964 823 9 976 936 984 825 10 970 910 895 925 11 979 968 986 888 12 966 889 920 850 13 978 930 993 835 14 966 897 943 871 15 963 881 898 914 16 963 886 951 867 17 977 954 986 861 18 976 930 967 915
The conditions corresponding to listed treatments
are presented in Table 1
100
50
5
100
101
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
82
84
86
88
90
92 T (ordmC)
aa
a
aa
aa
aa
a
Tot
al P
D (
)
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
(SO
4)3
a
a
0acute05 0acute1
0acute2
Fe source
a
a
a
0 -
100
50 -
50
80 -
20
C Fe (mM)
a
b
c
CM
C
+ 2
0 C
MC
Gluc-PAHs
aa
10^-
1
10^-
2
10^-
3DilutionCMC
aa
a
Figure 1 Graphical analysis of average values of total percentage degradation (PD) under
different treatments and levels of the factors () represent the average of the total PD of the
treatments of each level Letters (a b and c) show differences between groups
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
77
Table 3 Analysis of variance (ANOVA) summary for the increments of cell density (CDI) and the total
percentage degradation (PD) of each factor MS is the mean of squares and df degrees of freedom
ANOVA of CDI ANOVA of total PD
Factor df MS F-value p-value df MS F-value p-value
T (ordmC) Error
2 056 1889 2 22 183 ns
51 002 51 12
Molar ratio CNP Error
2 003 069 ns 2 22 183 ns
51 005 51 12
N source Error
2 001 007 ns 2 214 177 ns 51 005 51 121
Fe source Error
2 003 066 ns 2 89 071 ns
51 005 51 126
Fe concentration Error
2 007 146 ns 2 118 095 ns 51 005 51 124
Glucose-PAH Error
2 024 584 2 1802
3085 51 004 51 395
8
CMC Error
1 001 027 ns 1 89 071 ns
52 005 52 125
Inoculum Dilutionb Error
2 331 a 2 113 091 ns 54 6614 51 125
a H-value obtained of Kruskal-Wallis test used for non parametric data Chi-square = 28 Overall
median = 044
p-value lt 001
p-value lt 0001
100
50
5
100
100
1
100
211
6
CNP
20
ordmC
25ordmC
30ordmC
16
17
18
19
20
21
a
a
aa
a
aa
a
c
bCD
I
NaN
O3
NH
4NO
3
(NH
4)2S
O3
N source
FeC
L3
FeN
O3
Fe2
SO
4
Fe source
a
a
0acute05 0acute1
0acute2
C Fe (mM)
a
a
a
0-10
0
50-5
0
80-2
0
Gluc-PAH
a
b
c
CM
C
+ 2
0 C
MC
CMC
aa
10^-
1
10^-
2
10^-
3
00
05
10
15
20
25
30
35C
DI n
orm
aliz
ed
DilutionT (ordmC)
b
a
a
Figure 2 Graphical analysis of average values of cell density increments (CDI) and normalized cell
density increments (CDI normalized) of different treatments and levels of the factors () represent the
average of the CDI or CDI normalized of the treatments of each level Letters (a b and c) show
differences between groups
78
The temperature range considered in the present study might not affect the
biodegradation process since it is considered narrow by some authors (Wong et al 2000)
Nevertheless we observed significant differences in the process at different temperatures
showing an optimum at 25 ordmC for our microbial consortium growth (Figure 2) whereas when
consortium was incubated at 20 ordmC and 30 ordmC microorganisms remained in lag phase These
results were in agreement with the fact that respiration increases exponentially with
temperature (Q10 relationship) (Lloyd amp Taylor 1994) but increasing or decreasing
temperature beyond the optimal value will cause a reduction in microbial respiration We
suggest that moderate fluctuation of temperatures affect microbial growth rate but not
degradation rates because degrading population is able to degrade PAH efficiently in a
temperature range between 20-30 ordmC (Sartoros et al 2005)
The nutrient requirements for microorganisms increase during the biodegradation
process so a low CNP molar ratio can result in a reduced of the metabolic activity of the
degrader microorganisms and thus reduce their potential degrader (Leys et al 2004)
According to this author CNP ratios above 100101 provide enough nutrients to metabolize
the pollutants However our results showed that the CNP ratios supplied to the cultures
even the ratio 100505 did not affect the CDI and total PD This results indicate that the
consortium C2PL05 is able to degrade PAH even under low nutrients conditions due to its
high adaptation to the hard conditions of a chronically contaminated soil The results
concerning the addition of different nitrogen and iron sources did not show significant
difference in CDI and total PD Other works (Schelessinger 1991 Santos et al 2008) have
suggested that the addition of nitrogen in form of nitrates (Schelessinger 1991) and the iron
in form of sulphates or chlorides (Santos et al 2008) is more effective due to their high
solubility
The addition of readily biodegradable carbon source as glucose to a polluted
environment is considered an alternative to promote biodegradation The easy assimilation of
this compound result in an increase in total biomass (heterotrophic and PAH degrader
microorganisms) of the microbial population thereby increasing the degradation capacity of
the community Piruvate are a carbon source that promote the growth of certain degrading
strains as Pseudomonas putida (Lee et al 2003) whereas salicylate induces the synthesis
and activation of degradative enzymes (Chen amp Aitken 1999) Similarly to previous results
observed by Wong et al (2000) in the present study the addition of glucose to the cultures
had significant effects in total PD and CDI (Figure 1 Figure 2) Although the consortium
C2PL05 showed a significantly better growth with 80 of glucose the difference between
treatments (0100 5050 8020 of glucosePAH) showed that PD was higher when PAH
were added as only carbon source Previously it has been described that after a change in
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
79
the type of carbon source supplied to PAH-degrader microorganisms an adaptation period
for the enzymatic system was required reducing the mineralization rate of pollutants (Wong
et al 2000 Maier 2009 Simarro et al 2010) As glucose was added as additional carbon
source our results show an increase in CDI although the PD values decrease significantly
This indicated that glucose enhance the overall growth of consortium but decrease the
biodegradation rate of PAH-degrader population due to the adaptation of the corresponding
enzymatic system So in this case the addition of a readily carbon source retards the
biodegradation process The addition of surfactant to the culture media at concentration
above their CMC is essential to increase PAH degradation rate (Pantsyrnaya et al 2011)
However Yuan et al (2000) reported negative effects when the surfactant was added at
concentration above the CMC because the excess of micelles around PAH reduces their
bioavailability (Mulligan et al 2001) However our results showed that PD and CDI were not
affected by concentrations largely beyond the CMC Some non biodegradable surfactants
can be toxic to bacteria and therefore do not improve the biodegradation process (Bautista et
al 2009) Tween-80 was the optimal surfactant for the strains of the consortium C2PL05
(Bautista et al 2009) However the optimal type of surfactant is determined by the type of
degrading strains involved in the process (Bautista et al 2009) In addition it is important to
consider the possible use of surfactant as a carbon source by the strains preferentially to
PAHs which would reduce the rates of biodegradation (Kim amp Weber 2003)
Further dilution of the inoculum represents the elimination of minority species which
could result in a decrease in the degradation ability of the consortium if the eliminated
species represented an important role in the biodegradation process (Szaboacute et al 2007)
Our results concerning the inoculum concentration showed that this factor significantly
influenced in CDI but had no effect on total PD indicating that the degrading ability of the
consortium has not been altered by the dilution of the same In Gonzalez et al (2011) the
evolution and bacterial succession of the consortium C2PL05 by culture-dependent
techniques are described All of these identified strains were efficient in degradation of PAH
(Bautista et al 2009) but Enterobacter sp was dominant at the beginning of the degradation
process whereas Stenotrophomonas sp and Pseudomonas sp were less abundant In
addition DGGE fingerprint pattern studied and described in Molina et al (2009) showed a
low microbial diversity of the consortium C2PL05 typical of an enriched consortium from
chronically contaminated soil (Vintildeas et al 2005) The results present in this work suggest
that in cultures inoculated with the highest dilution of the consortium (10-3) the less abundant
microorganisms were eliminated reducing the competition for the dominant species which
can grow vigorously
80
The influence of some environmental factors on the biodegradation of PAH can
undermine the effectiveness of the process In this study the combination of all factors
simultaneously by an orthogonal design has allowed to establish considering the interactions
between them the most influential parameters in biodegradation process Finally we
conclude that the only determining factor in biodegradation by consortium C2PL05 is the
carbon source Although cell growth is affected by temperature carbon source and inoculum
dilution these factors not condition the effectiveness of degradation Therefore the optimal
condition for a more efficient degradation by consortium C2PL05 is that the carbon source is
only PAH
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (11-37320053-B and
0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero The consortium C2PL05 was
isolated from soil samples kindly provided by Repsol SA This work is framed within the
Official Maacutester en Ciencia y Tecnologiacutea Ambiental of the Universidad Rey Juan Carlos
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
81
References
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Boochan S Britz ML amp Stanley GA 1998 Surfactant-enhanced biodegradation of high
molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophila
Biotechnol Bioeng 59 482-494
Chen S-H amp Aitken MD 1999 Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
EnvironSci Technol 33 435ndash439
Chen J Wong MH Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAHs) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in Artic Tundra soil Appl EnvironMicrobiol 67 5107-
5112
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438-9446
Heitkamp MA amp Cerniglia CE 1998 Mineralization of polycyclic aromatic hydrocarbons by
a bacterium isolated from Sediment below an oil field Appl EnvironMicrobiol 54
1612-1614
Jin D Jiang X Jing X amp Ou Z 2007 Effects of concenrtration head group and structure of
surfactants on the biodegradation of phenanthrene J Hazard Mater 144 215-221
Kim HS amp Weber WJ 2003 Preferential surfactant utilization by a PAH-degrading strain
effects on micellar solubilization phenomena Environ Sci Technol 37 3574-3580
Laha S amp Luthy RG 1992 Effect of non-ionic surfactants on the solubilization and
mineralization of phenanthrene in soil-water systems Biotechnol Bioeng 40 1367-
1380
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegradation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Leys MN Bastiaens L Verstraete W amp Springael D 2004 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation
by Mycobacterium and Sphingomonas in soil Appl Microbiol Biot 66 726-736
Lloyd J amp Taylor JA 1994 On the temperature dependence of soil respiration Funct Ecol
8 315-323
82
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mulligan CN Young RN amp Gibbs BF 2001 Surfactant enhanced remediation of
contaminated soil a review Eng Geol 60 371-380
Muyzer G Hottentrager S Teske A amp Wawer C 1995 Molecular microbial ecology manual
(Eds Akkermans ADL van Elsas JD Bruijn FJ) Kluwer Academic Publishers
Dordrecht pp 1-23
Pantsyrnaya T Blanchard F Delaunay S Georgen JL Geacuteudon E Guseva E amp Boudrant
J 2011 Effect of surfactants dispersion and temperature on solubility and
biodegradation of phenanthrene in aqueous media Chemosphere 83 29-33
Santos EC Jacques JS Bento MF Peralba MCR Selbach AP Saacute LS amp Camargo
AOF 2008 Anthracene biodegradation and surface activity by an iron-stimulated
Pseudomonas sp Bioresource Technol 99 2644-2649
Sartoros C Yerushalmi L Beroacuten L amp Guiot S 2005 Effects of surfactant and temperature
on biotransformation kinetics of anthracene and pyrene Chemistry 61 1042-1050
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Sudipt KS Om VS amp Rakesh KJ 2002 Polycyclic aromatic hydrocarbons environmental
pollution and bioremediation Trends Biotechnol 20 243ndash248
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquatic Microbl Ecol 47 1-10
Thibault SL Anderson M amp Frankenberger WTJr 1996 Influence of surfactant on pyrene
desorption and degradation in soils Appl Environ Microbiol 62 283-287
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Poll 139 1-13
Capiacutetulo 1b Influence of abiotic factors on the PAH biodegradation using an orthogonal design
83
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon degrading bacteria by most-probably-number (MPN) Can J Microbiol
4 252-258
Yuan SY Wei SH amp Chang BV 2000 Biodegradation of polycyclic aromatic
hydrocarbons by a mixed culture Chemosphere 41 1463-1468
Capiacutetulo
Publicado en Bioresource Technology (2011) 102 9438-9446
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA
Effect of surfactants on PAH biodegradation by a bacterial consortium
and on the dynamics of the bacterial community during the process
Efecto de los surfactantes en la biodegradacioacuten de HAP por un consorcio bacteriano y dinaacutemica de la comunidad
bacteriana durante el proceso
2
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
87
Abstract
The aim of this work was to evaluate the effect of a non-biodegradable (Tergitol NP-10) and
a biodegradable (Tween-80) surfactant on growth degradation rate and microbial dynamics
of a polycyclic aromatic hydrocarbon (PAHs) degrading consortium (C2PL05) from a
petroleum polluted soil applying cultivable and non cultivable techniques Growth and
degradation rate were significantly lower with Tergitol NP-10 than that with Tween-80
Toxicity did not show any significant reduction with Tergitol NP-10 whereas with Tween-80
toxicity was almost depleted (30) after 40 days Regarding to the cultured bacteria
Pseudomonas and Stenotrophomonas groups were dominant during PAH degradation with
Tergitol NP-10 whereas Enterobacter and Stenotrophomonas were dominant with Tween-80
DGGE analyses (PRIMER and MDS) showed that bacteria composition was more similar
between treatments when PAHs were consumed than when PAHs concentration was still
high Community changes between treatments were a consequence of Pseudomonas sp
Sphingomonas sp Sphingobium sp and Agromonas sp
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
89
Introduction
Polycyclic aromatic hydrocarbons (PAH) are a group of organic pollutants composed of two
or more fused aromatic rings produced by natural and anthropogenic sources Besides
being toxic carcinogenic and mutagenic compounds the semi-volatile properties of some
PAH make them highly mobile throughout the environment (air soil and water) In addition
PAH have a high trophic transfer and biomagnification within the ecosystems due to the
lipophilic nature and the low water solubility that decreases with molecular weight (Clements
et al 1994) The importance of preventing PAH contamination and the need to remove PAH
from the environment has been recognized institutionally by the Unites States Environmental
Protection Agency (US-EPA) which has proposed 16 PAH as priority pollutants including
naphthalene phenanthrene and anthracene Currently governmental agencies scientist and
engineers have focused their efforts to identify the best methods to remove transform or
isolate these pollutants through a variety of physical chemical and biological processes
Most of these techniques involve expensive manipulation of the pollutant transferring the
problem from one site or phase to another (ie to the atmosphere in the case of cremation)
(Haritash amp Kausshik 2009) However microbial degradation is one of the most important
processes that PAH may undergo compared to others such as photolysis and volatilization
Therefore bioremediation can be an important alternative to transform PAH to less or not
hazardous forms with less input of chemicals energy and time (Haritash amp Kaushik 2009)
Most of the contaminated sites are characterized by the presence of complex mixtures
of pollutants Microorganisms are very sensitive to low concentrations of contaminants and
respond rapidly to environment perturbations (Andreoni et al 2004) Therefore microbial
communities chronically exposed to PAH tend to be dominated by those organisms capable
of use PAH as carbon and energy source (Gallego et al 2007) Even in areas previously
unpolluted there is a proportion of microbial community composed by PAH degrading
bacteria able to degrade PAH (Surridge et al 2009) These microbial communities subjected
to a polluted stress tend to be less diverse depending on the complexity of the composition
and the time of exposure (MacNaughton et al 1999) The biodegradation of hazardous
compounds by bacteria fungi and algae has been widely studied and the success of the
process will be due in part to the ability of the microbes to degrade all the complex pollutant
mixture However most of the PAH degradation studies reported in the literature have used
versatile single strains or have constructed an artificial microbial consortium showing ability
to grow with PAH as only carbon source by mixing together several known strains (Ghazali et
al 2004) Nevertheless pure cultures and synthetic microbial consortia do not represent the
natural behaviour of microbes in the environment since the cooperation among the new
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
90
species is altered In addition changes in microbial communities during pollutant
biotransformation processes are still not deeply studied Microbial diversity in soil
ecosystems can reach values up to 10 billion microorganisms per gram and possibly
thousands of different species although less than 10 can be culturables (Torsvik amp Ovreas
2002) Therefore additional information on biodiversity ecology dynamics and richness of
the degrading microbial community can be obtained by non-culturable techniques such as
DGGE In addition small bacteria cells are not culturable whereas large cells are supposed
to account 80 of the total bacterial volume (Nannipieri et al 2003) Therefore despite their
low proportion culturable bacteria can provide essential information about the structure and
functioning of the microbial communities With the view focused on the final bioremediation
culture-dependent techniques are necessary to obtain microorganisms with the desired
catabolic traits for bioaugmentation processes in polluted soils The PAH degradation is
limited by their low aqueous solubility but surfactants which are amphypatic molecules
enhance the solubility of hydrophobic compounds (Kolomytseva et al 2009) Previous works
(Bautista et al 2009) have shown that efficiency of a consortium named C2PL05 composed
by PAH degrading bacteria was significantly higher using surfactants
One of the main goals of the current work was to understand if culturable and non
culturable techniques are complementary to cover the full richness of a soil microbial
consortium A second purpose of the study was to describe the effect of different surfactants
(biodegradable and non-biodegradable) on growth rate PAH degradation rate and toxicity
reduction of a bacterial consortium (C2PL05) The microbial consortium C2PL05 was
isolated from a soil chronically exposed to petroleum products collected from a
petrochemical complex Finally the work is also aimed to describe the microbial dynamics
along the biodegradation process as a function of the surfactant used to increase the
bioavailability of the PAH
Material and methods
Chemicals and media
Naphthalene phenanthrene and anthracene (all 99 purity) were purchased from Sigmandash
Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) Reagent grade
dichloromethane and n-hexane were supplied by Scharlau Chemie (Barcelona Spain)
Surfactants (Tween-80 and Tergitol NP-10) used were supplied by Sigma-Aldrich (Steinheim
Alemania) Bushnell-Haas Broth medium (BHB) was purchased from Panreac (Barcelona
Spain) and its composition is 02 g l-1 MgSO4middot7H2O 002 gmiddotl-1 CaCl2middot2H2O 10 gmiddotl-1 KHPO4
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
91
10 gmiddotl-1 K2HPO4 10 gmiddotl-1 NH4NO3 005 gmiddotl-1 FeCl3 Luria-Bertani media (LB) glucose and
phosphate buffer saline (PBS) were purchased from Panreac (Barcelona Spain)
PAH degrader consortium C2PL05
The consortium C2PL05 was obtained from a soil sample in a petrochemical complex in
Puertollano Spain To obtain the consortium 1 g of sieved soil (lt2 mm) was resuspended in
10 ml of PBS and incubated during 12 h in an orbital shaker (Innova 40 New Brunswick
Scientific Edison NJ USA) at 150 rpm and 25 ordmC under dark conditions After that 15 ml of
the supernatant was inoculated in 50 ml of BHB broth (pH 70) containing 1 wt Tween-80
as surfactant and naphthalene phenanthrene and anthracene (each at 250 mg l-1) as carbon
source Then the culture was incubated at 150 rpm and 25 ordmC under dark conditions until the
exponential phase was completed This was confirmed by monitoring the cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK) Then the consortium was stored at 4 ordmC to
stop growth At the beginning of each experiment 500 μl of the stored consortium (asymp 16 AU)
was inoculated in Erlenmeyer flasks
Experimental design and treatments conditions
To evaluate the influence of Tween-80 and Tergitol NP-10 (biodegradable and non-
biodegradable surfactant respectively) on the degrading capacity of the consortium C2PL05
as well as the evolution of its microbial community two different treatments each in triplicate
were carried out The replicates were performed in 100 ml Erlenmeyer flasks with 50 ml of
BHB medium (pH 70) Tween-80 or Tergitol NP-10 as surfactants (1 vv) a mixture of
naphthalene phenanthrene and anthracene in n-hexane (final concentration 500 mgmiddotl-1) and
500 microl of the C2PL05 consortium (88middot108 heterotrophic cellsmiddotml-1 and 44middot107 PAH degrading
cellsmiddotml-1 for the treatments with Tween-80 73middot105 heterotrophic cellsmiddotml-1 and 24middot103 PAH
degrading cellsmiddotml-1 for treatment with Tergitol NP-10) The replicates were incubated in an
orbital shaker (Innova 40) at 150 rpm and 25 ordmC under dark conditions during 45 days
Previously to inoculate the consortium the Erlenmeyer flasks were shaked overnight to
reach the solubility equilibrium of PAH and to allow the complete evaporation of n-hexane
Samples vigorously shaking to ensure homogeneity were withdrawn twice a day for 45 days
except for the initial 24 hours where the sampling frequency was higher Cell growth PAH
(soluble and precipitated) toxicity and number of heterotrophic and PAH degrading cells
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
92
were measures in all samples To study the dynamic of the microbial consortium through
cultivable and non-cultivable methods samples were withdrawn at 0 15 and 30 days
Bacterial growth MPN and toxicity assays
Bacterial growth was monitored by changes in the absorbance of the culture media at 600
nm using a Spectronic Genesys spectrophotometer According to the Monod equation
(Equation 1) the specific growth rate micro is essentially equal to micromax when substrate limitation
is avoided
SK
S
S
max
(Equation 1)
Therefore from the above optical density data the maximum specific growth rate (micromax)
was estimated as the logarithmized slope of the exponential phase applying the following
equation (Equation 2)
Xdt
dX (Equation 2)
where micromax is the maximum specific growth rate Ks is the half-saturation constant S
is the substrate concentration X is the cell density t is time and micro is the specific
growth rate In order to evaluate the ability of the consortium to growth with
surfactants as only carbon source two parallel treatments were carried out at the
same conditions than the two treatments above described but in absence of PAH
Heterotrophic and PAH-degrading population from the consortium C2PL05 were
enumerated during the PAH degrading process comparing the effect of Tergitol NP-10 and
Tween-80 as surfactants The estimation was performed by using a miniaturized MPN
technique in 96-well microtiter plates with eight replicate wells per dilution Total
heterotrophic microbial population was enumerated in 180 μl of Luria Bertani (LB) medium
with glucose (15 gmiddotl-1) and 20 microl of the microbial consortium PHA-degrading population were
counted in BHB medium (180 microl including the surfactant) 20 microl of a mixture of phenanthrene
anthracene and naphthalene in hexane (each at a final concentration of 500 mgmiddotl-1) and 20 microl
of the microbial consortium in each well The MPN scores were transformed into density
estimates accounting for their corresponding dilution factors
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
93
The toxicity was monitored during PAH degradation and estimations were carried out
using the Microtox assay with the bioluminescent bacterium Vibrio fischeri Three controls
considered as 0 inhibition were prepared with the photobacterium and 2 NaCl (vv) and
three blanks as 100 inhibition containing only 2 NaCl (vv) Samples were salted with
NaCl (2 vv final concentration) and the toxicity was expressed as the percentage of the V
fischeri inhibition after 15 min of incubation at 15 ordmC To study the toxicity of the medium
caused by PAH when the surfactants were not added toxicity evolution was measured from
a treatment with PAH as carbon source and degrading consortia but without surfactant under
same conditions previously described
PAH monitoring
In order to compare the effect of the surfactant on the PAH depletion rate naphthalene
phenanthrene and anthracene concentrations in the culture media were analysed using a
reversed-phase C18 column (Luna C18(2) 75 cm length x 46 mm ID 3 microm particle size
Phenomenex Torrance CA USA) following the method described elsewhere (Bautista et
al 2009) The concentration of each PAH was calculated from a standard curve based on
peak area at 254 nm The apparent first-order kinetic constant (kB) due to biotic processes
was calculated by applying Equation 3
iBiiAii
i CkCkdt
dCr (Equation 3)
where C is the PAH concentration kA is the apparent first-order kinetic constant due to
abiotic processes kB is the apparent first-order kinetic constant due to biological
processes t is the time elapsed and the subscript i corresponds to each PAH
Degradation caused by abiotic processes was determined by control experiments
carried out in triplicate in 100 ml Erlenmeyers flask with 50 ml of BHB medium (pH 70)
Tween-80 (1wt) naphthalene phenanthrene and anthracene (each at 500 mgmiddotl-1) without
any microbial inoculum in an orbital shaker (Innova 40) at 150 rpm and 25ordmC under dark
conditions PAH concentration in the control experiments were analyzed using the HPLC
system described previously The values of kA for each PAH were calculated by applying Eq
2 considering kB asymp 0 since no bacterial consortium was inoculated The amount of
precipitated and bioadsorbed PAH was measured after centrifugation of the samples Then
dichloromethane was added to the pellet and this extraction was repeated three times and
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
94
the fractions pooled The solvent was evaporated using a nitrogen flow and the extract was
dissolved into a known volume of acetonitrile for HPLC analysis
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
Samples from cultures of the bacterial consortium C2PL05 during the PAH degrading
process were collected to identify the effect of the surfactants (Tergitol NP-10 and Tween-80)
To get about 20-30 colonies isolated at each collecting time samples of each treatment were
streaked onto Petri plates with BHB medium and purified agar and were sprayed with a
mixture of naphthalene phenanthrene and anthracene in n-hexane (final concentration 500
mgl-1) as carbon source The Petri plates were incubated at 25 ordmC under dark conditions
The isolated colonies were transferred onto LB agar-glucose plates in order to increase
microbial biomass for DNA extraction and stored in 50 glycerol (vv) at -80 ordmC In total 91
degrading colonies from the treatment with Tween-80 and 83 degrading colonies from the
treatment with Tergitol NP-10 were isolated
Total DNA was extracted using Microbial DNA isolation kit (MoBio Laboratories
Solano Beach CA USA) to perform the molecular identification of the PAH-degrader
isolated cultured (DIC) Amplification of the 16S rRNA coding region of the DNA was
performed as described by Vintildeas et al (2005) using the primers 16F27 (5rsquo-
AGAGTTTGATCMTGGCTCAG-3rsquo) and 16R1488 (5rsquo-TTACCTTGTTACGACTTCAGG-3rsquo) and
sequenced using the same primers Sequences were edited and assembled using
ChromasPro software version 142 (Technelysium Pty Ltd Tewantin Australia)
All of the 16S rRNA gene sequences were edited and assembled by using BioEdit
software version 487 BLAST search (Madden et al 1996) was used to find nearly identical
sequences for the 16S rRNA sequences determined Sequences were aligned using the Q-
INS-i algorithm (Katoh amp Toh 2008) of the multiple sequence alignment software MAFFT
version 6611 aligning sequences in a single step Sequence data obtained and 34
sequences downloaded from GenBank were used to perform the phylogenetic trees
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates by using PAUP
version 40B10 Maximum parsimony (MP) was also analyzed using PAUP 40B10 as is
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
95
described in Molina et al (2009) Sequences of Aquifex piruphilus were used as out-group
according to previous phylogenetic affiliations (Vintildeas et al 2005)
Denaturing gradient gel electrophoresis from microbial consortium during PAH degrading
process
Non culture dependent molecular techniques such as denaturing gradient gel
electrophoresis (DGGE) were performed to know the effect of the surfactant on the total
biodiversity of the microbial consortium C2PL05 during the PAH degradation process and
compared with the initial composition of the consortium The V3 to V5 variable regions of the
16S rRNA gene were amplified using the primers set 16S 518F and 16S 338R-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primers 338R-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded onto a 10
(wtvol) polyacrilamide gels that was 075 mm tick with a denaturing gradient of 35-65
(100 denaturant contained 7 M urea and 40 formamide) DGGE was performed in 1xTAE
buffer (20 M Tris-acetate 100 mM Na2EDTA pH 74) using a DGGE 2401 system (CBS
Scientific Co Del Mar CA USA) at 80 V and 60 ordmC for 16 h Gels were stained for 45 min in
1xTAE buffer containing Syber-Gold (500 μlmiddotl-1) and viewed under UV light Predominant
bands in DGGE gel were excised with a sterile razor blade and diluted in 50 μl of deionized
water overnight at 4ordmC Due to impossibility of reamplified bands DNA of the bands was
cloned in the pGEM-T Easy Vector (Promega Madison WI) Sequence of this PAH-degrader
uncultured bacterium (DUB) were edited and assembled as described above and included in
the matrix to perform the phylogenetic tree as described previously using the identification
code DUB
Statistical analyses
The maximum specific growth rate (micromax) and the kinetic constant of PAH biodegradation (kB)
were evaluated by both one and two-way analysis of variance (ANOVA) using Statistica 60
software (Statsoft Inc Tulsa OK USA) to determine differences between PAH (naphthalene
phenanthrene and anthracene) and surfactants (Tween-80 and Tergitol NP-10) Prior to
analyses Cochranrsquos C-test was used to check the assumption of homogeneity of variances
Student-Newman-Keuls test (SNK) was used to discriminate among different treatments after
significant F-test Differences in microbial assemblages were graphically evaluated for each
factor combination (surfactant and time) with non-metric multidimensional scaling (MDS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
96
using PRIMER software SIMPER method was used to identify the percent contribution of
each band to the dissimilarity or similarity in microbial assemblages between and within
combination of factors Based on Viejo (2009) bands were considered ldquohighly influentialrdquo if
they contributed to the first 70 of cumulative percentage of average dissimilaritysimilarity
betweenwithin combination of factors
Results and discussion
Bacterial growth and toxicity media during biodegradation of PAH
Since some surfactants can be used as carbon sources cell growth of the consortium was
measured with surfactant and PAH and only with surfactant without PAH to test the ability of
consortium to degrade and grow with both surfactants (Figure 1A) The microbial consortium
C2PL05 growth was significantly lower with Tergitol NP-10 than that reached with Tween-80
which showed the best cell growth with a maximum density (Figure 1A) In addition the
growth curve with PAH and Tergitol NP-10 showed a longer latent phase (36 hours) than
with PAH and Tween-80 (lt 12 hours) The specific growth rate (micromax) of the consortium
C2PL05 was significantly higher (Table 1A) with Tween-80 than that with Tergitol NP-10 The
results showed that Tween-80 was biodegradable for consortium C2PL05 since that
surfactant was used as the only carbon source (Figure 1A) Finally when using Tergitol NP-
10 as the only carbon source growth was not observed so that this surfactant was not
considered biodegradable for the consortium
Toxicity test (bioluminescence inhibition in Vibrio fischeri) indicates that high values
observed during the PAH degrading process with Tergitol NP-10 is caused at the initial time
by both PAH and surfactant (Figure 1B) However when PAH are totally consumed (40-45
days) toxicity still remained high and constant which means that toxicity is only due to the
Tergitol NP-10 (Figure 1B) The toxicity of PAH + biodegradable surfactant (Tween-80)
treatment decreased as the PAH and the surfactant were consumed and was almost
depleted (30) after 40 days of cultivation The toxicity showed a slight increment at the
beginning of the degradation process (Figure 1B) as a consequence of the potential
accumulation of intermediate PAH degradation products (Molina et al 2009)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
97
00
02
04
06
08
10
12
14
16
18
0 5 10 15 20 25 30 35 40 45
30
40
50
60
70
80
90
100
Tox
icity
(
)
Time (day)
B
A
Abs
orba
nce 60
0 nm
(A
U)
Figure 1 (A) Cell density of the consortium C2PL05 with PAH and Tween-80 () with
Tween-80 () with PAH and Tergitol NP-10() and with Tergitol NP-10 () (B)
Toxicity of the cultivation media during degradation of PAH by the consortium C2PL05
grown with Tween-80 () Tergitol NP-10 () and of the control experiment PAHs
without surfactants ()
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
98
The residual total concentration of three PAH of the treatments with surfactants and
the treatments without any surfactants added is shown in Figure 2 The consortium was not
able to consume the PAH when surfactants were not added PAH biodegradation by the
consortium C2PL05 was higher and faster (15 days) with Tween-80 than with Tergitol NP-10
(40 days) In all cases when surfactant was used no significant amount of PAH were
detected in precipitated or bioadsorbed form at the end of each experiment which means
that all final residual PAHs were soluble
0 5 10 15 20 25 30 35 40 45
0
10
20
30
40
50
60
70
80
90
100
Res
idua
l con
cent
ratio
n of
PA
Hs
()
Time (days)
Figure 2 Residual total PAH concentration (wt) in the treatment with Tween-80
() Tergitol NP-10 () and without surfactant ()
According to previous works (Bautista et al 2009 Molina et al 2009) these results
confirm that this consortium is adapted to grow with PAH as only carbon source and can
degrade PAH efficiently when surfactant is added According to control experiments (PAH
without consortium C2PL05) phenathrene and anthracene concentration was not affected by
any abiotic process (kA asymp 0 h-1) in the case of naphthalene some degree of abiotic depletion
was measured during the controls yielding an apparent first-order abiotic rate constant of
27middot10-3 plusmn 7middot10-5 h-1 This value was accounted for the calculation of the biodegradation rate
constant (kB) for naphthalene in the treatments so this not influence in the high
biodegradation rate of naphthalene for Tween-80 treatments The biotic depletion rate (kB) of
the three PAH was significantly higher for Tween-80 than that calculated for Tergitol NP-10
(Table 1B) There were no significant differences between PAH for Tergitol NP-10 (2 x 10-3 plusmn
4 x 10-4) whereas in the case of Tween-80 the value of kB for naphthalene (3 x 10-2 plusmn 6 x 10-4)
was higher than that for phenanthrene and anthracene (1 x 10-2 plusmn 4 x 10-4)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
99
Table 1 Analysis of variance (ANOVA) for the effects of surfactants on the specific
growth rate micromax (A) and for the effects of the surfactants and PAH on the biotic
degradation rate kB (B) of the C2PL05 consortium SS is the sum of squares and df
the degrees of freedom
Effect (A) SS df F-value p-value
Surfactant 16 1 782 0001
Error 0021 2
Effect (B) SS df F-value p-value
PAH 15middot10-4 2 779 0001
Surfactant 82middot10-4 1 4042 0001
PAH x Surfactant 12middot10-4 2 624 0001
Error 203middot10-7 12
Molecular characterization of the cultured bacteria of the consortium C2PL05 and dynamics
during the PAH degradation
The identification of cultured microorganisms and their phylogenetic relationships are keys to
understand the biodegradation and ecological processes in the microbial consortia From the
consortium C2PL05 grown with Tween-80 91 strains were isolated and sequenced From
them 7 different genotypes of PAH-degrading cultures (DIC-1 JA DIC-2 JA DIC-5 JA DIC-6
JA DIC-7 JA DIC-8JA and DIC-9JA) were identified by 16S rRNA For the treatment with
Tergitol NP-10 83 strains were isolated and sequenced and 6 different genotypes were
identified (DIC-1 RS DIC-2 RS DIC-3 RS DIC-4 RS DIC-5 RS and DIC-6 JA) One of the
isolated cultures from Tergitol NP-10 showed an identical sequence to one of the strains
grown with Tween-80 therefore the previous code (DIC-6JA) was kept Table 2 show a
summary of the PAH-degrader cultures identification The aligned matrix contained 1576
unambiguous nucleotide position characters with 424 parsimony-informative Parsimony
analysis of the data matrix yielded 10 parsimonious trees with CI = 0609 and RI = 0873 In
the parsimonic consensus tree 758 of the clades were strongly supported by boostrap
values higher or equal to 70 (Figure 3) All cultivable strains identified were γ-
proteobacteria (gram-negative) and were located in three clades Pseudomonas clade
Enterobacter clade and Stenotrophomonas clade These results are consistent with those of
Vintildeas et al (2005) who observed a strong dominance of gram negative bacteria in PAH
contaminated soil during the bioremediation process In Pseudomonas clade (Figure 3) DIC
are located in three clearly groups So DIC-2RS and DIC-3RS were grouped with P
frederiksbergensis which has been previously described in polluted soils (ie Holtze et al
2006) showing ability to reduce the oxidative stress generated during the PAH degrading
process DIC-1JA DIC-2JA (Tween-80) and DIC-1RS (Tergitol NP-10) were nested in very
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
100
solid group characterized by the presence of the type strain P koreensis previously studied
as an agricultural soil species (Kwon et al 2003) and DIC-5RS was located in P putida
group well known by their capacity to degrade high molecular weight PAH (Samantha et al
2002) to produce surfactants (Kruijt et al 2009) and to resist high temperature and salinity
(Egamberdieva amp Kucharova 2009) So several species of Pseudomonas (ie P putida P
fluorescens) have been widely studied in bioremediation (Molina et al 2009) and the present
results confirmed that it was the most representative group with the non biodegraded
surfactant treatment DIC-7JA DIC-8JA and DIC-9JA (Tween-80) which were identified as E
cloacae (Table 2) belonged to the Enterobacter clade with a strongly statistic support (Figure
3) In this clade DIC-4RS (Tergitol NP-10) is genetically related with E ludwigii which has
been recently described as relevant medical species (Hoffman et al 2005) but completely
unknown his PAH degrading capacity Enterobacter genus has been traditionally studied by
its animal gut symbiotic function but rarely recognized as a soil PAH degrading group
(Toledo et al 2006) In this phylogenetic tree E cloacae and E ludwiggi were not resolved
This result is according to Roggenkamp (2007) who consider necessary to use more
molecular markers within Enterobacter taxonomical group in order to contrast the
phylogenetic relationships In addition Enterobacter genera may not be a monophyletic
group (Kampfer et al 2005) Therefore more phylogenetic studies need to be done to clarify
the species concept within this group Finally DIC-5JA (Tween-80) and DIC-6JA isolated
from experiments using both surfactants (Tween-80 and Tergitol NP) are clearly belong to
type strain Stenotrophomonas clade genetically close to S maltophiliaT (Table 2) which has
been described as PAH-degrader (Zocca et al 2004)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
101
Figure 3 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) from the consortium C2PL05 with Tergitol NP (DIC-1JA ndash DIC-9JA)
and Tween-80 (DIC-1RS ndash DIC-5RS) and PAH-degrader uncultured bacteria (DUB) obtained from
DGGE of the consortium with both surfactant at 0 15 and 30 days of the process Boostrap values of
neighbourjoining and parsimonus higher than 50 are showed on the branch of the tree (NJMP) No
incongruence between parsimony and neighbour joining topology were detected Pseudomonas
genus has been designated as P Pantoea genus as Pa Sphingobium as S and Sphingomonas as
Sp Xantomonas as X and Xyxella as Xy T= type strain
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
102
Table 2 Bacteria identification and percentage of similarity from the GenBank data base Degrading
uncultured bacteria (DUB) form DGGE bands and degrading isolates cultured (DIC)
Colonies identified by cultivable techniques
DIC simil Mayor relationship with bacteria
of GenBank(acc No) Phylogenetic group
DIC-1RSb 980 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ)
DIC-2RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-3RS b 1000 Pseudomonas frederiksbergensis (AY785733)
Pseudomonadaceae (γ)
DIC-4RS b 990 Enterobacter ludwigii (AJ853891) Enterobacter cloacae (EU733519)
Enterobacteriaceae (γ)
DIC-5RS b 990 Pseudomonas putida (EU046322) Pseudomonadaceae (γ) DIC-6JA-6RS c 1000 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-1JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-2JA a 9900 Pseudomonas koreensis (NR025228) Pseudomonadaceae (γ) DIC-5JA a 9964 Stenotrophomonas maltophilia (AY512625) Xanthomonadaceae (γ) DIC-7JA a 9985 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-8JA a 9993 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ) DIC-9JA a 100 Enterobacter cloacae (AF157695) Enterobacteriaceae (γ)
Identification by non-cultivable techniques
DUB Band
simil Mayor relationship with bacteria
of GenBank (acc No) Phylogenetic group
DUB-1RS a 1 970 Uncultured Nitrobacteria sp (AM990004) Caulobacteraceae (α) DUB-2RS b 21 980 Bradyrhizobium sp (HQ171485) Bradyrhizobiaceae (α) DUB-3RS b 24 940 Uncultured bacterium (AY939443) -- DUB-4RS b 24 100 Uncultured Pseudomonas sp (HM561497) Pseudomonadaceae (γ) DUB-10RSb 28 980 Uncultured Sphingomonas sp (HM438638) Sphingomonadaceae(α) DUB-11RSa 28 960 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-6RS b 29 980 Pseudomonas stutzeri (HQ130335) Pseudomonadaceae (γ) DUB-8RS b 29 980 Pseudomonas sp (HM468085) Pseudomonadaceae (γ) DUB-5RS b 29 990 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-7RS b 29 980 Sphingobium sp (EF534725) Sphingomonadaceae(α) DUB-9RS b 30 970 Bacterium (AJ295668) --
a DIC or DUB belonging to treatments with Tween-80 b DIC or DUB belonging to treatments with Tergitol NP-10 c DIC or DUB belonging to treatments with Tween-80 and Tergitol NP-10
With respect to the dynamics of the microorganisms isolated from the microbial
consortium C2PL05 (Figure 4) Pseudomonas (DIC-1RS DIC-2RS and DIC-5RS Figure 4A
4B) with a percentage around 60 and Stenotrophomonas (only DIC-6JA Figure 4A and
4D) with presence of 90 were dominant groups during the PAH degrading process with
Tergitol NP-10 at 0 and 30 days in the case of Pseudomonas and at 15 days in the case of
Stenothrophomonas Enterobacter (DIC-4RS Figure 4A 4D) only was present at the end of
the process with a percentage around 40 With Tergitol NP-10 Pseudomonas sp group
was dominant coincident with the highest relative contribution of PAH degrading bacteria to
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
103
total heterotrophic bacteria at the beginning (33 of contribution) and at the end of the
degradation process (41) However Enterobacter (DIC-7JA DIC-8JA and DIC-9JA Figure
4E and 4H) with a maximum presence of 98 at 0 days and Stenotrophomonas (DIC-6JA
Figure 4E and 4G) with a maximum presence of 85 at the end of the process were
dominant with the biodegradable Tween-80 Thus Enterobacter sp seems to start the PAH
degradation process and Stenotrophomonas to finish it but at 15 days three groups coexist
within a contribution ranging 20 to 50 (Figure 4E) Therefore in agreement with other
authors (Colores et al 2000) the results of the present work confirm changes in the
bacterial (cultured and non-cultured) consortium succession during the PAH degrading
process driven by surfactant effects According to Allen et al (1999) the diversity of the
bacteria cellular walls may explain the different tolerance to grow depending on the
surfactant used Previous works (Piskonen amp Itaumlvaara 2004) have shown the capacity of
some bacteria to use both surfactants (Tergitol NP-10 and Tween-80) as carbon sources
However in agreement with recent studies (Bautista et al 2009) the present work confirms
that Tergitol NP-10 is not degradable by the consortium C2PL05 These results showed a
drastic change of the consortium composition after the addition of surfactant
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
104
0 15 30
0102030405060708090
100
102030405060708090
100
D
C
B
A
0 15 30
F DIC-1JA DIC-2JA
E
G DIC-6JA DIC-5JA
0 15 30
H
Time (day)
DIC-7JA DIC-8JA DIC-9JA
Pse
udom
onas
ribot
ypes
(
)
DIC-1RS DIC-2RS DIC-3RS DIC-5RS
102030405060708090
100
Ste
notr
opho
mon
as
ribot
ypes
(
)
DIC-6JA
0 15 30
102030405060708090
100
Ent
erob
acte
r rib
otyp
es (
)
DIC-4RS
Time (days)
Tot
al s
trai
ns (
)
Figure 4 (A) Dynamics of the microbial consortium C2PL05 during PAH degradation process with
Tergitol NP-10 and (E) with Tween-80 as surfactants Isolated and identified genus were
Pseudomonas () Stenotrophomonas () and Enterobacter () Dynamics and succession of
the (B) Pseudomonas (C) Stenotrophomonas and (D) Enterobacter ribotypes with Tergitol NP-10
as surfactant Dynamics and succession of the (F) Pseudomonas (G) Stenotrophomonas and (H)
Enterobacter ribotypes
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
105
Biodiversity and evolution of the non-cultivable bacteria of the consortium during PAH
degradation
The most influential DGGE bands to similarity 70 of contribution according to the results of
PRIMER analyses were cloned and identified allowing to know the bands and species
responsible of similarities and dissimilarities SIMPER procedure (Clarke 1993) was used to
identify the percentage contribution () that each band made to the measures of the Bray-
Curtis similarity between treatments at each surfactant (Tween-80 and Tergitol-NP) and time
(initial time after 15 and 30 days) Bands were selected as lsquoimportantrsquo to be identified if they
contributed to the first 70 of cumulative percentage of average similarity between
treatments Summary of the identification process are shown in Table 2 Phylogenetic
relationship of these degrading uncultured bacteria was included in the previous
parsymonious tree (Figure 3) In total 11 uncultured bacteria were identified DUB-4RS
DUB-6RS DUB-8RS and DUB-11RS were located in the Pseudomonas clade but these
uncultured bacteria were no grouped with a particular species of the genus DUB-5RS DUB-
7RS were identified as Sphingobium sp and DUB-10RS as Sphingomonas sp and located
in the Sphingobium and Sphingomonas clade respectivelly DUB-2RS was nested in
Bradyrhizobium clade because was identified as Bradyrhizobium sp and this clade was
supported by the type strain B japonicum In the same way DUB-1RS identified as
Uncultured Nitrobacteria was located in the Nitrobacteria clade belonged to N
hamadeniensis type strain Finally DUB-3RS and DUB-9RS were not identified with a
particular genus so they were located in a clade composed by uncultured bacteria The
phylogenetic relationship of these degrading uncultured bacteria allows expanding
knowledge about the consortium composition and process development Some of them
belong to α-proteobacteria DUB-5RS and DUB-7RS were related to Sphingobium group and
DUB-10RS with Sphingomonas clade thought this relationship should be confirmed
considering the low boostrap values Sphingomonas is a genus frequently isolated as PAH
degrader (Jing et al 2007) and important in the degradation of phenanthrene metabolites
(Tao et al 2007) Similarly Sphingobium sp has been described as PAH degrader
specifically in phenanthrene degradation process (Jing et al 2007) DUB-2RS belonged to
Bradyrhizobiaceae phylogenetic group and although Bradyrhizobium are genera barely
described as PAH degrading bacteria some studies based on PAH degradation by chemical
oxidation and biodegradation process have described that this plant-associated bacteria are
involved in the degradation of extracting agent used in PAH biodegradation techniques in
soils (Rafin et al 2009) DUB-1RS is a genotype related to Nitrobacteria clade However
Nitrobacteria has not been described as PAH degrader but this bacteria transform nitrites in
nitrates from the oxidation of nitrites (Modrogan et al 2010) and it is likely involved in the
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
106
nitrites oxidation process when the bioavailability of PAH in the media are low and so it is
not toxic for this bacteria Finally DUB-8RS DUB-6RS and DUB-11RS showed a high
similitude with Pseudomonas strain though the phylogenetic relationship with Pseudomonas
clade of DUB-11RS should be confirmed
Analysis of DGGE gel (Figure 5) showed that treatment with Tergitol NP-10 had very
few changes during biodegradation process whereas when the consortium was grown with
the biodegradable surfactant Tween-80 more changes were observed Similarity (Table 3)
between treatments were compared and analyzed by type of surfactant (Tween-80 vs
Tergitol NP-10) or by sampling time (15 days vs 30 days) The MDS analysis (Table 3)
showed the lowest values of Bray Curtis similarity coefficient between the consortium at
initial time (T0 not exposed to PAH and surfactants) with the PAH and Tween-80 after 15
days (16) and 30 days (7) However the similarity of T0 with PAH and Tergitol NP-10 after 15
days (22) and 30 days (26) was much higher Similarity between time treatments (15 and 30
days) within Tergitol NP-10 (56) was higher than with Tween-80 (32) The similarity within
treatments with Tween-80 was mainly due to the bands 1 and 29 (Table 3 Uncultured
Nitrobacteria and Sphingobium and Pseudomonas respectively see Table 2) whereas the
similarity within Tergitol NP-10 treatment was due to bands 1 and 30 (Table 3 Uncultured
Nitrobacteria and Uncultured bacteria respectively see Table 2)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
107
Figure 5 Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen fragments
from the consortium C2PL05 with initial inoculum (lane 1) with Tween-80 at 15 (lane 2) and 30 (lane 4)
days with Tergitol NP-10 at 15 (lane 3) and 30 (lane 5) days and molecular weight markers (lane 0)
According to PRIMER analysis similar bands between treatments (15 and 30 days) with Tergitol NP-
10 () and between treatments (15 and 30 days) with Tween-80 () are shown
1 Uncultured Nitrobacteria sp(DUB-1RS) 21 Bradyrhizobium sp (DUB-2RS) 24 Uncultured bacterium (DUB-3RS)
Uncultured Pseudomonas (DUB-4RS) 28 Uncultured Sphingomonas sp (DUB-10RS)
Pseudomonas sp (DUB-11RS) 29 Pseudomonas stutzeri (DUB-6RS) Pseudomonas sp
(DUB-8RS) Sphingobium sp(DUB-5RS DUB-7RS)
30 Uncultured Bacterium (DUB-9RS)
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
108
Table 3 Bands contributing to approximately the first 70 of cumulative percentage
of average similarity () Bands were grouped by surfactant and time
Band Tween-80 TergitolNP-10 15 days 30 days 1 3828 2105 2707 3014 29 2969 1509
30 2469 19
24 881 3447
27 845
21 516
Cumulative similarity () 3168 4479 4479 3391 Cloning was not possible
The genera identified in this work have been previously described as capable to
degrade the three PAH completely and efficiently with a reduction of the toxicity (Bautista et
al 2009) In the case of the treatment with Tween-80 the lower biodiversity may be caused
by a few dominant species of these genera driven during the PAH degradation process by
antagonist and synergic bacterial interactions and not by differences in the functional
capacities However when consortium grows with a non-biodegradable surfactant there is
higher biodiversity of species and interaction because the activity of various functional
groups can be required to deal the unfavorable environmental conditions
Conclusions
The choice of surfactants to increase bioavailability of pollutants is critical for in situ
bioremediation because toxicity can persist when surfactants are not biodegraded
Nevertheless surfactants affect the dynamics of microbial populations in a stable PAH-
degrading consortium From the application point of view the combination of culturable and
non culturable identification techniques may let to optimize the bioremediation process For
bioaugmentation processes culturable tools help to select the more appropriate bacteria
allowing growing enough biomass before adding to the environment However for
biostimulation process it is important to know the complete consortium composition to
enhance their natural activities
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
109
Acknowledgment
Authors are deeply indebted to Raquel Sanz Laura Saacutenchez and Laura Garciacutea and for their
support during the development of the experiments Authors also gratefully acknowledged
the financial support from the Spanish Ministry of Environment (Research project 1320062-
11) and Fundacioacuten Alfonso Martiacuten Escudero Authors also thank Repsol-YPF for providing
the soil samples This work is framed within the Official Maacutester en Ciencia y Tecnologiacutea
Ambiental from Universidad Rey Juan Carlos
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
110
References
Allen CRC Boyd DR Hempenstall F Larkin MJ amp Sharma D 1999 Contrasting effects
of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons
to cis-dihydrodiols by soil bacteria Appl Environ Microbiol 65 1335-1339
Andreoni V Cavalca L Rao MA Nocerino G Bernasconi S DellrsquoAmico E Colombo M
amp Gianfreda L 2004 Bacterial communities and enzyme activities of PAH polluted
soils Chemosphere 57 401-412
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 30 1ndash10
Clements WH Oris JT amp Wissing TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Lepomis macrochirus
Archiv Environ Contam Toxicol 26 261ndash266
Colores GM Macur RE Ward DM amp Inskeep WP 2000 Molecular analysis of
surfactant-driven microbial population shifts in hydrcarbon-contaminated soil Appl
Environ Microbiol 66 2959-2964
Egamberdieva D A amp Kucharova Z 2009 Selection for root colonising bacteria stimulating
wheat growth in saline soils Biol Fert Soils 45 563ndash571
Gallego RJS Garciacutea-Martiacutenez MJ Llamas JF Belloch C Pelaacuteez AI amp Saacutenchez J
2007 Biodegradation of oil tank bottom sludge using microbial consortia
Biodegradation 18 269ndash281
Ghazali FM Rahman RNZA Salleh AB amp Basri M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hydrocarbons (PAH) A review J Hazard Mater 169 1-15
Hoffmann H Stindl S Stumpf A Mehlen A Monget D Heesemann J Schleifer KH amp
Roggenkamp A 2005 Description of Enterobacter ludwigii sp Nov a novel
Enterobacter species of clinical relevance Syst Appl Microbiol 28 206ndash212
Holtze MS Nielsen P Ekelund F Rasmussen LD amp Johnsen K 2006 Mercury affects
the distribution of culturable species of Pseudomonas Appl Soil Ecol 31 228ndash238
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor R 1969 Evolution of protein molecules in Mammalian protein
metabolism (H Munro ed) Academic Press New York
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
111
Katoh K amp Toh H 2008 Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMC Bioinformatics 9 paper
212
Kampfer P Ruppel S amp Remus R 2005 Enterobacter radicincitans sp Nov a plant
growth promoting species of the family Enterobactriaceae Syst Appl Microbiol 28
213ndash221
Kolomytseva MP Randazzo D Baskunov BP Scozzafava A Briganti F amp Ludmila A
2009 Role of surfactants in optimizing fluorene assimilation and intermediate
formation by Rhodococcus rhodochrous VKM B-2469 Bioresource Technol 100
839-844
Kruijt M Tran H amp Raaijmakers JM 2009 Functional genetic and chemical
characterization of biosurfactants produced by plant growth-promoting Pseudomonas
putida J Appl Microbiol 107 546-556
Kwon SW Jong WS Kim S Park IC Yoon SH Park DH Lim CK amp Go SJ 2003
Pseudomonas koreensis sp Nov Pseudomonas umsongensis sp Nov and
Pseudomonas jinjuensis sp Nov novel species from farm soils in Korea Int J Syst
Evol Microbiol 53 21ndash27
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang Y amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Modrogan C Diaconu E Orbulet OD amp Miron AR 2010 Forecasting Study for Nitrate Ion
Removal Using Reactive Barriers Rev Chim 6 580-584
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions Eur J Soil Sci 54 655-670
Piskonen R amp Itaumlvaara M 2004 Evaluation of chemical pretreatment of contaminated soil
for improved PAH bioremediation Appl Microbiol Biotechnol 65 627-634
Rafin C Veignie E Fayeulle A amp Surpateanu G 2009 Benzo[a]pyrene degradation using
simultaneously combined chemical oxidation biotreatment with Fusarium solani and
cyclodextrins Bioresource Technol 100 3157-3160
Roggenkamp A 2007 Phylogenetic analysis of enteric species of the family
Enterobacteriaceae using the oric-iocus Syst Appl Microbiol 30 180-188
Capiacutetulo 2 Effect of surfactant on PAH biodegradation and on the dynamic of the community
112
Samantha SK Singh OV amp Jain RK 2002 Polycyclic aromatic hydrocarbons
environmental pollution and bioremediation Trends Biotechnol 20 243-248
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil in Singh
A Kuhad RC Ward OP (Eds) Adv Appl Biorem p 103-121 Springer Berlin
Tao X-Q Lu G-N Dang Z Yi X-Y amp Yang C 2007 Isolation of ohenanthrene-degrading
bacteria and characterization of phenanthrene metabolites Worl J Biotechnol 23
647-6554
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities Syst Appl Microbiol 29 244ndash252
Torsvik V amp Ovreas L 2002 Microbial diversity and function in soil from genes to
ecosystems Curr Opin Microbiol 5 240ndash245
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Mar Eco- Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Zocca C Gregori SD VisentiniF amp Vallini G 2004 Biodiversity amongst cultivable
polycyclic aromatic hydrocarbon-transforming bacteria isolated from an abandoned
industrial site FEMS Microbiol Lett 238 375-382
Capiacutetulo
Enviado a FEMS Microbiology Ecology en Diciembre 2012
Simarro R Gonzaacutelez N Bautista LF amp Molina MC
High molecular weight PAH biodegradation by a wood degrading
bacterial consortium at low temperatures
Biodegradacioacuten de hidrocarburos de alto peso molecular por un consorcio bacteriano
degradador de madera a bajas temperaturas
3
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
115
Abstract
The aim of this work was to evaluate the ability of two bacterial consortia (C2PL05 and
BOS08) extracted from very different environments to degrade low (naphthalene
phenanthrene anthracene) and high (pyrene and perylene) molecular weight polycyclic
aromatic hydrocarbons (PAH) at high (15-25ordmC) and low (5-15ordmC) temperature ranges
C2PL05 was isolated from a soil in an area chronically and heavily contaminated with
petroleum hydrocarbons and BOS08 from decomposing wood in an unpolluted forest free of
PAH Bacterial consortia were described by cultivable and no-cultivable techniques (DGGE)
PAH-degrading bacterial population measured by most probable number (MPN)
enumeration increased during the exponential phase Toxicity estimated by MicrotoxTM
method was reduced to low levels and the final PAH depletion determined by high-
performance liquid chromatography (HPLC) confirmed the high degree of low and high
molecular weight PAH degradation capacity of both consortia The PAH degrading capacity
was also confirmed at low temperatures and specially by consortium BOS08 where strains
of Acinetobacter sp Pseudomonas sp Ralstonia sp and Microbacterium sp were identified
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
117
Introcuduction
Polycyclic aromatic hydrocarbons (PAH) constitute a diverse class of organic compounds
formed by two or more aromatic rings in several structural configurations having
carcinogenic mutagenic and toxic properties Therefore environment contamination by PAH
is currently a problem of concern and it has been shown that bioremediation is the most
efficient practice retrieving the original conditions of the ecosystem (Haritash amp Kaushik
2009) However the high molecular weight PAH (HMW-PAH) such as pyrene
benzo[a]pyrene or benzo[b]fluoranthene are generally recalcitrant and resistant to microbial
attack due to their low solubility and bioavailability Therefore these compounds are highly
persistent in the environment and bioaccumulated in organisms (Lafortune et al 2009)
Studies on PAH biodegradation with less than three rings have been the subject of many
reviews (ie Sutherland et al 1995) However there is a lack of knowledge about the
HMWndashPAH biodegradation (Kanaly amp Harayama 2000)
Microbial communities play an important role in the biological removal of pollutants in
soils (MacNaughton et al 1999) Therefore changes in environmental condition may alter
species diversity of the soil microbiota and their metabolic rates (Margesin amp Schinner
2001) In areas chronically polluted by PAH there are abundant bacteria able to degrade
those toxic contaminants by using them as sole carbon and energy sources (Taketani et al
2010) Recent works (Tian et al 2008 Surridge et al 2009 Couling et al 2010) have
reported the potential ability to degrade PAH by microorganisms apparently not previously
exposed to those toxic compounds This is extensively known for lignin degrading white rot-
fungi that produce a set of extracellular enzymes such as oxidases and peroxidases (Wong
2009) with low substrate specificity that expand their oxidative action beyond lignin being
capable to degrade other complex phenolic compounds and PAH (ie Canet et al 2001)
Although less extensively than in fungus PAH degradation capacity have been also reported
in this type of environment in bacteria belonged to genera Pseudomonas (Zimmermann
1990 McMahon et al 2007) However according to Couling et al (2010) the wide-spread
capacity to degrade PAH by microbial communities even from unpolluted soils can be
explained by the fact that PAH are ubiquitously distributed by natural process throughout the
environment at low concentration enough for bacteria to develop degrading capacity
Regardless of these issues there are some abiotic factors such as temperature that
may greatly influence biodegradation process It has been shown (Mohn amp Stewart 2000)
that although biodegradation of PAH is more efficient in the range 20-30 ordmC it can be carried
out even in colder (lt5 ordmC) environments (Eriksson et al 2001) At low temperature diffusion
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
118
and solution rates and so bioavailability of PAH decreases (Haritash amp Kaushik 2009)
Simultaneously the microbial metabolism is slowed-down increasing the lag period (Atlas amp
Bartha 1972 Eriksson et al 2001) However and according to the hypothesis that
degrading microorganisms are present in most of ecosystems there are degrading bacteria
adapted to low temperatures (Yakimov et al 2003 Brakstad amp Bonaunet 2006) that can
express degrading capacity So the study of biodegradation at low temperatures is important
since the temperature of more than 90 of the seawater volume is below 5 ordmC In addition
PAH and anthropic discharges sometimes have occurred and may occur in sea water (Bode
et al 2006 Soriano et al 2006) or in cold and even extreme environments such as in
Alaska (Bence et al 1996)
The main goal of this work was to study the effect of low temperature on HMW-PAH
degradation rate by two different consortia isolated from two different environments one from
decay wood in an unpolluted forest (consortium BOS08) and other from a polluted soil
exposed to hydrocarbons The purpose of the present work was also to describe the
microbial dynamics along the biodegradation process as a function of temperature and type
of consortium used
Materials and methods
Chemicals and media
Naphthalene phenanthrene anthracene pyrene and perylene (all gt99 purity) purchased
from Sigma-Aldrich (Steinheim Germany) and Fluka (Steinheim Germany) were prepared
in a stock solution in n-hexane (Fluka Steinheim Germany) to get a final concentration of
002 gl-1 for naphthalene phenanthrene and anthracene 001 gl-1 for pyrene and 0005 gl -1
for perylene Tween-80 purchased from Sigma-Aldrich was added according to previously
work (Bautista et al 2009) Composition of optimized Bushnell Haas Broth medium (BHB)
(Simarro et al 2010) was 02 g l -1 MgSO4middot7H2O 002 g l -1 CaCl2 2H2O 0088 g l -1 KHPO4
0088 g l -1 K2HPO4 209 g l -1 NaNO3 0015 g l -1 Fe2(SO4)3
Physicochemical characterization of soils and isolation of bacterial consortia
Consortia C2PL05 was isolated from a permanently polluted soil from a petroleum refinery
(Ciudad Real Spain) with a range of environmental temperatures from 10 ordmC in winter to 25
ordmC in summer The consortium BOS08 was extracted from dead wood in a pristine Atlantic
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
119
forest in Fragas do Eume Galicia Spain (latitude 43ordm 4175acute north longitude 8ordm 0683acute west)
with oaks as the dominant flora species and with a range of temperatures of 10 ordmC in winter
and 18 ordmC in summer To obtain the microbial consortia sieved soil and the wood sample
were suspended in PBS (110) and stirred overnight at 25 ordmC Then 15 ml of each extract
was inoculated in 50 ml of BHB (pH 70) with Tween-80 1 (vv) as surfactant and
naphthalene phenanthrene anthracene pyrene and perylene (each at 500 mg l -1) as carbon
sources Each culture were incubated in an orbital shaker at 150 rpm 25 ordmC and dark
conditions until the exponential phase was completed (asymp 5 days) monitoring cell density by
absorbance at 600 nm in a spectrophotometer (Spectronic Genesys Thermo Fisher
Scientific Loughborough Leicestershire UK)
Sieved (lt2 mm) river sand was used as substrate Prior to use it was burned at 550
ordmC in a furnace to remove organic matter and microorganisms Water holding capacity (WHC)
of the river sand was measured following the method described by Wilke (2005)
Experimental design and treatments conditions
15 microcosms (triplicates by five different incubation times) were performed with consortium
C2PL05 at high temperature range (H) 16 hours with light at 25 ordmC followed by 8 hours in
the dark at 15 ordmC Another 15 microcosms with consortium C2PL05 were incubated at low
temperature range (L) 16 hours with light at 15 ordmC followed by 8 hours in the dark at 5 ordmC
The same experiments were performed with consortium BOS08 Microcosms were incubated
in suitable chambers equipped with temperature lightdarkness cycle and humidity (60)
control systems Each microcosms contained 90 g of sterilized sand 18 ml of BHB (60 of
WHC) with Tween-80 1 (vv) 2 ml of PAH stock solution in n-hexane (final amount of PAH
per tray of 20 mg of naphthalene 20 mg of phenanthrene 20 mg of anthracene 10 mg of
pyrene and 5 mg of perylene) and 35 ml of bacterial consortium (0088 AU = 275x104
cellsmiddotml -1 for C2PL05 and 0051 AU = 286 x 104 cellsmiddotml-1 for BOS08)
Bacterial growth MPN and toxicity assays
Bacterial density during the PAH degrading process was monitored at 0 11 33 66 101 and
137 days by changes in the absorbance of the culture media at 600 nm in a
spectrophotometer (Spectronic GenesysTM England) From the absorbance data the
intrinsic growth rate in the exponential phase was calculated by applying Equation 1
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
120
1
1
ii
iii tt
AlnAlnexpA Equation 1
where A is the absorbance at 600 nm t is the time elapsed in hours and the subscript i
corresponds to each sample or sampling time Increments were normalized by
absorbance measurements at initial time (day 0) to correct the inoculum dilution effect
Heterotrophic and PAH-degrading population from the consortia were estimated by a
miniaturized most probably number technique (MPN) in 96-well microtiter plates with eight
replicate wells per dilution (Wrenn amp Venosa 1996) Total heterotrophic microbial population
was estimated in 180 μl of Luria Bertani (LB) medium with glucose (15 gl -1) and 20 microl of the
microbial consortium PAH-degrading population in the inoculum was estimated in 180 microl of
BHB medium containing Tween-80 (1 vv) 10 microl of PAH stock mix solution as only carbon
source (n-hexane was allowed to evaporate prior to inoculation) and 20 microl of the microbial
consortium in each well
Toxicity during the PAH degradation was also monitored through screening analysis of
the samples following the MicrotoxTM method with the luminescent bacterium Vibrio fischeri
following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15 ordmC
Monitoring of PAH biodegradation
To confirm that consortium BOS08 was not previously exposed to PAH samples were
extracted with acetone and n-hexane according to Joslashrgensen et al (2005) and the
identification was performed by GC-MS analysis of the extract A gas chromatograph (model
CP3800 Varian Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary
column (15 m length 025 mm ID 025 μm film thickness) was coupled to a quadruple
mass-spectrometer detector (Model 1200L Varian) The stationary phase was composed by
phenyl (5) and dimethylpolysiloxane (95) as carried gas ice in the mobile phase
Temperature gradient program used was initial temperature of 80 ordmC for 2 min temperature
increase to 300 ordmC at the rate of 1 ordmC min-1 final temperature of 300 ordmC for 15 min with a
final duration of the method of 39 min In addition total petroleum hydrocarbons (TPH) in
both soils were extracted and quantified as is described previously
PAH from microcosms were extracted and analyzed at initial and final time to estimate
the total percentage of PAH depletion by gas cromatography using the gas cromatograph
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
121
equiped and protocol described previuosly For this 100 g of soil from each replicate were
dried overnight at room temperature and PAH were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inyect 05 μl in
the FDI chromatograph
DNA extraction from cultured bacteria and phylogenetic analysis for characterization of the
PAH degrader consortium
To identify cultivable microorganisms samples from each microcosm were collected at zero
33 and 101 days of the biodegradation process To extract the microorganisms 15 g of soil
were suspended in PBS (110) and incubated overnight in an orbital shaker at 150 rpm
maintaining the same temperature and light conditions than during the incubation process
To get about 10 PAH-degrading colonies isolated 100 ml of the supernatant were placed
onto Petri plates with BHB medium and purified agar and were sprayed with a stock mix
solution of naphthalene phenanthrene anthracene pyrene and perylene (final concentration
500 mgL-1) as carbon source and incubated at the same temperature conditions
Total DNA of the PAH-degrading isolated cultures (DIC) was extracted using Microbial
DNA kit (MoBio Laboratories Solano Beach CA USA) and amplified using primers 16S F27
and 16S R1488 (Lane et al 1991) according to the ExTaq HS DNA polymerase protocol
(Molina et al 2009) Sequences were edited and assembled using ChromasPro software
version 142 (Technelysium Pty Ltd Tewantin Australia) to check for reading errors and
when possible resolving ambiguities BLAST search (Madden et al 1996 available at URL
httpncbinlmnihgovBLAST) was used to find nearly identical sequences for the 16S
rRNA sequences determined Sequences were aligned using the Q-INS-i algorithm (Katoh amp
Toh 2008a) of the multiple sequence alignment software MAFFT version 6611 (Katoh amp
Toh 2008b) aligning sequences in a single step
All identified sequence (by culture and no-culture techniques) and more similar
sequences downloaded from GenBank were used to perform the phylogenetic tree
Sequence divergence was computed in terms of the number of nucleotide differences per
site between of sequences according to the Jukes and Cantor algorithm (1969) The distance
matrix for all pairwise sequence combinations was analyzed with the neighbour-joining
method (NJ) of phylogenetic tree construction with 1000 bootstrap replicates using PAUP
40B10 (Swofford 2003) In addition maximum parsimony (MP) was also analyzed (Molina
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
122
et al 2009) Sequences of Aquifex piruphilus and Hydrogenobacter hydrogenophylus were
used as out-group
Denaturing gradient gel electrophoresis (DGGE) from microbial consortia during PAH
degrading process
A non culture-dependent molecular techniques as DGGE was performed to know the effect
of the temperature on total biodiversity of both microbial consortia during the PAH
degradation process by comparing the treatment at zero 33 and 101 day with the initial
composition of the consortia Total DNA was extracted from 025 g of the samples using
Microbial Power DNA isolation kit (MoBio Laboratories Solano Beach CA USA) and
amplified using the primers set 16S 338F-GC and 16S 518R according to ExTaq HS DNA
polymerase protocol (Promega Corp Madison WI USA) PCR product was loaded onto a
10 (wv) polyacrilamide gel with a denaturing gradient from 35 to 65 denaturant Gel
were stained with Syber-Gold and viewed under UV light and predominant bands in DGGE
gel were excised Due to impossibility to reamplify bands DNA of the bands was cloned in
the pGEM-T Easy Vector (Promega Madison WI) PAH-degrader uncultured bacterium
(DUB) were edited and assembled as described above and included in the matrix to perform
the phylogenetic tree Images of DGGE were digitalized and processed using the UN-Scan-It
gel analysis software version 60 (Silk Scientific US)
To identifiy the presence of fungi in the consortium BOS08 during the process total
DNA was extracted from the samples using Microbial Power DNA isolation kit (MoBio
Laboratories Solano Beach CA USA) and amplified with the primers set 18S ITS1F and
ITS4 according to Quiagen Multiplex PCR kit protocol DNA of Clitocybe metachroa was
extracted using DNeasy Plant Mini Kit (Quiagen) from the mushroom for use as PCR
positive PCR products were visualized under UV light on an agarose gel (1 ) using Syber-
Gold as intercalating agent
Statistical analysis
In order to evaluate the effects of inocula type and temperature on the final percentage of
PAH depletion and on the intrinsic growth rate (μ) bifactorial analysis of variance (ANOVA)
were used The variances were checked for homogeneity by the Cochranacutes test Student-
Newman-Keuls (SNK) test was used to discriminate among different treatments after
significant F-test representing this difference by letters in the graphs Data were considered
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
123
significant when p-value was lt 005 All tests were done with the software Statistica 60 for
Windows Differences in microbial assemblages were graphically evaluated for each factor
combination (time type of consortium and temperature) with a non-metric multidimensional
scaling (MDS) using PRIMER software (Clarke 1993) SIMPER method was used to identify
the percent contribution of each band from DGGE to the dissimilarity or similarity in microbial
assemblages between and within combination of factors Based on Viejo (2009) bands were
considered ldquohighly influentialrdquo if they contributed to the first 60 of cumulative percentage of
average dissimilaritysimilarity betweenwithin combination of factors
Results
Hydrocarbons in soils
Figure 1 shows GC-MS analysis of the extracted hydrocarbons from samples where both
consortia were isolated Soil samples where C2PL05 consortium was isolated contained 64
wt of total petroleum hydrocarbons (TPH) However no traces of PAH or any other
petroleum hydrocarbons were detected within samples where BOS08 consortium was
obtained
0 5 10 15 20 25 30 35
BO S08
C 2PL05
tim e (m in)
Figure 1 GC-MS total ion chromatogram from solvent extracted hydrocarbons in soils where
consortia C2PL05 and BOS08 were isolated
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
124
Cell growth intrinsic growth MPN and toxicity assays
Figure 2 (A B) shows the growth of both microbial consortia during PAH biodegradation
process Lag phases were absent and long exponential phases (until day 66 approximately)
were observed in all treatments except with the C2PL05 consortium at low temperature
(finished at day 11) In general higher cell densities were achieved in those microcosms
incubated in the higher temperature range Despite similar cell densities reached with both
consortia and both temperature levels the values of the intrinsic growth rate (μ) during the
exponential phase (Table 1) showed significant differences between consortia and
temperatures of incubation but not in their interaction (Table 2A) Differences between
treatments showed that the highest μ was obtained at high temperatures (25 ordmC-15 ordmC) and
with BOS08 consortium
Figure 2 (C D) showed that the initial number of PAH-degrading bacteria were at least
one order of magnitude lower than heterotrophic bacteria in both consortia The highest
heterotrophic bacteria concentration was reached after 33 days of incubation approximately
to a final value of 108- 109 cells g-1 soil (four orders of magnitude above the initial values)
The highest contribution of PAH-degrading bacteria to total heterotrophic bacteria was
observed at 33 days of incubation No differences were observed between temperature
ranges From 33 days both type of populations started to decrease but PAH-degrading
bacteria of consortia increased again at 101 days reaching values at the end of the process
similar to the initial ones
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
125
0 11 33 66 101 137
005
010
015
020
025
030
035
0 11 33 66 101 137
0 33 101 137102
103
104
105
106
107
108
109
0 33 101 137Time (day)Time (day)
Time (day)
Abs
orba
nce 6
00nm
(A
U)
Time (day)
DC
BA
cell
g so
il
Figure 2 Cell growth of consortia C2PL05 (A) and BOS08 (B) at high () and low () temperature
range during PAH biodegradation and MPN for consortia C2PL05 (C) and BOS08 (D) of heterotrophic
(squares) and PAH-degrading (circles) cultivated at high (filled symbols) and low (empty symbols)
temperature range
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
126
Table 1 Intrinsic growth rate (μ) and biodegradation percentage of phenanthrene (Phe) anthracene
(Ant) pyrene (Pyr) perilene (Per) and total PAH (Tot) at final time for consortia C2PL05 and BOS08 at
high (H) and low (L) temperature range Superscript letters (a to c) show differences between groups
(plt005 SNK) and plusmn SD the standard deviation
μ
Treatment d-1x10-3 plusmnSD x10-3
C2PL05 H 158 b 09 C2PL05 L 105 a 17
BOS08 H 241 c 17
BOS08 L 189 b 12
PAH biodegradation ()
Treatment Phe plusmn SD Ant plusmn SD Pyr plusmn SD Per plusmn SD Total plusmn SD
C2PL05 H 954 plusmn 04 993 plusmn 01 270 plusmn 62 986 plusmn 01 989 c plusmn 04
C2PL05 L 801 plusmn 61 459 plusmn 158 470 plusmn 118 538 plusmn 190 543 a plusmn 109
BOS08 H 938 plusmn 27 993 plusmn 04 472 plusmn 130 864 plusmn 61 866 bc plusmn 60
BOS08 L 940 plusmn 31 579 plusmn 31 542 plusmn 102 691 plusmn 137 677 ab plusmn 77
Table 2 Analysis of variance (ANOVA) of the effects on μ (A) total PAH biodegradation (B) and
biodegradation of pyrene and perilene (C) SS is the sum of squares and df the degree of freedoms
Factor df SS F
p-value
A) μ
Temperature a 1 36 x 10-3 5931 Consortium b 1 83 x 10-5 136
Temperature x Consortium 1 20 x 10-4 343 ns
Error 8 49 x 10-5 0001
B) Total PAH biodegradation ()
Treatment c 3 3526 73
Error 8 1281
C) Biodegradation of pyrene and perilene ()
Treatment c 3 11249 11 ns
PAH d 1 85098 251
Treatment x PAH 3 31949 31 ns
Error 16 54225
a high (15-25ordmC) or low (5-15ordmC) temperature range b consortium C2PL05 or BOS08 c C2PL05 at
high and temperature range or BOS08 at high and low temperature range d naphthalene
phenanthrene anthracene pyrene and perylene p lt 005 p lt 001 p lt 0001
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
127
With regard to toxicity values (Figure 3) complete detoxification were achieved at the
end of each treatment except for consortium C2PL05 (percentage of toxicity 40) incubated
at low temperature (Figure 3A) When consortium BOS08 was incubated at low temperature
there was a time period between 11 and 66 days that toxicity increased (Figure 3B)
0 11 33 66 101 137
0
20
40
60
80
100
0 11 33 66 101 137
BA
Time (day)
Tox
icity
(
)
Time (day)
Figure 3 Toxicity of microcosms with consortium C2PL05 (A) and BOS08 (B) incubated at high ()
and low () temperature range during PAH biodegradation process
Biodegradation of PAH
PAH biodegradation results are shown in Table 1 PAH depletion showed significantly
differences (Table 2B) within the consortium C2PL05 with highest values at high temperature
and the lowest at low temperature (Table 1) Those differences were not observed within the
BOS08 consortium and PAH depletion showed average values between values of C2PL05
depletion Regarding each individual PAH naphthalene was completely degraded at final
time 80 of phenanthrene was depleted in all treatments and anthracene and perylene
were further reduced at high (gt85) rather than low temperature (gt50) However pyrene
was significantly less consumed by the consortia than perylene (Table 1 and Table 2C)
Phylogenetic analyses
Phylogenetic relationships of the degrading isolated cultures and degrading uncultured
bacteria are shown in Figure 4 The aligned matrix contains 1349 unambiguous nucleotide
position characters with 505 parsimony-informative and 173 characters excluded Parsimony
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
128
analysis of the data matrix yielded 87 parsimonious trees with CI = 0756 RI = 0945 and a
length of 1096 Figure 4 also shows the topology of the neighbour joining tree
Inconsistencies were not found when analysing boostrap values of neighbour joining (NJ)
and maximum parsimony (MP)
Figure 4 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrader isolated culture (DIC) and degrading uncultured bacteria (DUB) obtained from DGGE of the
consortia and cultivable identification process at day 0 33 and Boostrap values of neighbour joining
(NJ) and parsimonious (MP) are showed on the branch of the tree (NJMP) No incongruence between
parsimony and neighbour joining topology were detected Pseudomonas genus has been designated
as P Psychrobacter genus as Ps Acinetobacter as A and Ralstonia as R T= type strain
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
129
DIC-46-RS (Rhodococcus sp) DIC-47RS (Bacillus psychrodurans) and DUB-25RS
(Microbacterium sp) were not included in the phylogenetic tree due to their high phylogenetic
distance with most of the DIC and DUB Phylogenetic tree was composed by bacteria
belonged to γ- and β-Proteobacteria Group of γ- Proteobacteria was composed by
Acinetobacter clade Psychrobacter clade and Pseudomonas clade whereas β-
Proteobacteria group was only composed by Ralstonia clade Within Acinetobacter clade
although the identity approximation (BLAST option Genbank) reported A johnsonii and A
haemolyicus such as the species closest to some of the DIC and DUB the incorporation of
the types strains in the phylogenetic tree species do not showed a clear monophyletic group
Thus and as a restriction molecular identification of these strains (Table 3) was exclusively
restricted to genus level that is Actinobacter sp A similar criteria was taken for
Pseudomonas clade where molecular identifications carry out through BLAST were not
supported by the monophyletic hypothesis when type strains were included in the analysis
Psycrobacter clade sister group of Acinetobacter clade are represented by Psychrobacter
urativorans type strain (DQ143924T) in which DIC-14RS and DIC-23RS are nested β-
Proteobacteria is only composed by Ralstonia clade confirmed by RinsidiosaT (FJ772078T)
although DICs included in this clade are more related with the strain Ralsonia sp AF488779
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
130
Table 3 Identification and similarity () to bacteria from GenBank of cultivable strains
and DGGE bands (non-cultivable bacteria)
Days Consortium Temperature Strains Molecular Identification
(genera) 33
C2PL05
15 ordmC-5 ordmC
DIC-7RS DIC-8RS DIC-9RS DIC-11RS DIC-10RS DIC-12RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-13RS DIC-14RS DIC-15RS DIC-46RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Psychrobacter urativorans Pseudomonas sp Rhodococcus sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-16RS DIC-17RS DIC-18RS DIC-19RS DIC-20RS DIC-21RS DIC-22RS DUB-25RS DUB-26RS
Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Ralstonia sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-23RS DIC-47RS DUB-22RS DUB-23RS DUB-24RS DUB-25RS DUB-26RS
Psychrobacter urativorans Bacillus psychrodurans Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
101
C2PL05
15ordmC-5ordmC
DIC-24RS DIC-25RS DIC-26RS DIC-27RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
25 ordmC-15 ordmC
DIC-28RS DIC-29RS DIC-30RS DIC-31RS DIC-32RS DUB-24RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
BOS08
15 ordmC-5 ordmC
DIC-33RS DIC-34RS DIC-35RS DIC-36RS DIC-37RS DIC-38RS DIC-39RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Microbacterium sp Acinetobacter sp
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
131
25 ordmC-15 ordmC
DIC-40RS DIC-41RS DIC-42RS DIC-43RS DIC-44RS DIC-45RS DUB-25RS DUB-26RS
Acinetobacter sp Acinetobacter sp Acinetobacter sp Acinetobacter sp Pseudomonas sp Pseudomonas sp Microbacterium sp Acinetobacter sp
Diversity and evolution of cultivated and uncultivated bacteria and dynamics during PAH
biodegradation
PCR analysis to identify fungal DNA in BOS08 was negative for the initial period of the
biodegradation process at both temperatures ranges Fungal DNA was only positive at high
temperatures and the end of the biodegradation process (101 and 137 days)
A minimum of 10 colonies were isolated and molecularly identified from the four
treatments at days 33 and 101 by cultivated methods The most influential bands of DGGE
to 60 of contribution to similarity (Figure 5 Table 4) according to the results of PRIMER
analysis were cloned and identified with the except of bands 2 4 27 and 36 that were not
cloned after several attempts likely due to DNA degradation The results of the identification
by cultivated and uncultivated methods (Table 3 Figure 5) show that different strains of
Acinetobacter (DUB-26RS uncultured Acinetobacter sp) and Microbacterium bands 24
(DUB-26RS uncultured Acinetobacter sp) and 22 (DUB-25RS Microbaterium sp)
respectively were always present in both consortia (Figure 5) both at high and low
temperatures However it should be also noted that Rhodococcus sp strains are unique to
C2PL05 consortium whereas Ralstonia sp and Bacillus sp were only found in BOS08
consortium being all of the above DIC strains (Table 3) In depth analysis of the community
of microorganisms through DGGE fingerprints and further identification of the bands allowed
to establish those bands responsible for the similarities between treatments (Table 4) and the
most influential factor MDS (Figure 6) shows that both time and temperature have and
important effects on C2PL05 microbial diversity whereas only time had effect on BOS08
consortium Both consortia tend to equal their microbial compositions as the exposed time
increase (Figure 6) The highest average of similarity (5327 ) was observed at day 101
being bands 36 4 (unidentified) and 24 (DUB-26RS Acinetobacter sp) responsible for that
similarity The lowest similarity (3543 ) was observed within the consortium C2PL05 (Table
4) being the high abundance of the band 20 (DUB-24RS Pseudomonas sp) and the lack of
the band 22 (DUB-25R Microbacterium sp) responsible of the dissimilarity Concluding it
can be observed that bands 20 (DUB-24RS Pseudomonas sp) 22 (DUB-25R
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
132
Microbacterium sp) 24 (DUB-26RS Acinetobacter sp) 36 and 4 (both unidentified) were
the most responsible for the similarity or dissimilarity between bacterial communities of
different treatments Another band showing lower contribution to these percentages but yet
cloned was band 12 from which two genotypes were identified (DUB-22RS and DUB-23RS)
as Pseudomonas sp Regarding to identification of DIC strains (Table 3) Rhodococcus sp
was exclusive of C2PL05 consortium and Ralstonia sp and Bacillus sp were only found in
BOS08 consortium
Table 4 Bands contribution to 60 similarity primer between treatments grouped by time type
of bacterial consortium and incubation temperature Average similarity of the groups determine
by SIMPER method
Time (day) Consortium Temperature
Band DUB 0 33 101 C2PL0 BOS0 High Low
22 DUB-25RS 2855 2789 2581 20 DUB-24RS 2993 2521 1797 2366
36 Unidentified 3546 1029 210
4 Unidentified 2855 1120 2362 1755 2315 175
27 Unidentified 139
2 Unidentified 1198
24 DUB-26RS 929
Cumulative similarity () 5710 5781 5595 6081 6134 5710 524Average similarity () 4433 4070 5327 3543 4660 4433 405
Unidentified bands from DGGE after several attempts to clone
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
133
Figure 5 Denaturant gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA gen
fragments from the consortium C2PL05 (line 1 to 5) and consortium BOS08 (line 6 to 10) Line 0
contains the molecular weight markers lines 1 and 6 correspond to initial time lines 2 and 7 to
high temperature range at day 33 lines 3 and 8 to high temperature range at day 101 lines 4
and 9 to low temperature range at day 33 and lines 5 and 10 to low temperature range at day
101
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
134
Figure 6 Multidimensional scaling (MDS) plot showing the similarity
between consortia BOS08 (BO) and C2PL05 (C2) incubated at low
(superscript L) and high (superscript H) temperature at day 0 33 and
101(subscripts 0 1 and 2 respectively)
Discussion
PAH degradation capability of bacterial consortia
Consortium BOS08 was isolated from a pristine soil since hydrocarbons and especially PAH
were not detected Opposite results were observed for samples where consortium C2PL05
was extracted with a large amount (64 wt) of petroleum compounds (ltC40) measured
However both consortia proved to be able to efficiently degrade HMW-PAH even at low
temperature range (5-15 ordmC) However both consortia have shown lower pyrene than
perylene depletion rates despite the former has lower molecular size and higher aqueous
solubility and bioavailability and lower hydrophobicity Previous work (Alves et al 2005)
have reported that UV and visible light can activate the chemical structure of some PAH
inducing changes in toxicity However whereas these authors classified phototoxicity of
pyrene and perylene as positive other phototoxic classifications (Mekenyan et al 1994)
consider pyrene as extremely toxic and perylene as moderately toxic So the high toxicity
level of pyrene due to phototoxic effect may explain the lower depletion rates of pyrene
opposite to that expected from their physicochemical properties above mentioned
Contrary to previous works (Spain amp ven Veld 1983 Jhonsen amp Karlson 2005) the
consortium BOS08 has not needed the pre-exposure to PAH to induce microbial adaptation
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
135
and consequently degradation of those pollutants In agreement with previous works
(Margesin amp Schinner 2001) our results have showed that the addition of PAH to the forest
consortium BOS08 was rapidly followed by an initial increase of PAH degrading bacteria
Considering the origin of consortium BOS08 extracted from a soil rich in organic matter and
decaying wood is possible that biodegradation process may be associated with wood
degrading bacteria and fungi However results confirmed that initial conditions when PAH
concentration was high fungi were not present Fungi appeared just at the end of the
biodegradation process (101 and 137 days) and only at high temperature when high PAH
concentration was already depleted and toxicity was low These results therefore confirm
that biodegradation process was mainly carried out by bacteria when PAH concentration and
toxicity were high
PAH degradation ability is a general characteristic present in some microbial
communities when community is exposed to PAH (Macleod amp Semple 2002 Jhonsen amp
Karlson 2005 Tian et al 2008) Microbial consortia were obtained from highly different
levels of contamination However although high differences were observed at the initial
microbial composition of both consortia they share some strains (Microbacterium sp and
Acinetobacter sp) The lower diversity found within the C2PL05 consortium (more details in
Molina et al 2009) obtained from a chronically and heavily polluted area with petroleum
hydrocarbons is typical of aged soils exposed to PAH These pollutants drive the selection of
specific bacteria that are able to degrade them (Vintildeas et al 2005)
Most of the identified species by DGGE (culture-independent rRNA approaches) in this
work were γ-proteobacteria (Pseudomonas and Acinetobacter) except DUB-26RS 98
similar to Microbacterium sp belonging to Actinobacteria phylum In agreement with previous
works (Harayama et al 2004) identification results retrieved by culture-dependent methods
showed some differences from those identified by the culture-independent rRNA
approaches DIC identified by culturable techniques belonged to a greater extend to
Proteobacteria phylum γ-Proteobacteria (Pseudomonas Pshycrobacter Acinetobacter) and
β-Proteobacteria (Ralstonia) Only two cultivable strains DIC-46RS and DIC-47RS identified
as Rhodococcus sp and Bacillus psychrodurans belonged to Actinobacteria and Firmicutes
phylum respectively Genera as Bacillus Pseudomonas and Ralstonia were identified within
the consortium BOS08 obtained from decaying wood in a pristine forest These genera are
typical from decomposing wood systems and have been previously mentioned as important
aerobic cellulose-degrading bacteria such as Bacillus sp (Lynd et al 2002) or degraders of
the highly oxidized oxalate (Pseudomonas sp Ralstonia sp) which is released by white-rot
fungi during degradation of lignocellulose (Dutton amp Evans 1996) Lignin is one of the most
slowly degraded components of dead plants and the major contributor to the formation of
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
136
humus as it decomposes The breakdown of lignin is mediated by extracellular enzymes
such as laccase lignin peroxidise and manganese peroxidase (Hatakka 1994 Hatakka
2001) The lack of specificity and the high oxidant activity of these enzymes make them able
to degrade different components as PAH (ie Pickard 1999) For this reason Bacillus
Pseudomonas and particularly Ralstonia identified within the consortium BOS08 and
typical from decomposing wood systems have been also previously identified as degrader of
aromatic compounds (Zhuang et al 2002 Chauhan et al 2008 Luo et al 2009) While
many eukaryotic laccases have been identified and studied laccase activity has been
reported in relatively few bacteria these include some strains identified in our decomposing
wood consortium BOS08 such as Ralstonia sp and Bacillus sp and others like Azospirillum
lipoferum Marinomonas mediterranea Amycolatopsis sp Streptomyces coelicolor
Arthrobacter cholorophenolicus and Rhodococcus opacus (McMahon et al 2007 Dawkar et
al 2009 Brown et al 2011)
HMW-PAH degradation at low temperatures
In the last 10 years research in regard to HMW-PAH biodegradation has been carried out
mainly through single bacterial strains or artificial microbial consortia and at optimal
temperatures (Kanaly amp Harayama 2000 Kanaly amp Harayama 2010) However there is a
lack of knowledge focused on HMW-PAH biodegradation at difficult conditions such as low
temperatures by full microbial consortia Temperature is a key factor in physicochemical
properties of PAH and in the control of PAH biodegradation metabolism in microorganisms
The diffusion rate of PAH into the aqueous phase increases with temperature and so PAH
bioavailability (Haritash amp Kaushik 2009) and PAH metabolism rate (Leahy amp Colwell 1990)
In agreement with previous results (Eriksson et al 2001) PAH biodegradation rates were
significantly higher at moderate temperatures (15-25 ordmC) because metabolic activity
diffusion and mass transfer was facilitated However there are also microorganisms with
capacity to efficiently degrade HMW-PAH even at lower temperatures (Margesin et al 2002)
as microorganisms present at both consortia (BOS08 and C2PL05)
Genera as Acinetobacter and Pseudomonas identified from both consortia growing at
low temperature have been previously reported as typical strains from cold and petroleum-
contaminated sites being capable to grow using solely hydrocarbons (MacCormack amp Fraile
1997 Eriksson et al 2003 Margesin et al 2003) According to previously works that
considered this genera as cold-tolerant (Margesin et al 2003 Ma et al 2006) our results
showed that they grow and efficiently degrade HMW-PAH at low temperature range (5-15 ordmC)
but with significantly lower rates than those at higher temperature In addition whereas time
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
137
was an influence factor in bacterial communities distribution temperature only affected to
C2PL05 consortium Possibly these results can be related with the environmental
temperature of the sites where consortia were extracted Whereas bacterial community of
BOS08 are adapted to temperatures below 20 ordmC all year C2PL05 consortium is adapted to
a range with maximum temperatures above 20 ordmC Hence although this consortium had cold-
tolerant species that degrade at low temperatures their probably less proportion than in the
BOS08 consortium resulted in differences between percentages of PAH depletion and
evolution of the bacterial community in function of temperature Therefore the cold-adapted
microorganisms are important for the in-situ biodegradation in cold environments
Acknowledgements
This work has been funded by the Spanish Ministery of Enviroment (Projects 11-37320053-
B and 0120062-11) and by Fundacioacuten Alfonso Martiacuten Escudero
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
138
References
amp Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int Biodet
Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bode A Gonzaacutelez N Lorenzo J Valencia J Varela MM amp Varela M 2006 Enhanced
bacterioplankton activity after the Prestige oil spill off Galicia NW Spain Aquatic
Microb Ecol 43 33-41
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0ndash5degC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Brown ME Walker MC Nakashige TG Iavarone AT amp Chang M 2011 Discovery and
characterization of heme enzymes from unsequenced bacteria Application to microbial
lignin degradation J Am Chem Soc 4518006-18009
Canet R Birnstingl JG Malcolm DG Lopez-Real JM amp Beck AJ 2001 Biodegradation
of polycyclic aromatic hydrocarbons (PAH) by native microflora and combinations of
white-rot fungi in a coal-tar contaminated soil Bioresource Technol 76113-117
Chauhan A Fazlurrahman Oakeshot JG amp Jain RK 2008 Bacterial metabolism of
polycyclic aromatic hydrocarbons strategies for bioremediation Indian J Microbiol 48
95-113
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158 3411-
3420
Dawkar VV Jadhav UU Telke AA amp Govindwar SP 2009 Peroxidase from Bacillus sp
VUS and its role in the decolorization of textile dyes Biotechnol Bioprocess Eng 14
361-368
Dutton MV amp Evans CS 1996 Oxalate production by fungi its role in pathogenicity and
ecology in the soil environment Can J Microbiol 42 881ndash895
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
139
Eriksson M Jong-Ok Ka amp Mohn WW 2001 Effects of low temperature and freeze-thaw
cycles on hydrocarbon biodegradation in Arctic Tundra soil Appl Environ Microbiol
675107-5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Harayama S Kasai Y amp Hara A 2004 Microbial communities in oil-contaminated seawater
Curr Opin Biotechnol 15 205-214
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of Polycoilyclic aromatic
hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microb Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M Steinbuchel A(eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Johonsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-
does it depend on PAH exposure Microb Ecol 50 488ndash495
Joslashrgensen KS Jaumlrvinen O Sainio P Salminen J amp Suortti AM 2005 Quantification of
soil contamination In Margesin R Schinner F (eds) Manual of soil analysis
monitoring and assessing soil bioremediation Springer Berlin pp 97-119
Kanaly RA amp Harayama S 2000 Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059ndash2067
Kanaly RA amp Harayama S 2010 Advances in the field of high-molecular-weight polycyclic
aromatic hydrocarbon biodegradation by bacteria Microb Biotechnol 3 136ndash164
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Lafortune I Juteau P Deacuteziel E Leacutepine F Beaudet R amp Villemur R 2009 Bacterial
diversity of a consortium degrading high-molecular-weight polycyclic aromatic
hydrocarbons in a two-liquid phase biosystem Microb Ecol 57 455-468
Lane DJ 1991 16S23S sequencing In E Stackebrandt and M Goodfellow (ed) Nucleic
acid techniques in bacterial systematic John Wiley amp Sons Chischester UK
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environments
Microbiol Rev 54 305-315
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
140
Luo YR Tian Y Huang X Yan CL Hong HS Lin GH amp Zheng TL 2009 Analysis of
community structure of a microbial consortium capable of degrading benzo(a)pyrene
by DGGE Marine Poll Bull 58 1159-1163
Lynd LR Weimer PJ van Zyl WH amp Pretorius IS 2002 Microbial cellulose utilization
fundamentals and biotechnology Microbiol Mol Biol Rev 66 506ndash577
MacCormack WP amp Fraile ER 1997 Characterization of a hydrocarbon degrading
psychrotrophic Antarctic bacterium Antarct Sci 9 150-155
Macleod CJA amp Semple KT 2002 The adaptation of two similar soils to pyrene catabolism
Environ Pollut 119357-364
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill Appl
Environ Microbiol 65 3566-3574
Madden TL Tatusov RL Zhang J 1996 Applications of network BLAST server Method
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts Extremophiles
7451ndash458
McMahon AM Doyle EM Brooksm S amp OacuteConnor KE 2007 Biochemical
charcaterization of the coexisting tyrosinase and laccase in the soil bacterium
Pseudomonas putida F6 Enzyme Microb Tech 401435-1441
Mekenyan OG Ankly GT Veith GD amp Call DJ 1994 QSAR for photoinduced toxicity I
Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere
28 567
Microbics Corporation 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mohn WW amp Stewart GR 2000 Limiting factors for hydrocarbon biodegradation at low
temperature in Artic soils Soil Biol Biochem 321161-1172
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Pickard MA Roman R Tinoco R Vazquez-Duhalt R 1999 Polycyclic aromatic
hydrocarbon metabolism by white rot fungi and oxidation by Coriolopsis gallica UAMH
8260 laccase Appl Environ Microbiol 65 3805-3809
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
141
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2010 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Poll 217 365-374
Soriano JA Vintildeas L Franco MA Gonzaacutelez JJ Ortiz L Bayona JM amp Albaigeacutes J 2006
Spatial and temporal trends of petroleum hydrocarbons in wild mussels from the
Galician coast (NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-
90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Surridge AKJ Wehner FC amp Cloete TE 2009 Bioremediation of Polluted Soil In Singh
A Kuhad RC Ward OP (eds) Adv Appl Biorem 103-121 Springer Berliacuten
Sutherland JB Rafii F Khan AA amp Cerniglia CE 1995 Mechanisms of polycyclic
aromatic hydrocarbon degradation p 269ndash306 In L Y Young and C E Cerniglia
(ed) Microbial transformation and degradation of toxic organic chemicals Wiley-Liss
New York NY
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of Xiamen
China Marine Pollut Bull 56 1184-1191
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-95
Wong WSD 2009 Structure and action of ligninolytic enzymes Appl Biochem Biotechnol
157 174-209
Wrenn BA amp Venosa AD 1996 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Capiacutetulo 3 HMW-PAH biodegradation by a wood bacterial consortium at low temperatures
142
Yakimov MM Giuliano L Gentile G Crisafi E Chernikova TN Abraham W-R Luumlnsdorf
H Timmis KN amp Golyshin PN 2003 Oleispira antarctica gen nov sp nov a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water Int J
System Evol Microbiol 53779-785
Zhuang W-Q Tay J-H Maszenan AM amp Tay STL 2002 Bacillus naphthovorans spnov
from oil contaminated tropical marine sediments and its role in naphthalene
biodegradation ApplMicrobiol Biotechnol 58547-553
Zimmermann W 1990 Degradation of lignin by bacteria J Biotechnol 13119-130
Proteobacteria
Capiacutetulo
Manuscrito ineacutedito
Simarro R Gonzaacutelez N Bautista LF Molina MC Peacuterez M amp Peacuterez L
Assessment the efficient of bioremediation techniques (biostimulation bioaugmentation
and natural attenuation) in a creosote polluted soil change in bacterial community
Evaluacioacuten de la eficacia de teacutecnicas de biorremediacioacuten (bioestimulacioacuten bioaumento y
atenuacioacuten natural) en un suelo contaminado con creosota cambios en la comunidad bacteriana
4
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
145
Abstract
The aim of the present work was to assess different bioremediation treatments
(bioaugmentation bioestimulation combination of both and natural attenuation) applied to a
creosote polluted soil with a purpose of determine the most effective technique in removal of
pollutant Toxicity microbial respiration degradation of creosote and PAH (antharcene
phenathrene and pyrene) as well as evolution of bacterial communities by non culture-
dependent molecular technique DGGE were analyzed Results showed that creosote was
degraded through time without significant differences between treatments but PAH were
better degraded by treatment with biostimulation Low temperatures at which the process
was developed negatively conditioned the degradation rates and microbial metabolism as
show our results DGGE results revealed that biostimulated treatment displayed the highest
microbial biodiversity However at the end of the bioremediation process no treatment
showed a similar community to autochthonous consortium The degrader uncultured bacteria
identified belonged to Pseudomonas Sphingomonas Flexibacter all of them involved in
degradation process Particularly interesting was the identification of two uncultured bacteria
belonged to genera Pantoea and Balneimonas did not previously describe as such
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
147
Introduction
Creosote is a persistent chemical compound derived from burning carbons as coal between
900-1200 ordmC and has been used as a wood preservative It is composed of approximately
85 polycyclic aromatic hydrocarbons (PAH) 10 phenolic compounds and 5 nitrogen
and sulfur PAH are a class of fused-aromatic compounds toxic mutagenic bioaccumulative
and persistent in the environment and so the United State Environmental Protection Agency
(US EPA) considered that the removal of these compounds is important and priority Against
physical and chemical methods bioremediation is the most effective versatile and
economical technique to eliminate PAH Microbial degradation is the main process in natural
decontamination and in the biological removal of pollutants in soils chronically contaminated
(MacNaughton et al 1999) in which degrading-bacteria are abundant (Taketani et al
2010) However recently works have reported (Tian et al 2008 Couling et al 2010) the
potential ability to degrade PAH of microorganisms from soils apparently not exposed
previously to those toxic compounds The technique based on this degradation capacity of
indigenous bacteria is the natural attenuation This technique avoid damage in the habitat
(Dowty et al 2001) allowing to retrieve the original conditions of the ecosystem converting
the toxic compounds into harmless (Kaplan amp Kitts 2004 Haritash amp Kaushik 2009)
However this method require a long period or time to remove the toxic components because
the number of degrading microorganisms in soils only represents about 10 of the total
population (Yu et al 2005a) Many of the bioremediation studies are focused on the
bioaugmentation which consist in the inoculation of allochthonous degrading
microorganisms (ie Atagana 2006) However bioaugmentation is a complicate technique
to study because a negative or positive effect depends on the interaction between the
inocula and the indigenous population due to the competition for resources mainly nutrients
(Yu et al 2005b) Other bioremediation techniques as biostimulation consist in to empower
the degrading capacity of the indigenous community by the addition of nutrients to avoid
metabolic limitations (ie Vintildeas et al 2005)
However inconsistent results have been reported with all these previuos treatments
Previous studies have shown that biodegradation rates can be increased (Mills et al 2004)
and have no effect influenced negatively with biostimulation (Yu et al 2005a Chen et al
2008) Similar enhance of biodegradation rates (Atagana et al 2006) and not significant
differences (Vintildeas et al 2005 Yu et al 2005b) have been described with bioaugmentation
It is necessary taking in to account that each contaminated site can respond in a different
way (Vintildeas et al 2005) therefore to carry out an in situ bioremediation process it will be
necessary to design a laboratory-scale assays to determine what technique is more efficient
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
148
on the biodegradation process and the effect on the microbial diversity In addition
previously works (Gonzalez et al 2011) showed that although PAH were completely
consumed by microorganisms toxicity values remained above the threshold of the non-
toxicity Although most of the work not perform toxicity assays these are necessary to
determine effectiveness of a biodegradation The main goal of the present study is to
determine through a laboratory-scale assays the most effective bioremediation technique in
decontamination of creosote contaminated soil evaluating changes in bacterial community
and the toxicity values
Materials and methods
Chemical media and inoculated consortium
The fraction of creosote used in this study was composed of 26 of PAH (naphthalene
05 phenanthrene 51 anthracene 122 pyrene 31 dibenzofurane 13 and
acenaphthene47) Creosote was diluted in acetonitrile (purchased form Sigma Aldrich
Steinheim Germany) in a stock solution of a final concentration of 0439 gmiddotml-1 containing
0117 g PAHmiddotml-1 The culture mediums LuriandashBertani (LB) and Bushnell-Haas Broth (BHB)
were purchased from Panreac (Barcelona Spain) Biostimulated treatments were amended
with BHB as inorganic nutrients source which composition was optimized for PAH-degrading
consortium (C2PL05 consortium) in a previously work (Simarro et al 2010) with the optimum
composition 02 gmiddotlminus1 MgSO4 7H2O 002 gmiddotlminus1 CaCl2 2H2O 0281 gmiddotlminus1 KHPO4 0281 gmiddotlminus1
K2HPO4 002 gmiddotlminus1 NH4NO3 0195 gmiddotlminus1 Fe2(SO4)3 According to Bautista et al(2009) Tween-
80 was the optimal surfactant for PAH biodegradation by bacteria and was added in a critical
micellar concentration (CMC) of 300 μlmiddotml-1 (0012 mM) Bioaugmented treatments were
inoculated with the PAH-degrading consortium C2PL05 extracted from a permanently PAH
contaminated soil from a refinery in Ciudad Real (Spain) and previously identified and
described in Molina et al(2009)
Experimental design
Five different treatments in microcosms designated as T1 to T5 (see Table 1) were carried
out each in duplicate for five sampling times zero 6 40 145 and 176 days from December
2009 to May 2010 In total 40 microcosms containing 550g of natural soil samples collected
from an uncontaminated area of Rey Juan Carlos University in Madrid (Spain) were carried
out The soil obtained from the first top 20 cm and sieved by 2 mm was located in plastic
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
149
trays and randomly arranged outdoor in terrace and protected with a plastic to avoid the rain
and snow on them Each tray except the treatment T1 contained 56 ml of a creosote
solution in n-hexano (0439 g ml-1) with final amount of creosote per tray of 25 g
Microcosms were maintained at 40 of water holding capacity (WHC) considered as
optimum during bioremediation process (Vintildeas et al 2005) For biostimulation microcosms
samples were hydrated with the required amount of the optimum BHB while in treatment no
biostimulated samples were hydrated with only mili-Q water Bioaugmented treatments were
inoculated with 5ml of the consortium C2PL05 (2015x107 plusmn 427x106 cellsmiddotg soil-1 of
heterotrophic microorganisms and 177x105 plusmn 101x105 cellsmiddotg soil-1 of creosote-degrading
microorganisms)
Table 1 Summary of the treatment conditions
Code Treatments Conditions
T1 Untreated soil (control) Uncontaminated soil
T2 Natural attenuation Contaminated soil with 56 ml creosote moistened 40WHC
with 1054 ml mili-Q water
T3 Biostimulation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1104 ml BHB
T4 Bioaugmentation Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml mili-Q water 5 ml consortium
C2PL05
T5 Biostimulation
+ Bioaugmentation
Contaminated soil with 56 ml of creosote stock solution
moistened 40WHC with 1054 ml BHB inoculated with 5 ml
Characterization of soil and environmental conditions
The water holding capacity (WHC) was measured following the method described by Wilke
(2005) and the water content was calculated through the difference between the wet and dry
weigh after drying at 60ordmC during 1 hour pH was measured using a GLP 21 micro pHmeter
(Crison Barceona Spain) resuspending 1 g of the soil in mili-Q water (110) and incubating it
in an orbital shaker at 150 rpm at 25 ordmC during 1 h Temperature which the experiments were
developed was recorded on a temperature loggers (Tidbit Loggers Onset Computer
Pocasset Mass) located in the site
Total heterotrophic microorganisms (HM) and creosote-degrading microorganisms
(C-DM) of the microbial population of the natural soil was counted using a miniaturized most
probable number technique (MPN) in 96-well microtiter plates with eight replicates per
dilution (Wrenn amp Venosa 1996) The number of cells was calculated with Most Probable
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
150
Number Calculator software Version 404 (Klee 1993)To extract the microorganisms from
the soil 1 g of soil was resuspended in 10 ml of phosphate buffer saline (PBS) and was
shaker at 150 rpm at 25 ordmC during 24 h The HM were determined in 180 μl of LB medium
with glucose (15 gl-1) and C-DM were counted in 180 μl of BHB medium with 10 μl of
creosote stock solution as carbon source
Respiration and toxicity assays
To measure the respiration during the experiments 10 g of soil moistened with 232 ml of
mili-Q water (to maintain a water capacity of 40 WHC) was incubated in duplicate in a
desiccator during 14 days at 25ordmC Replicates contained 14 ml of NaOH 02 M to absorb the
CO2 produced by microorganisms The vials were periodically replaced and checked
calorimetrically with HCl (01M) and phenolphthalein as indicator The test was doing with
BaCl2 (01 M) in excess to ensure the precipitation of carbonates The numbers of moles of
CO2 produced were calculated as a difference between initial moles of NaOH in the
replicates and moles of NaOH checked with HCl (moles of NaOH free)
The toxicity evolution during the PAH degradation was also monitored through a short
screening of the samples with the Microtox TM method with the luminescent bacterium Vibrio
fischeri following the protocol suggested by Microbics Corporation (1992) The toxicity was
expressed as the percentage of the V fischeri inhibition after 15 min of incubation at 15ordmC
Monitoring the removal of creosote and polycyclic aromatic hydrocarbons
Organic compounds were extracted and analyzed from the microcosms samples at 0 6 40
145 and 176 days by gas chromatography-mass spectrometry (GC-MS) to estimate the
creosote and percentage of PAH depletion A gas cromatograph (model CP3800 Varian
Palo Alto CA USA) equipped with a Varian Factor Four VF-1ms capillary column (15 m
length 025 mm ID 025 μm film thickness) was coupled to a quadruple mass-spectrometer
detector (Model 1200L Varian) The stationary phase was composed by phenyl (5) and
dimethylpolysiloxane (95) as carried gas ice in the mobile phase Temperature gradient
program used was initial temperature of 80 ordmC for 2 min temperature increase to 300 ordmC at
the rate of 1ordmC min-1 final temperature of 300 ordmC for 15 min with a final duration of the
method of 39 min Organic compounds were extracted with 100 ml of dichloromethane
during 3 hours in a Soxhlet device The solvent was removed in a rotary evaporator and the
residue was dissolved in 1 ml of dichloromethane an encapsulated in a vial to inject 05 μl in
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
151
the FDI chromatograph The concentration of each PAH and creosote was calculated from
the chromatograph of the standard curves
DNA extraction molecular and phylogenetic analysis for characterization of the total
microbial population in the microcosms
Non culture-dependent molecular techniques as denaturing gradient gel electrophoresis
(DGGE) was performed to identify non-culture microorganisms and to compared the
biodiversity between treatments and its evolution at 145 and 176 days of the process Total
community DNA was extracted from 25 g of the soil samples using Microbial Power Soil
DNA isolation kit (MoBio Laboratories Solano Beach CA USA) In total suitable yields of
high molecular-weight DNA (5-20 μgg of soil-1) were obtained The V3 to V5 variable regions
of the 16S rRNA gene were amplified using the primers set 16S 518R and 16S 338F-GC
according to ExTaq HS DNA polymerase protocol (Promega Corp Madison WI USA)
Primer 338F-GC included a GC clamp at the 5acuteend (5acute-CGC CCG CCGCGC CCC GCG
CCC GTC CCG CCG CCC CCG CCC G-3acute) 20 μl of PCR product was loaded on to a 10
(wtvol) polyacrylamide gels that was 075mm tick and the denaturing gradients used ranged
from 35 to 65 denaturant (more details in Gonzalez et al 2011) Gel were stained with
Syber-Gold and viewed under UV light and predominant bands were excised and diluted in
50μl of mili-Q water Due to impossibility of reamplified bands DNA of the bands was cloned
in the pGEM-T Easy Vector (Promega Madison WI) Plasmids were purified using the High
Pure plasmid Isolation Kit (Roche) and sequenced using the internal primers 338F and 518R
Creosote-degrader uncultured bacterium (DUB) were edited and assembled using version
487 of the BioEdit program (Hall 1999) BLAST search (Madden et al 1996) was used to
find nearly identical sequences for the 16S rRNA sequences determined All DUB identified
sequence and 25 similar sequences downloaded from GenBank were used to perform the
phylogenetic tree Sequences were aligned using the Q-INS-i algorithm (Katoh amp Toh 2008a)
of the multiple sequence alignment software MAFFT version 6611 (Katoh amp Toh 2008b)
aligning sequences in a single step Sequence divergence was computed in terms of the
number of nucleotide differences per site between of sequences according to the Jukes and
Cantor algorithm (1969) The distance matrix for all pair wise sequence combinations was
analyzed with the neighbour-joining method (NJ) of phylogenetic tree construction with 1000
bootstrap replicates by using version PAUP 40B10 (Swofford 2003) In addition maximum
parsimony (MP) was also analyzed (Molina et al 2009) Sequences of Sphirochatea
americans belonged to Sphirochaetes phylum were used as out-group (Gupta amp Griffiths
2002) Images of DGGE were digitalized and DGGE bands were processed using the UN-
Scan-It gel analysis software version 60 (Silk Scientific US)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
152
Statistical analysis
In order to evaluate the effects of treatments on intrinsic growth rate (μ) toxicity degradation
of organic compounds and respiration analysis of variance (ANOVA) were used The
variances were checked for homogeneity by the Cochranacutes test Student-Newman-Keuls
(SNK) test was used to discriminate among different treatments after significant F-test
representing these differences by letters in the graphs Data were considered significant
when p-value was lt 005 All tests were done with the software Statistica 60 for Windows
Differences in microbial assemblages by biostimulation by bioaugmentation and by time
(145 and 176 days) were graphically evaluated with a non-metric multidimensional scaling
(MDS) using PRIMER software (Clarke 1993) The previous period to 145 days was
considered a period of cold conditions and the time from 145 to 176 days a period of higher
temperatures SIMPER method was used to identify the percent contribution of each band to
the similarity in microbial assemblages between factors Bands were considered ldquohighly
influentialrdquo if they contributed to the first 60 of cumulative percentage of average similarity
betweenwithin combination of factors In addition Shannon index (Hacute) was calculated from
DGGE bands applying equation 2 to estimate the ecological diversity of each treatment at
136 and 145 days
Equation 2
where pi is the proportion in the gel of the band i with respect to the total of all bands
detected calculated as coefficient between band intensity and total intensity of all
bands (Baek et al 2007)
Results
Physical chemical and biological characteristics of the natural soil used for the treatments
pH of the soil was slightly basic 84 and the water content of the soil was 10 although the
soil had a high WHC (521) possibly due to their sandy character Initial proportion of C-DM
from natural soil represented only 088 of the total heterotrophic population with a number
of microorganisms two order of magnitude higher (201 x 107 plusmn 427 x 106 cells g soil-1)
Figure 1 shows that the evolution of the monthly average temperature observed during the
experiment and the last 30 years Average temperature decreased progressively from
October to January from 16 ordmC to a minimum average of 6 ordmC starting to increase
progressively to reach a mean value of 21 ordmC in June
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
153
October
November
DecemberJanuary
FebruaryMarch
April MayJune
468
10121416182022
0 day
40 day
145 day
176 day
6 dayT
empe
ratu
re (
ordmC)
Month
Figure 1 evolution of the normal values of temperature (square) and evolution of
the monthly average temperature observed (circle) during the experiment
Respiration of the microbial population
Table 2A shows the ANOVA results concerning to the accumulated values of CO2 produced
for each treatment in each time period (from 0- to 6 days from 40 to 145 days and from 145
to 176 days) Due to interval time was the only significant factor (Table 2A) differences in
percentage of accumulative CO2 by sampling times (6 40 145 and 176 days) were analyzed
and showed in Figure 2 Differences between sampling times showed that the accumulated
percentage of CO2 was significantly higher at 176 days than at other time
6 40 145 17600
10x10-4
20x10-4
30x10-4
40x10-4
50x10-4
a a
b
aCO
2 mol
esg
of
soil
Time (days)
Figure 2 accumulated CO2 issue at 6 40 145 and 176 days Error bars show the
standard deviation and the letters show significant differences between groups
(plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
154
Toxicity assays
Changes on the toxicity during the creosote degradation process (Figure 3A) showed that all
treatments had a similar evolution T1 (uncontaminated) was not toxic (lt20 ) but toxicity of
treatments with creosote increased constantly from initial value of 26 to a values higher
than 50 Only during last period of time (145 to 176 days) toxicity started to decrease
slightly Despite similar toxicity values reached with the treatments interaction between time
periods (0 to 6 days 40 to 145 days and 145 to 176 days) and treatments showed significant
differences (Table 2B) Differences between groups by both significant factors (Figure 3B)
showed that toxicity of all treatments in first time period was significantly lower than in the
other periods Differences in toxicity between the two last periods were only significant for
treatment T4 in which toxicity increase progressively from the beginning
0 6 20 40 56 77 84 91 98 1051121251321411760
10
20
30
40
50
60
70
80
90
100 BA
Tox
icity
(
)
Time (days)T2 T3 T4 T5
c
c
c
b
c
bc
bcbc
aa
aa
Treatment
Figure 3 (A) evolution of the toxicity () of the treatment T1 (square) T2 (circle) T3 (triangle) T4
(inverted triangle) and T5 (rhombus) during the experiment (B) percentage of toxicity of the treatment
in the interval times 1 (black bars) from 0- to 6 days interval 2 (with bars) from 6 to 40 days and
interval 3 (gray bars) from 40 to 176 days Error bars show the standard deviation and letters
differences between groups
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
155
Biodegradation of creosote and polycyclic aromatic hydrocarbons
The results concerning the chromatography performed on the microcosms at 0 40 145 and
176 days are shown in Figure 4 Creosote depletion during first 40 days was very low
compared with the intensive degradation occurred from 40 to 145 days in which the greatest
amount of creosote was eliminated (asymp 60-80) In addition difference between residual
concentration of PAH at final time by type of PAH (phenanthrene anthracene and pyrene)
and treatment were analyzed (Table 2C) Both factor were significantly influential although
was not the interaction between them Differences by PAH (Figure 4B) showed that
anthracene degradation was significantly higher than other PAH and differences by
treatments (Figure 4C) showed that difference were only significant between treatment T3
and T2 lower in the treatment T3
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
156
T1 T2 T3 T4 T50000
0005
0010
0015
0020
0025
0030
0035
0040
g cr
eoso
te
g so
il
Phenanthrene Anthracene Pyrene0
102030405060708090
100
C
aab
abb
a
bb
B
A
Ave
rage
res
idua
l con
cenr
atio
n of
PA
H (
)
T2 T3 T4 T50
102030405060708090
100
Tot
al r
esid
ual c
once
ntra
tion
of
PA
H (
)
Figure 4 (A) creosote depletion during the experiment at sampling times 6 days (black
bars) 40 days (with bars) 145 days (grey bars) and 176 days ( ) (B) average residual
concentration at 176 days of the identified PAH (phenanthrene anthracene and pyrene)
and (B) average residual concentration of the identified PAH as a function of applied
treatment (C) Error bars show the standard error and the letters show significant
differences between groups (plt005 SNK)
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
157
Table 2 Analysis of variance (ANOVA) of the effects on the μ of the
heteroptrophic population (A) μ of the creosote degrading microorganisms (B)
accumulated value of CO2 (C) toxicity (D) and residual concentration of PAH (E) SS is
the sum of squares and df the degree of freedoms
Factor df SS F P
C) Accumulated value of CO2 (n=40) Time interval 3 65-5 3112
Treatment 4 60-6 202 ns
Interval x Treatment 12 11-5 134 ns
Error 20 14-5
D)Toxicity (n=24) Time interval 2 907133 11075
Treatment 3 12090 098 ns
Interval x Treatment 6 122138 497
Error 12 49143
E) Residual concentration of the PAH (n=24) Treatment 3 95148 548
PAH 2 168113 1452
Treatment x PAH 6 17847 051 ns
Error 12 69486
p-value lt 005
p-value lt 001
p-value lt 0001
Diversity and evolution of the uncultivated bacteria and dynamics during the PAH
degradation
The effects of different treatments on the structure and dynamics of the bacterial community
at 145 days and 176 days were analyzed by DGGE (Figure 5) At 145 days 8 bands (3 4 10
810 16 17 26 and 27 see Figure 5) were cloned and 6 different genotypes (DUB 12-RS to
DUB-17RS) were identified whereas at 176 days 5 bands (4 112 113 22 and 26 see
Figure 5) and 6 different genotypes (DUB-12RS DUB-13RS DUB-18RS DUB-19RS DUB-
20RS and DUB-21RS) were identified Most influential bands considered as 60 of
contribution to similarity according to the results of PRIMER analysis is showed at the Table
3 Similarities between treatments at 145 and 176 days were compared and analyzed as a
function of the addition of nutrients (biostimulated vs no biostimulated treatments) and the
addition of degrading consortium C2PL05 (bioaugmentated vs no bioaugmentated
treatments) The addition of nutrients was the factor that best explained differences between
treatments and so results in Table 3 are as a function of the addition of nutrients At 145
days no-biostimulated treatments T1 T2 and T4 were only similar in 402 whereas
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
158
biostimulated treatments (T3 and T5) were 6567 (Table 3) The patter were slightly
opposite at 176 days where no-biostimulated treatments were more similar (7026 ) than
biostimulated treatments (average similarity 4384 ) In addition at 145 days (Figure 6A)
natural attenuation (T2) was the only similar treatment to microbial community from the
uncontaminated treatment (T1) However at 176 days (Figure 6B) bacterial communities
from all treatments were highly different to the treatment T1 and there was no defined group
In addition PRIMER analysis allowed us to estimate the Shannon diversity index (Hacute) for
each treatments at 145 and 176 days indicating that the bacterial diversity increased for the
treatments T1 (3328) T3 (4154) and T5 (3739) remarkably higher in the treatment T4
Table 3 Bands contribution to 60 similarity primer between treatments grouped by
treatments biostimulated and no biostimulated at 145 days and 176 days Average
similarity of the groups determined by SIMPER method
145 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
3 DUB-12RS
DUB-17RS 2875
16 DUB-17RS 1826
17 DUB-12RS
DUB-16RS 1414
18 Unidentified 3363
19 Unidentified 3363
Cumulative similarity () 6725 6115 Average similarity () 402 6567
176 days
Band DUB No biostimulated (T1 T2 T4) Biostimulated (T3 T5)
11 Unidentified 2116 13 Unidentified 2078 1794
23 Unidentified 2225 2294
26 DUB-13RS 1296
Cumulative similarity () 6418 5383 Average similarity () 7026 4384
bands from DGGE unidentified after several attempts to clone
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
159
Figure 5 Denaturing gradient gel electrophoresis (DGGE) at 145 days (A) and 176 days (B) of PCR-
amplified 16S rDNA gen fragments from the consortium C2PL05 (lane B) control experiment (lane C)
treatment with natural attenuation T1 (lane T1)biostimulated treatment T2 (lane T2) bioaugmentated
treatment T3 (lane T3) bioaugmentated treatment T4 (lane T4) and biostimulated and
bioaugmentated treatment t5 (lane T5) Lane A is the molecular weigh marker Numbers are the
bands cloning
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
160
Figure 6 proximity analysis (MDS) based on the Bray-Curtis dissimilarity
matrix of each treatment from the bands obtained in DGGE at 145 days (A)
and 176 days (B)
Phylogenetic analyses
Phylogenetic relationships of the degrading uncultured bacteria are shown in Figure 7 The
aligned matrix contained 1373 unambiguous nucleotide position characters with 496
parsimony-informative Parsimony analysis of the data matrix yielded 87 parsimonious trees
with CI = 0671 RI = 0767 and a length of 1452 Figure 6 also shows the topology of the
maximum parsimony (MP) tree with the bootstrap values of the maximum parsimony and
neighbour joining analyses Inconsistencies were not found between parsimony and
neighbour joining (NJ) topology
Phylogenetic tree was composed by bacteria belonged to Proteobacteria (α- and γ-
Proteobacteria) and Bacteroidetes phylum From DUB-12RS to DUB-17RS were located in
the Pseudomonadaceae clade in which it can be observed five clearly species groups DUB-
13RS and DUB-15RS identified as Pseudomonas trivialensis (HM134251) and P poae
(HM640290) respectively were in an undifferentiated group supported by P trivialensis and
P poae type-strains DUB-14RS similar to P viridiflava (HM190224) formed a group
supported by P viridiflavaT (HM190229) DUB-12RS 98 similar to P fluorescens (GQ
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
161
496662) was grouped with P fluorescensT (D84013) DUB-16RS was identified as
uncultured Pseudomonas sp (HQ677222) and classified in an indefinite group Finally the
last group of the Pseudomonadaceae clade was formed by DUB17-RS 98 similar to P
parafulva (HQ406758) and grouped with P parafulvaT (D84015) DUB-21RS was nested in
the Enterobacteriaceae clade due to it was identified with 99 of similarity as Pantoea
Brenneri (HM163514) This clade is supported by types-strains of other species of Pantoea
as Pantoea agglomeransT (FJ613819) and other enteric bacteria as Enterobacter cloacaeT
(AJ251469) DUB nested in Enterobacteriaceae and Pseudomonadaceae clade were γ-
Proteobacteria In α-Proteobacteria class are included Rhizobiales and
Sphingomonadaceae clades In the first clade formed by uncultured Balneimonas and
Rihzobiales bacterium supported by Balneimonas floculansT was nested DUB-19-RS 99
similar to an uncultured Balneimonas strain (HM799006) In Sphingomonadaceae clade was
nested DUB-20RS identified as uncultured Sphingomonadales bacterium DUB-18RS was
similar in 99 to Uncultured Flexibacteriaceae bacterium and was nested in Cytophagaceae
clade belonging to Bacteroidetes phylum
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
162
Figure 7 Neighbour joining tree showing the phylogenetic relationship of the 16S rRNA for the PAH-
degrading uncultured bacteria (DUB) obtained from DGGE of the treatments 145 and 176 days of the
process Boostrap values of neighbourjoining and parsimony higher than 50 are showed on the
branch of the tree (NJMP) No incongruence between parsimony and neighbour joining topology were
detected Pseudomonas genus has been designated as P Pantoea genus as Pa Balneimonas as B
and Bacteriovorax as Ba Hidrogenymonas as H Flexibacerium as F T= type strain
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
163
Discussion
The estimated time of experimentation (176 days) was considered adequate to the complete
bioremediation of the soil according to previous studies developed at low temperatures (15
ordmC ndash 5 ordmC) in which toxicity was reduced below 20 in 101 days and PAH were removed in
137 days above 60 (Simarro et al under review) However our results confirm that
toxicity evaluation of the samples is necessary to know the real status of the polluted soil
because despite creosote was degraded almost entirely (Figure 4A) at the end of the
experiment toxicity remained constant and high during the process (Figure 3A) Possibly the
low temperatures under which was developed the most of the experiment slowed the
biodegradation rates of creosote and its immediate products which may be the cause of
such toxicity In addtion the most removal of creosote (Figure 4A) and higher respiration
rates (Figure 2) occurred from 40 days when temperature began to increase Hence our
results according to other authors (Margesin et al 2002) show that biodegradation at low
temperatures is possible although with low biodegradation rates due to slowdown on the
diffusion rate PAH bioavailability and metabolisms rates (Haritash amp Kaushik 2009 Leahy amp
Colwell 1990)
As in a previously work (Margesin amp Schinner 2001) no significant differences were
observed between treatments in degradation of creosote The final percentage of creosote
depletion above 60 in all treatments including natural attenuation confirm that indigenous
community of the soil degrade creosote efficiently Concurring with these results high
number of creosote-degradaing microorganisms were enumerated in the natural soil at the
time in which the disturbance occurred There is much controversy over whether
preexposure to a pollutant is required for degradation (Johnsen amp Karlson 2005) or if it is a
characteristic intrinsically present in some species of the microbial community that is
expressed when community is exposed to a pollutant (Tian et al 2008 Spain amp van Veld
1983) According to Tian et al 2008) and similarly as in previuosly work in which a wood
degrading consotium from a free polluted soil degraded PAH efficiently bacterial consortium
from natural soil never preexposed to creosota was able to efficiently degrade the
contaminant
Traditionally is widely tested (Yachi amp Loreau 1999) and accepted that higher
diversity leads to greater protection against disturbances (Vilaacute 1998) because the
functionality is higher Bacterial diversity of the biostimulated treatments (T3 and T5) notably
increased during the biodegradation process and showed (T3) a significantly enhance of the
PAH depletion Hence the higher biodiversity of the biostimulated treatment could contribute
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
164
to the increased of PAH degradation Overall the soil microbial community was significantly
altered in the soil with the addition of creosote is evidenced by the reduction of the size or
diversity of the various population of the treatments precisely in treatments no biostimulated
Long-term exposure (175 days) of the soil community to a constant stress such as creosote
contamination could permanently change the community structure as it observed in DGGEN
AND mds Bioaugmentation (T4 and T5) not resulted in a significant increase of the reduction
of creosote or PAH possibly due to the high adaptability of the indigenous consortium to
degrade PAH The relationship between inoculated and autochthonous consortium largely
condition the results of bioaugmentation Some authors (ie Herwijnen et al2005 Andrenoi
amp Gianfreda 2007) purpose that this technique only has positive effects when indigenous
consortium is no capable to degrade The indigenous microbial community demonstrated
capacity to degrade creosote explains the ineffectiveness of bioaugmentation A study of the
bacterial communities during a bioremediation process is important because such as
demonstrate our results bioremediation techniques cause changes in microbial communities
Most of the DUB identified have been previously related with biodegradation process
of PAH creosote andor diesel 60 of the DUB identified (DUB-12RS to DUB17RS)
belonged to Pseudomonas genus widely studied in bioremediation (ie Ma et al 2006
Molina et al 2009) Our results showed that it was the unique representative group at 145
days and the most representative at 176 days of the biodegradation process However in
this work it has been identified some species of Pseudomonas grouped in P trivialis P poae
and P Viridiflava clades (DUB-13RS DUB-15RS and DUB-14RS respectively) less
commonly described in biodegradation process (ie Bogan et al 2003) α-Proteobacteria
class was composed by DUB-19RS (Uncultured balneimonas) and DUB-20RS (Uncultured
Sphingomonadales bacterium) DUB-18RS belonged to phylum Bacteroidetes previously
identified in degradation of high-molecular-mass organic matter in marine ecosystems in
petroleum degradation process at low temperatures and in PAH degradation during
bioremediation of creoste-contaminated soils (Cotrell amp Kiechman 2000a Brakstad et al
2006 Vintildeas et al 2005) Something important to emphasize is the identification of the
Pantoea brenneri (DUB-21RS Enterobacteriaceae clade) and an uncultured Balneimonas
bacteria (DUB-19RS Metylbacteriaceae Rhizobiales clade) as creosote degrader because
have not been previously described as such However very few reports have indicated the
ability to degrade PAH of some genera of the enteric bacteria group as Enterobacter (Molina
et al 2009) Klebsiella (Grant et al 1967) or Escherichia (Diaz et al 2001)
In conclusion temperature is a very influential factor in ex situ biodegradation process
that control biodegradation rates toxicity reduction availability of contaminant and bacterial
metabolisms and so is an important factor to take into account during bioremediation
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
165
process Biostimulation was the technique which more efficiently removed PAH compared
with natural attenuation In this work bioaugmentation not resulted in an increment of the
creosote depletion probably due to the ability of the indigenous consortium to degrade
Bioremediation techniques produce change in the bacterial communities which is important
to study to evaluate damage in the habitat and restore capability of the ecosystem
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
166
References
Andreoni V amp Gianfreda L 2007 Bioremediation and monitoring of aromatic-polluted
habitats Appl Microbiol Biotechnol 76 287-308
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Baek SH Kim KH Yin CR Jeon CO Im WT Kim KK amp Lee ST 2003 Isolation and
characterization of bacteria capable of degrading phenol and reducing nitrate under
low-oxygen conditions Curr Microbiol 47462-466
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Behrendt U Ulrich A amp Schumann P 2003 Fluorescent pseudomonas associated with the
phyllosphere of grasses Pseudomonas trivialis sp nov Pseudomonas poae sp nov
and Pseudomonas congelans sp nov Int J Syst Evol Microbiol 53 1461ndash1469
Brakstad OG amp Bonaunet K 2006 Biodegradation of petroleum hydrocarbons in seawater
at low temperatures (0-5 ordmC) and bacterial communities associated with degradation
Biodegradation 17 71-82
Bodour AA Wang JM Brusseau ML amp Maier RM 2003 Temporal changes in culturable
phenatrhene degraders in response to long-term exposure to phenantrhene in a soil
column system Environ Microbiol 5 888-895
Bogan BW Lahner LMamp Sullivan WR 2003 Degradation of straight-chain aliphatic and
high molecular weight polycyclic aromatic hydrocarbons by a strain of Mycobacterium
austroafricanum J Appl Microbiol 94 230-239
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of plyciclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Pollut Bull 57 695-702
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Austral Ecol 18 117-143
Cotrell MT amp Kirchman DL 2000 Natural assemblages of marine proteobacteria and
members of Cytophaga-Flavobacter cluster consuming low- and high molecular
weight dissolved organic matter Appl Environ Microbiol 66 1692-1697
Couling NR Towel MG Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Pollut 158
3411-3420
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
167
Diaz E Fernandez A Prieto MA amp Garcia JL 2001 Bioremediation of aromatic
compounds by Eschericlia coli Microbiol Mol Biol Rev 65 523-569
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosm
simulation Marine Environ Res 52 195-211
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grant DJW 1967 Kinetic aspect of the growth of Klebsiella aerogenes with some
benzenoid carbon sources J Gen Microbiol 46 213-224
Hall TA 1999 bioedit a user-friendly biological sequence alignment editor and analysis
program for Windows 9598NT Nucleic Acids Symp Ser 4195-98
Haritash AK Kaushik CP 2009 Biodegradation aspects of Polycyclic Aromatic
Hidrocarbons (PAH) A review J Hazard Mater 169 1-15
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJWuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kaplan CW Kitts CK 2004 Bacterial succession in a petroleum land treatment unit Appl
Environ Microbiol 70 1777-1786
Karen M amp Chistoserdov AY 2001 Phylogenetic analysis of the sucession of bacterial
communities in the Great South Bay (Long Island) Microb Ecol 35 85-95
Katoh K amp Toh H 2008a Recent developments in the MAFFT multiple sequence alignment
program Brief Bioinform 9 286ndash298
Katoh K amp Toh H 2008b Improved accuracy of multiple ncRNA alignment by incorporating
structural information into a MAFFT-based framework BMF Bioinform 9 212
Klee AJ 1993 A computer program for the determination of the most probable number and
its confidence limits J Microbiol Methods 18 91-98
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Loacutepez Z Vila J Ortega-Calvo JJ amp Grifoll M 2008 Simultaneous biodegradation of
creosote-polycyclic aromatic hydrocarbons by a pyrene-degrading Mycobacterium
Appl Microbiol Biotechnol 78 165-172
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
168
MaY Wang L amp Shao Z 2006 Pseudomonas the dominant polycyclic aromatic
hydrocarbon-degrading bacteria isolated from Antarctic soils and the role of large
plasmids in horizontal gene transfer Environ Microbiol 8 455ndash465
Madden TL Tatusov RL amp Zhang J 1996 Applications of network BLAST server Methods
Enzymol 266 131-141 (available at URL httpncbinlmnihgovBLAST)
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
McConkey BJ Duxbury CL Dixon DG amp Greenberg BM 1997 Toxicity of a PAH
photooxidation product to the bacteria Photobacterium phosphoreum and the
duckweed Lemna gibba Effects of phenanthrene and its primary photoproduct
phenanthrenequinone Environ Toxicol Chem 16 892-899
MacNaughton SJ Stephen JR Venosa AD Davis GA Chang YJ amp White DC 1999
Microbial population changes during bioremediation of an experimental oil spill App
Environ Microbiol 65 3566-3574
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Simarro R Gonzalez N Bautista LF Sanz R amp Molina MC 2011 Optimization of key
abiotic factors of PAH (naphthalene phenanthrene and anthracene) biodegradation
process by a bacterial consortium Water Air Soil Pollut 217 365-374Surridge
AKJ Wehner FC amp Cloete TE 2009 Bioremediation of polluted soil En Singh A
Kuhad RC Ward OP (eds) Adv Appl Biorem p103-121 Springer Berliacuten
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Taketani RG Franco NO Rosado AS amp van Elsas JD 2010 Microbial community
response to a simulated hydrocarbon spill in mangrove sediments J Microbiol 48 7-
15
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull 56 1184-1191
Capiacutetulo 4 Efficient of biorremediation techniques in creosote polluted soil
169
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol Progr Ser 390 55-65
Vilagrave M 1998 Efectos de la diversidad de especies en el funcionamiento de los ecosistemas
Orsis 13 105-117
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated soil Appl Environ Microbiol 71 7008-7018
Wilke BM 2005 Determination of chemical and physical soil properties In Margesin R
Schinner F (eds) Manual of soil analysis monitoring and assessing soil
bioremediation Springer Berlin pp 47-97
Wrenn BA amp Venosa AD 1983 Selective enumeration of aromatic and aliphatic
hydrocarbon-degrading bacterial by most probably number (MPN) Can J Microbiol
42 252-258
Yachi S amp Loreau M 1999 Biodiversity and ecosystem productivity in a fluctuating
environment The insurance hypothesis Proc Natl Acad Sci USA 96 1463-1468
Yu SH Ke L Wong YS amp Tam NFY 2005a Biodegradation of polycyclic aromatic
hydrocarbons (PAHs) by a consortium enrichment from mangrove sediments Environ
Int 32 149-154
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005b Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
bull Discusioacutengeneral
II
Discusioacuten general
173
Discusioacuten general
Temperatura y otros factores ambientales determinantes en un proceso de
biodegradacioacuten
El resultado final de la aplicacioacuten directa de teacutecnicas de biorremediacioacuten en un medio
contaminado estaacute fuertemente influenciado por los paraacutemetros ambientales Por este motivo
son numerosos los estudios (ej Chaicircneau et al 2005 Cheung amp Kinkle 2005 Leys et al
2005 Chen et al 2008) realizados para optimizar y en la medida de lo posible modificar
tanto los factores bioacuteticos como abioacuteticos Frecuentemente la optimizacioacuten se ha llevado a
cabo considerando exclusivamente un solo factor implicado por ejemplo la temperatura
(Torres et al 2005) la concentracioacuten de nutrientes y la relacioacuten CNP (Leys et al 2005) o
el tipo de nutrientes y los surfactantes adicionados (Cheung amp Kinkle 2005) Pocos son los
estudios en los que se valoran dos o tres factores conjuntamente (Kaumlstner et al 1998
Cheung amp Kinkle 2005) y menos auacuten en los que se combinan maacutes de cuatro paraacutemetros
variables Chen et al (2008) destacoacute la importancia de evaluar en el proceso de
optimizacioacuten tanto los efectos individuales como los derivados de la interaccioacuten entre
factores mediante un meacutetodo factorial completo La optimizacioacuten de un proceso de
biorremediacioacuten previo a la aplicacioacuten in situ es fundamental y un disentildeo ortogonal del
experimento va a permitir ademaacutes considerar los efectos sineacutergicos y antagoacutenicos
derivados de la interaccioacuten entre las variables bioacuteticas y abioacuteticas (Chen et al 2008) Los
resultados obtenidos en los dos trabajos de optimizacioacuten que componen el capiacutetulo 1
demuestran que los factores ambientales significativamente influyentes en la tasa de
biodegradacioacuten (kB) de HAP son diferentes cuando se fijan como constantes todos los
paraacutemetros excepto uno (capiacutetulo 1a) que cuando todos los paraacutemetros se consideran
variables y se combinan en un anaacutelisis ortogonal (capiacutetulo 1b) Sin embargo los resultados
obtenidos de un anaacutelisis factorial no invalidan la optimizacioacuten individual la cual es necesaria
y maacutes adecuada en casos en los que tan soacutelo interesa estudiar la influencia de un
determinado factor en el proceso de biodegradacioacuten En algunos casos determinados
paraacutemetros ambientales fijos e inamovibles (ej bajas temperaturas) dificultan el proceso de
biodegradacioacuten y mediante la optimizacioacuten individual y posterior modificacioacuten de otros
factores del medio (ej nutrientes fuente de carbono) se consigue aumentar la eficacia del
proceso Ademaacutes como resultado de la optimizacioacuten indiviadual de factores realizada en el
capiacutetulo 1a de la presente tesis se obtuvo un medio de crecimiento oacuteptimo (capiacutetulo 1) que
que se usoacute en ensayos y experimentos posteriores (capiacutetulos 3 y 4)
Discusioacuten general
174
Dada la elevada variabilidad de resultados que se pueden obtener en la eficacia de
biodegradacioacuten en funcioacuten de los factores ambientales y sus modificaciones proponemos
que los ensayos de optimizacioacuten del proceso para determinar las condiciones oacuteptimas del
mismo es fundamental para maximizar la eficacia (tiempo y costes) de la aplicacioacuten in situ
De entre todos los factores ambientales limitantes de la biodegradacioacuten de
hidrocarburos del petroacuteleo como son los HAP la temperatura es uno de los que maacutes
condiciona la eficacia del mismo (Chen et al 2008) En la presente tesis los procesos de
biodegradacioacuten realizados a bajas temperaturas (capiacutetulo 3 y 4) con el objetivo de evaluar la
influencia de este factor en la eficacia de degradacioacuten y en la comunidad bacteriana
muestran que la degradacioacuten del contaminante es menor a temperaturas inferiores a 15ordmC
(Margesin et al 2002) La notable ralentizacioacuten de las tasas de crecimiento bacteriano y
degradacioacuten a temperaturas bajas (capiacutetulos 3 y 4) fue debida a la menor solubilidad de los
HAP (Haritash amp Kaushik 2009) y al decrecimiento del metabolismo microbiano (Leahy amp
Colwell 1990) Los estudios centrados en la obtencioacuten de la temperatura oacuteptima durante los
procesos de degradacioacuten de HAP por un consorcio bacteriano (Capiacutetulos 1a 1b y 3) han
determinado que no existe un valor oacuteptimo sino maacutes bien un rango oacuteptimo que oscila entre
los 20ordmC y los 30ordmC Tal y como concreta Chen et al (2008) son las fluctuaciones amplias
de temperatura lo que dificulta el proceso de biodegradacioacuten Cuando el rango de variacioacuten
es estrecho y ademaacutes se encuentra dentro de los valores oacuteptimos la influencia es
significativamente despreciable (capiacutetulo 1b) Sin embargo hay que tener presente que
existen ecosistemas susceptibles de ser contaminados en zonas cuyas condiciones
climaacuteticas son extremas Histoacutericamente grandes desastres ecoloacutegicos se han producido en
aacutereas cuyas temperaturas medias estaacuten muy por debajo del rango oacuteptimo como es el caso
del petrolero Exxon Vadez en Alaska (Bence et al 1996) o el Prestige en Espantildea (Soriano
et al 2006) A pesar de la evidente importancia de este aspecto poco se sabe sin embargo
de la degradacioacuten de HAP a temperaturas friacuteas comprendidas entre los 5 ordmC-15 ordmC la cual
es posible gracias a la presencia de especies psicrotolerantes y psicroacutefilas (ldquocold-adaptedrdquo)
(Margesin amp Schinner 2001) Alguna de estas especies que han adquirido o que poseen
intriacutensecamente la capacidad para degradar hidrocarburos pertenecen a los geacuteneros
Pseudomonas Acinetobacter o Pshycrobacter (Eriksson et al 2003 Margesin et al 2003)
La identificacioacuten de estos geacuteneros en los consorcios bacterianos (C2PL05 y BOS08)
posiblemente ha sido determinante en los procesos de biodegradacioacuten a bajas temperaturas
(capiacutetulos 3 y 4) ya que aunque con menores tasas que a temperaturas altas la
biodegradacioacuten ha sido posible Estas especies son claves para el mantenimiento de dicha
comunidad ya que su actividad metaboacutelica durante periodos de bajas temperaturas o en
ambientes permanentemente friacuteos permite la mineralizacioacuten de los hidrocarburos y
subsecuente formacioacuten de otros compuestos maacutes sencillos y faacuteciles de degradar por el resto
Discusioacuten general
175
de las especies del consorcio o la comunidad (Pelz et al 1999) La utilizacioacuten de consorcios
bacterianos adaptados a climas friacuteos compuestos por especies con capacidad degradadora
puede ser una medida de actuacioacuten fundamental en aacutereas extremas Ademaacutes a partir de
estas cepas psicrotolerantes y psicroacutefilas se estaacuten aislando enzimas oxidativas capaces de
trabajar a bajas temperaturas con un importante potencial en procesos biotecnoloacutegicos
(Cavicchioli et al 2002)
Consorcios bacterianos durante un proceso de biodegradacioacuten factores que
determinan la sucesioacuten de especies
La sucesioacuten de especies en un consorcio durante un proceso de biodegradacioacuten depende
en gran medida de ciertas caracteriacutesticas celulares y metaboacutelicas de las especies que lo
componen sobre todo cuando la fuente de carbono son HAP de alto peso molecular
(Mueller et al 1997) Por ejemplo algunas especies de Pseudomonas (P aeruginosa
Soberon-Chavez et al 2005) tienen la capacidad de producir biosurfactantes para aumentar
la biodisponibilidad de HAP o bien como es el caso de las Gram-positivas la presencia de
una uacutenica membrana permite un transporte maacutes eficaz de los HAP al interior de la ceacutelula
(Mueller et al 1997) En la mayoriacutea de los casos las sustancias que se presentan como
recalcitrantes para una especie individual pueden metabolizarse a traveacutes de secuencias
cataboacutelicas complementarias que presentan las diferentes especies de un consorcio
(Fritsche 1985) De ahiacute que con los consorcios microbianos se puedan obtener tasas de
degradacioacuten mucho maacutes elevadas que con cepas individuales (Bautista et al 2009) Sin
embargo la estabilidad y eficacia de un consorcio bacteriano estaacuten determinadas por las
relaciones de supervivencia entre las especies que lo componen Un caso en el que las
asociaciones bacterianas son fundamentales son los procesos de biorremediacioacuten a bajas
temperaturas ya que tal y como Leahy amp Cowell (1990) exponen los consorcios bacterianos
cuentan con una capacidad enzimaacutetica maacutes amplia que especies aisladas y por tanto
mayor versatilidad y superioridad de supervivencia
Una modificacioacuten sobre el consorcio como es la dilucioacuten del mismo (capiacutetulo 1b)
puede afectar a las tasas de degradacioacuten finales precisamente porque modifican las
relaciones inicialmente establecidas entre las especies Igualmente este paraacutemetro puede
modificar el patroacuten de crecimiento sin que esto suponga un cambio significativo en la tasa de
degradacioacuten (capiacutetulo 1b) hecho que dependeraacute de la capacidad degradadora de la especie
favorecida (Szaboacute et al 2007) Por tanto la concentracioacuten del inoacuteculo introducido en un
medio contaminado puede condicionar la eficacia del proceso
Discusioacuten general
176
En los diferentes experimentos que componen los capiacutetulos de este proyecto doctoral
no se han realizado pruebas fisioloacutegicas para estudiar las rutas metaboacutelicas o la importancia
relativa del cometabolismo que condicionen la sucesioacuten o composicioacuten de especies de una
comunidad Sin embargo los anaacutelisis de la comunidad bacteriana a traveacutes de la
identificacioacuten de especies cultivables (capiacutetulos 2 y 3) y no cultivables (capiacutetulos 2 3 y 4)
mediante teacutecnicas moleculares indican que la comunidad bacteriana cambia y por tanto
existe una sucesioacuten y coexistencia determinada de especies en el tiempo Los resultados
obtenidos en el capiacutetulo 2 indican que las especies del consorcio cambian en funcioacuten de la
fuente de carbono disponible (HAP y subproductos de degradacioacuten de HAP) y la presencia
de determinados surfactantes (Tween-80 y HAP o solo HAP) por lo que eacutestos pueden ser
factores que intervienen en la sucesioacuten de especies en un consorcio En muchos procesos
de biodegradacioacuten es comuacuten la adicioacuten de ciertas fuentes de carbono para aumentar la
biomasa de los consorcios bacterianos o cepas concretas y acelerar por tanto el proceso de
biodegradacioacuten (Chen amp Aitken 1999 Lee et al 2003) Sin embargo dada la mencionada
influencia de la fuente de carbono sobre la composicioacuten de especies el resultado de esta
medida puede ser negativo en consorcios bacterianos en los que coexistan especies
degradadoras de una determinada fuente de carbono (ej HAP) con otras que no lo son
(capiacutetulo 1a y 1b) Este hecho es debido a que la adaptacioacuten a la nueva fuente de carbono
de los microorganismos degradadores de HAP se traduce en un aumento de la fase de
latencia y por tanto en un retraso de la tasa de degradacioacuten (Maier et al 2009) Este
fenoacutemeno se pudo observar con claridad cuando se suministroacute al consorcio degradador
C2PL05 glucosa como uacutenica fuente de carbono o en combinacioacuten con HAP (capiacutetulos 1a y
1b)
Nuevas especies bacterianas degradadoras de HAP
La identificacioacuten de especies en los numerosos trabajos de biodegradacioacuten realizados hasta
el momento verifican la existencia de una importante variedad de bacterias degradadoras
de HAP Sin embargo esto no implica que no haya taxa particularmente bien adaptados a
medios contaminados (Mueller et al 1997) y que frecuentemente esteacuten involucrados en
procesos de biodegradacioacuten Este es el caso de geacuteneros como Pseudomonas
Acinetobacter Sphingomonas y Stenothrophomonas identificados durante los ensayos que
componen los capiacutetulos 2 3 y 4 Ademaacutes de la identificacioacuten de especies pertenecientes a
estos geacuteneros ampliamente descritos en procesos de biodegradacioacuten (ej Pseudomonas
Sphingomonas Sphingobium Ralstonia Flexibacter Rhodococcus y Bacillus) cabe
destacar la importancia del aislamiento e identificacioacuten de secuencias englobadas en nuevos
geacuteneros degradadores ineacuteditos hasta el momento o cuya implicacioacuten en estos procesos es
Discusioacuten general
177
escasa Este es el caso de Enterobacter cloacae y E ludwigii (γ-Proteobacterias)
identificadas en el consorcio C2PL05 como degradadoras de HAP de bajo peso molecular
Incluso en un estudio previo (Bautista et al 2009) se ha determinado que la eficacia
degradadora de este geacutenero es mucho maacutes eficaz que otras especies degradadoras
frecuentemente descritas como Pseudomonas fluorescens o Stenotrophomonas maltophilia
Pantoea aglomerans (γ-Proteobacterias) es otra Enterobacteriaceae identificada por primera
vez como degradadora de (capiacutetulo 4) En escasas ocasiones (Toledo et al 2006) una
especie de la familia Enterobacteraceae ha sido identificada como degradadora de HAP o
de crudo (Zhang et al 2010) Asiacute mismo es la primera vez que bacterias Gram-positivas
pertenecientes a los geacuteneros Balneimonas sp (capiacutetulo 4) Bradyrhizobium sp y
Nitrobacteria sp (capiacutetulo 2) todas α-Proteobacterias y por otro lado el geacutenero
Microbacterium sp (Phylum Actinobacterias Capiacutetulo 3) se relacionan con procesos de
biodegradacioacuten de HAP y en procesos de mineralizacioacuten de sustancias recalcitrantes La
presencia de estos organismos debe quedar justificada por su capacidad degradadora dado
que han sido identificadas a partir de bandas de gran intensidad en DGGE teacutecnica que se
ha realizado con muestras procedentes de ensayos de biodegradacioacuten de HAP y creosota
(capiacutetulos 2 3 y 4) Es decir su mera presencia en el consorcio no parece justificable por
causas aleatorias sino maacutes bien por su implicacioacuten directa en los procesos metaboacutelicos
asociados a la degradacioacuten Por ejemplo el aislamiento e identificacioacuten en el capiacutetulo 2 de
especies del geacutenero Nitrobacteria podriacutea estar relacionada con la reduccioacuten de nitritos
presentes en el medio contaminado (capiacutetulo 2 Gonzaacutelez et al 2010)
Los resultados de identificacioacuten mediante teacutecnicas moleculares muestran la evidente
variedad de geacuteneros implicados en estos procesos La variabilidad observada fue mucho
menos intensa con las teacutecnicas moleculares dependientes de cultivo (capiacutetulo 2) ya que tan
solo entre un 1 y un 10 del total de bacterias del suelo son cultivables (Nannipieri et al
2003) Algunos autores (Menn et al 1993 Okpokwasili et al 1986) proponen que los genes
cataboacutelicos para la degradacioacuten de HAP probablemente se transmitan horizontalmente
mediante plaacutesmidos entre bacterias pertenecientes a grupos taxonoacutemicos muy diferentes
Mueller et al (1997) afirman que no es probable encontrar una clara relacioacuten entre grupos
taxonoacutemicos de bacterias y la produccioacuten de enzimas implicadas en la degradacioacuten de
hidrocarburos aromaacuteticos Por tanto no es extrantildeo que genes homoacutelogos (en este caso
degradativos) se expresen en bacterias que taxonoacutemicamente estaacuten muy poco relacionadas
(capiacutetulos 2 3 y 4) otorgando una alta variabilidad al conjunto de bacterias con capacidad
degradadora
Discusioacuten general
178
Preexposicioacuten a los HAP iquestes necesaria para una biodegradacioacuten eficaz HAP
Tradicionalmente algunos autores han sugerido que la preexposicioacuten de bacterias a un
determinado contaminante es necesaria para la adaptacioacuten y consecuente degradacioacuten
(Spain amp van Veld 1983) o para un aumento en la tasa del proceso (Haritash amp Kaushik
2009) Sin embargo autores como Johnsen amp Karlson (2005) se plantean si eacutesta es una
capacidad presente en las comunidades microbianas independientemente de su previa
exposicioacuten o si es una capacidad inducida por la exposicioacuten a elevados niveles de
contaminante Los procesos de biodegradacioacuten realizados con consorcios bacterianos
procedentes de zonas libres de contaminacioacuten por HAP (capiacutetulos 3 y 4) indican que eacutesta
es una capacidad intriacutenseca en las bacterias e independiente de la previa exposicioacuten y que
se manifiesta ante un periodo de contaminacioacuten Los geacuteneros identificados en el capiacutetulo 3
(Ralstonia Pseudomonas o Bacillus) son propios de sistemas con un alto contenido en
madera en descomposicioacuten en los que contribuyen a la degradacioacuten de lignocelulosa
celulosa y sus subproductos mediante enzimas oxidativas (Rastogi et al 2009) Las
enzimas lignoliacuteticas de los hongos saproacutefitos degradan compuestos con estructuras
quiacutemicas similares a la lignina como son los HAP (Hatakka 1994 2001 Barr amp Aust 1994
Meulenberg et al 1997) Por tanto las especies bacterianas con la bateriacutea enzimaacutetica para
degradar subproductos de lignina y celulosa pueden tambieacuten adaptarse y metabolizar HAP
(Tian et al 2008 Couling et al 2010) La capacidad degradadora de este tipo de
compuestos no solo se transmite de manera vertical sino que la transferencia horizontal de
genes puede ser tambien un factor determinante para la adquisicioacuten de esta capacidad entre
los microorganismos del consorcio o comunidad
Los resultados referentes a la alta capacidad degradativa que muestra el consorcio
BOS08 procedente de una zona limpia (capiacutetulo 3) gozan de una extraordinaria importancia
a nivel aplicado y ecoloacutegico La mayoriacutea de los trabajos que estudian el posible paralelismo
entre la degradacioacuten de lignina y la de compuestos aromaacuteticos se han llevado a cabo con
hongos maderables de la llamada ldquopodredumbre blancardquo El hecho de que un consorcio
bacteriano no adaptado a la degradacioacuten de HAP sea capaz de metabolizar eficazmente
HAP de alto peso molecular y ademaacutes disminuya la toxicidad del medio por debajo del
umbral de la toxicidad incluso a bajas temperaturas sin duda abre un campo de
investigacioacuten muy amplio dentro de la biorremediacioacuten Ecofisioloacutegicamente hablando
resultan tambieacuten de gran intereacutes estas espcies que han sido capaces de readaptar su
bateriacutea enzimaacutetica para metabolizar una fuente de carbono altamente recalcitrante y toacutexica
que no estaba presente en su medio natural
Discusioacuten general
179
Posibles actuaciones en un medio contaminado
Ante un caso de contaminacioacuten de un medio con HAP o sustancias que los contengan la
biorremediacioacuten resulta una de las teacutecnicas maacutes eficaces y respetuosas con el medio La
atenuacioacuten natural del contaminante por los microorganismos presentes en el propio medio
depende seguacuten Frosyth et al (1995) del tamantildeo de la poblacioacuten degradadora autoacutectona No
obstante los resultados obtenidos durante el proceso de biorremediacioacuten de un suelo
contaminado con creosota (capiacutetulo 4) indican que los resultados que puede ofrecer la
atenuacioacuten natural no dependen uacutenicamente del nuacutemero inicial de microorganismos
degradadores Las pruebas realizadas indicaron en el momento que se produjo la
contaminacioacuten la actividad degradadora era nula aunque tras un corto peridodo de
exposicioacuten al mismo comenzoacute la actividad de los microorganismos degradadores Esto
quiere decir que aunque en un primer momento la poblacioacuten degradadora sea miacutenima la
presencia del contaminante favorece su dominancia y hace patente su capacidad
degradadora Ademaacutes hay que tener en cuenta varias de las cuestiones abordadas en
apartados previos como son la rapidez y facilidad que tienen los microorganismos para
transferir esta capacidad incluso entre diferentes taxas (Menn et al 1993) o la alta
adaptabilidad a una nueva fuente de carbono Sin embargo la atenuacioacuten natural es una
teacutecnica muy ventajosa porque evita dantildeos en la comunidad bacteriana del medio a
diferencia de cualquier otra actuacioacuten que en menor o mayor medida modifican las
condiciones originales del ecosistema
Uno de los principales problemas de la biorremediacioacuten es el tiempo necesario para
la completa eliminacioacuten del contaminante del medio para lo cual se han desarrollado
estrategias de actuacioacuten con el uacutenico objetivo de acelerar y mejorar la eficacia del proceso
La bioestimulacioacuten tiene como principal objetivo potenciar la capacidad degradadora de los
microorganismos degradadores autoacutectonos mediante la adicioacuten de nutrientes inorgaacutenicos al
medio contaminado Sin embargo los resultados referentes a esta teacutecnica no son
concluyentes dada la elevada variabilidad de los mismo Los casos en los que la
bioestimulacioacuten favorece el proceso de biodegradacioacuten estaacuten estrechamente relacionados
con el impedimento de que los nutrientes se conviertan en un factor limitante para los
microorganismos ya que tal y como expone Leys et al (2005) los requerimientos de
nitroacutegeno y foacutesforo aumentan notablemente durante un episodio de contaminacioacuten Sin
embargo son numerosos los estudios que han obtenido resultados desfavorables con esta
teacutecnica debido a cuestiones relacionadas con altos iacutendices de salinidad (Braddock et al
1997) o tal y como se observa en el capiacutetulo 4 con los cambios que la bioestimulacioacuten
genera en la comunidad bacteriana que en muchos casos inducen a relaciones negativas
entre las especies de la comunidad debido a la competencia por los nutrientes (Rolling-
Discusioacuten general
180
Willfred et al 2002) Por otra parte la bioestimulacioacuten durante el proceso de
biorremediacioacuten del suelo contaminado con creosota (capiacutetulo 4) no favorecioacute
significativamente la biodegradacioacuten del contaminante Estos resultados se pueden atribuir a
una concentracioacuten de nutrientes suficientes en el medio o bien a la raacutepida y efectiva
capacidad degradativa de creosota que mostraron los microorganismos autoacutectonos
El bioaumento es una teacutecnica que pretende incrementar la eficacia del proceso de
biorremediacioacuten mediante el inoacuteculo a la poblacioacuten autoacutectona de una poblacioacuten
degradadora previamente definida como tal Sin embargo es un tratamiento complejo cuyos
resultados dependen de algo tan desconocido y variable como son las relaciones entre
especies y comunidades (Yu et al 2005) Por ello no hay gran nuacutemero de artiacuteculos en los
que se describan resultados favorables de esta teacutecnica pero podemos resumir que las
consecuencias del bioaumento dependen fundamentalmente de dos cuestiones Una de
ellas es que las relaciones de competencia que se establecen entre la comunidad
introducida y autoacutectona sean negativas para la poblacioacuten degradadora (Vintildeas et al 2005
Yu et al 2005) relaciones que principalmente estaacuten dirigidas por la competicioacuten por los
recursos (Yu et al 2005) La inexistencia de efectos significativos del bioaumento durante el
proceso de bodegradacioacuten de creosota (capiacutetulo 4) al igual que los descritos por Herwignen
et al (2005) indican que la presencia de una comunidad bacteriana autoacutectona con
capacidad degradadora o que se adapta raacutepidamente como es nuestro caso puede ser otra
de las cuestiones que hagan que el bioaumento no favorezca el proceso
Los ensayos de biorremediacioacuten realizados durante la presente tesis y los
consultados en las diferentes referencias bibliograficas nos llevan a concluir una vez maacutes
que los efectos de las diferentes teacutecnicas de biorremediacioacuten dependen de las condiciones
del medio contaminado y de la poblacioacuten bacteriana que alberga Por ello un estudio previo
que indique las caracteriacutesticas bioacuteticas (capacidad degradadora composicioacuten y evolucioacuten de
la comunidad bacteriana) y abioacuteticas (temperatura ambiente y caracteriacutesticas fisico-quiacutemicas
del suelo) del mismo asiacute como un breve ensayo a escala de laboratorio donde se apliquen
las diferentes teacutecnicas y seleccionando las maacutes adecuadas mejora en gran medida la
efectividad de la biorremediacioacuten in situ
Conclusiones generales
III
Conclusiones generales
183
Conclusiones generales
De los trabajos llevados a cabo en esta tesis doctoral se pueden extraer las siguientes
conclusiones generales
1 La optimizacioacuten de los factores abioacuteticos y bioacuteticos hace que el proceso de
biodegradacioacuten sea maacutes eficaz y permite modificarlo mediante estrategias de
biorremediacioacuten
2 Los factores que realmente influyen significativamente en un proceso se observan
mediante un estudio ortogonal de los mismos porque permite evaluar las
interacciones entre los factores seleccionados
3 No todos los ambientales son limitantes para la degradacioacuten de HAP Po ejemplo la
bioestimulacioacuten con nutrientes inorgaacutenicos no es efectiva en casos en los que la
cantidad de nutrientes en el medio es suficiente La adicioacuten de glucosa como fuente
adicional de carbono no es necesaria cuando el consorcio esta adaptado a los HAP
como fuente de carbono
4 Las actuaciones basadas en la adicioacuten de fuentes de carbono adicionales a los HAP
no son efectivas cuando los consorcios o cepas bacterianas estaacuten adaptadas a los
HAP porque esto supone un periodo de readaptacioacuten
5 La fuente de carbono disponible en cada momento durante un proceso de
biodegradacioacuten de HAP y otras sustancias en el medio como los surfactantes
condicionan la presencia de especies y por tanto la sucesioacuten de las mismas
6 La aparicioacuten de nuevas especies previamente no descritas como degradadoras
puede estar relacionada con la transferencia horizontal de genes degradativos que
en muchos casos ocurre entre grupos taxonoacutemicos poco relacionados lo que
ampliariacutea auacuten maacutes la expresioacuten de la capacidad degradativa en la comunidad
7 La identificacioacuten en un consorcio procedente de una zona limpia y rica en materia
orgaacutenica de especies fundamentales en sistemas de degradacioacuten de madera
sugiere que las enzimas oxidativas usadas por estas especies en la degradacioacuten de
subproductos de lignina y celulosa se emplean en la degradacioacuten de HAP Por tanto
Conclusiones generales
184
la previa exposicioacuten de los consorcios bacterianos o cepas individuales a un
contaminante no es necesaria cuando tienen una bateriacutea enzimaacutetica que se puede
adaptar y metabolizar el contaminante
8 El papel de las especies bacterianas adaptadas a la degradacioacuten de HAP en
ambientes friacuteos (Tordf lt 15ordmC) es fundamental para la biorremediacioacuten en climas
extremos Ademaacutes la actividad de estas especies en periodos de bajas temperaturas
permite el crecimiento de otras especies de la comunidad bacteriana a partir de los
subproductos de degradacioacuten
9 El bioaumento es una teacutecnica cuyos resultados estaacuten ampliamente influenciados por
las relaciones que se establecen entre la comunidad autoacutectona e introducida y soacutelo
se recomienda en aquellos casos en los que la comunidad autoacutectona no tenga
microorganismos degradadores o no sean capaces de desarrollar esta capacidad
Referencias bibliograacuteficas
IV
Referencias bibliograacuteficas
187
Referencias bibliograacuteficas
Aislabie J Foght J amp Saul D 2000 Aromatic hydrocarbon-degrading bacteria from soil near
Scott Base Antarctica Polar Biol 23 183-188
Atagana HI 2006 Biodegradation of polycyclic aromatic hydrocarbons in contaminated soil
by biostimulation and bioaugmentation in the presence of copper (II) iron World J
Microbiol Biotechnol 22 1145-1153
Atlas RM amp Bartha R 1972 Biodegradation of petroleum in seawater at low temperatures
Can J Microbiol 18 1851-1855
Baek KH Yoon BD Kim BH Cho DH Lee IS Oh HM amp Kim HS 2007 Monitoring of
microbial diversity and activity during bioremediation of crude oil-contaminated soil
with different treatments J Microbiol Biotechnol 17 67-73
Barkay T amp Pritchart H 1988 Adaptation of aquatic microbial communities to pollutant
stress Microbiol Sci 5165-169
Barr DP amp Aust SD 1994 Mechanisms with rot fungi use to degrade pollutants Environ
Sci Technol 28 78A-87A
Bautista LF Sanz R Molina MC Gonzaacutelez N amp Saacutenchez D 2009 Effect of different non-
ionic surfactants on the biodegradation of PAH by diverse aerobic bacteria Int
Biodeter Biodegr 63 913-922
Bence AE Kvenvolden KA amp Kennicutt MC 1996 Organic geochemistry applied to
environmental assessments of Prince William Sound Alaska after Exxon Valdez oil
spill-a review Org Geochem 24 7-42
Bouchez M Blanchet D amp Vandecasteele J-P 1995 Degradation of polycyclic aromatic
hydrocarbons by pure strains and by defined strain associations inhibition
phenomena and cometabolism Appl Environ Microbiol 43 156-164
Braddock JF Ruth ML Catterall PH Walworth JL amp McCarthynd KA 1997
Enhancement and inhibition of microbial activity in hydrocarbon contaminated arctic
soil implication for nutrients amended bioremediation Environ Sci Technol 31
2078-2084
Cavicchioli R Siddiqui KS Andrews D amp Sower KR 2002 Low temperature
extremophiles and their applications Curr Opin Biotechnol 13 253-261
Cerniglia1984 Microbial metabolism of polycyclic aromatic hydrocarbons Adv Appl
Microbiol 30 31-71
Cerniglia 1992 Biodegradation of polycyclic aromatic hydrocarbons Biodegradation 2-3
351-368
Referencias bibliograacuteficas
188
Chaicircneau CH Morel J Dupont J Bury E amp Oudot J 1999 Comparison of the fuel oil
biodegradation potential of hydrocarbon assimilating microorganisms isolated from a
temperate agricultural soil Sci Total Environ 227 237-247
Chaicircneau CH Rogeus G Yeacutepreacutemian C amp Outdot J 2005 Effects of nutrients
concentration on the biodegradation of crude oil and associated microbial
populations in the soil Soil Biol Biochem 37 1490-1497
Chauhan A Fazlurrahman Oakeshott JG amp Jain RK 2008 Bacterial metabolisms of
polycyclic aromatic hydrocarbons strategies for remediation Indian J Microbiol
4895-113
Chen S-H amp Aitken MD 1999Salicylate stimulates the degradation of high-molecular
weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15
Environ Sci Technol 33 435ndash439
Chen J Wong MH amp Tam N 2008 Multi-factors on biodegradation kinetics of polycyclic
aromatic hydrocarbons (PAH) by Sphingomonas sp a bacterial strain isolated from
mangrove sediment Marine Poll Bull 57 695-702
Cheung P-Y amp Kinkle BK 2005 Effect of nutrients and surfactant on pyrene mineralization
and Mycobacterium spp populations in contaminated soil Soil Biol Biochem 37
1401-1405
Clarke KR 1993 Non-parametric multivariate analyses of changes in community structure
Aust Ecol 18 117-143
Clements WH Oris JT amp Wissin TE 1994 Accumulation and food chain transfer of
fluoranthene and benzo[a]pyrene in Chironomus riparius and Leponis macrochirus
Arch Environ Contam Toxicol 26261-266
Colwell RR Mills AL Walker JD Garcia Tello P amp Campos V 1978 Microbial ecological
studies at the Metula spill in the Strait of Magellan J Fish Res Board Can 35573-
580
Couling NR Towel MG amp Semple KT 2010 Biodegradation of PAH in soil Influence of
chemical structure concentration and multiple amendment Environ Poll 158 3411-
3420
Das K amp Mukherjee AK 2006 Crude petroleum-oil biodegradation efficiency of Bacillus
subtillis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India Bioresour Technol 98 1339-1345
Delille D amp Pelletier E 2002 Natural attenuation of diesel-oil contamination in a subantartic
soil (Crozet island) Polar Biol 25 682-687
Dibble JR amp Bartha R 1979 Effect of environmental parameters on the biodegradation of
oil sludge App Environ Mirobiol 37 729-739
Referencias bibliograacuteficas
189
Dowty RA Shaffer GP Hester MW Childers GW Campo FM amp Greence MC 2001
Phytoremediation of small-scale oil spills in fresh marsh environments a mesocosms
simulation Marine Environ Res 52 195-211
Eriksson M Ka J-O amp Mohn WW 2001 Effects of low temperature and freeze-thaw cycles
on hydrocarbon biodegradation in artic tundra soil Appl Environ Microbiol 67 5107-
5112
Eriksson M Sodersten E Yu Z Dalhammar G amp Mohn WW 2003 Degradation of
polycyclic aromatic hydrocarbons at low temperature under aerobic and nitrate-
reducing conditions in enrichment cultures from northern soils Appl Environ
Microbiol 69 275-84
Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap
Evolution 39 783-791
Fiechter A 1992 Biosurfactants moving towards industrial application Trends Biotechnol
10 208-217
Fritsche JD 1985 Nature and significance of microbial cometabolism of xenobiotics J
Basic Bacteriol 25 603-619
Forsyth JV Tsao YM amp Bleam RD 1995 Biorremediation when is augmentation needed
In Hinchee RE Fredrickson J amp Alleman BC (Eds) Bioaugmentation for site
remediation Battelle Press Columbus pp 1-14
Ghazali FM Rahman RNZA Salleh AB amp Basr M 2004 Degradation of hydrocarbons
in soil by microbial consortium Int Biodeter Biodegr 54 61ndash67
Gonzaacutelez N Simarro R Molina MC Bautista LF Delgado L amp Villa JA 2011 Effect of
surfactants on PAH biodegradation by a bacterial consortium and on the dynamics of
the bacterial community during the process Bioresource Technol 102 9438ndash9446
Grimberg SJ Stringfellow WT amp Aitken MD 1996 Quantifying the biodegradation of
phenanthrene by Pseudomonas stutzeri P16 in the presence of a nonionic surfactant
Appl Environ Microbiol 62 2387-2392
Habe H amp Omori T 2003 Gentics of polycyclic aromatic hydrocarbon metabolisms in
diverse aerobic bacteria Biosci Biotechnol Biochem 67 225-243
Haritash AK amp Kaushik CP 2009 Biodegradation aspects of polycyclic aromatic
hydrocarbons (PAHs) A review J Hazard Mater 169 1-15
Hatakka A 1994 Lignin-modifying enzymes from selected white rot fungi production and
role in lignin degradation FEMS Microbial Rev 13 125-135
Hatakka A 2001 Biodegradation of lignin In Hofrichter M amp Steinbuchel A (eds)
Biopolymers vol 1 Lignin humic substances and coal Wiley-VCH Weinheim
Germany p129-180
Herwijnen R Joffe B Ryngaert A Hausner M Springael D Govers HAJ Wuertz S amp
Parson JR 2005 Effect of bioaugmentation and supplementary carbon sources on
Referencias bibliograacuteficas
190
egradation of polycyclic aromatic hydrocarbons by a soil-derived culture FEMS
Microbiol Ecol 55 122-135
Internacional Agency for Research on Cancer 1972-1990 Monographs on the evaluation of
carcinogenics risks on human International Agency for Research on Cancer Lyons
France
Johnsen A amp Karlson U 2005 PAH degradation capacity of soil microbial communities-does
it depend on PAH exposure Microbial Ecol 50 488ndash495
Johnsen AR Wick LY amp Harms H 2005 Principles of microbial PAH-degradation in soil
Environ Pollut 133 71-84
Johnsen AR Lipthay JR Sorensen SJ Ekelund F Christensen P Andersen O
Karlson U amp Jcobsen CS 2006 Microbial degradation of street dust polycyclic
aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil
Environ Microbiol 8535-545
Jing W Hongke X amp Shaohui G 2007 Isolation and characterization of a microbial
consortium for effectively degrading phenanthrene Pet Sci 4 68-75
Jukes TH amp Cantor CR 1969 Evolution of protein molecules Pp 21-132 in Munro HN ed
Mammalian protein metabolism Academic Press New York
Kanaly RA amp Harayama S 2000 Biodegradation of high molecular weight polycyclic
aromatic hydrocarbons by bacteria J Bacteriol 182 2059-2067
Kaumlstner M Breueer-Jammali M amp Mahro B 1998 Impact of inoculation protocols salinity
and pH on the degradation of polycyclic aromatic hydrocarbons (PAHs) and survival
of PAH-degrading bacteria introduced into soil Appl Environ Microbiol 64 359-362
Kim Y H Freeman J P Moody J D Engesse K H amp Cerniglia C E 2005 Effects of pH
on the degradation of phenanthrene and pyrene by Mycobacterium vanbaalenii
PYR-1 Appl Environ Microbiol 67 275ndash285
Koeber R Bayona JM amp Niessner R 1999 Determination of benzene[a]pyrene diones in
air particulates matter with liquid chromatography mass spectrometry Environ Sci
Technol 33 1552-1558
Laha S amp Luthy RG 1991 Inhibition of phenantrene mineralization by nonionic surfactants
in soil-water systems Environ Sci Technol 25 1920-1930
Leahy JG amp Colwell RR 1990 Microbial degradation of hydrocarbons in the environment
Microbiol Mol Biol R 54 305-315
Lee ML Novotny MV amp Bartle KD 1981 Analytical chemistry of polycyclic aromatic
hydrocarbons Academic Press Inc New York NY
Lee K Park J-W amp Ahm I-S 2003 Effect of additional carbon source on naphthalene
biodegrdation by Pseudomonas putida G7 J Hazard Mater 105 157-167
Referencias bibliograacuteficas
191
Leys MN Bastiaens L Verstraete W amp Springael D 2005 Influence of the
carbonnitrogenphosphorus ratio on polycyclic aromatic hydrocarbons degradation by
Mycobacterium and Sphingomonas in soil Appl Microbiol Biotechnol 66 726-736
Lim LH Harrison RM amp Harrad S 1999 The contribution of traffic to atmospheric
concentration of polycyclic aromatic hydrocarbons Environ Sci Technol 33 3538-
3542
Liu Y Zhu L amp Shen X 2001 Polycyclic aromatic hydrocarbons in indoor and outdoor air of
Hangzhou China Environ Sci Technol 35 840-844
Maier MR 2009 Bacterial growth In MR Maier LI Pepper and PC Gerba (Eds)
Environmental Microbiology (pp 37-54) New York Academic Press
Maliszewska-Kordybach B 1996 Polycyclic aromatic hydrocarbons in agricultural soils in
Poland preliminary proposals for criteria to evaluate the level of soil contamination
Appl Geochem 11 212-127
Margesin R amp Schinner F 2001 Bioremediation (natural attenuation and biostimulation) of
diesel-oil contaminated soil in alpine glacier skiing area Appl Environ Microbiol 67
3127-3133
Margesin R Zacke G amp Schinner F 2002 Characterization of heterotrophic
microorganisms in alpine glacier cryoconite Arct Antarct Alp Res 3488ndash93
Margesin R Gander S Zacke G Gounot AM amp Schinner F 2003 Hydrocarbon
degradation and enzyme activities of cold-adapted bacteria and yeasts
Extremophiles 7451ndash458
Martiacuten Guirao L 2007 Aproximacioacuten ecotoxicoloacutegica a la contaminacioacuten por metales
pesados en la laguna costera del Mar Menor Tesis doctoral Universidad de Murcia
Murcia
Menn F-M Applegate BM amp Sayler GS 1993 NAH-plasmid mediated catabolisms of
anthracene and phenanthrene to naphtoic acids Appl Environ Microbiol 59 1938-
1942
Meulenberg R Rijnaarts HHM Doddema HJ amp Field A 1997 Partially oxidized polycyclic
aromatic hydrocarbons show an increased bioavailability and biodegradability FEMS
Microbiol 152 45-49
Microbics Corporaion 1992 Microtox manual vol III condensed protocols A toxicity tested
handbook Microbics Corporation Carslbad
Mills MA Bonner JS Page CA amp Autenrieth RL 2004 Evaluation of bioremediation
strategies of a controlled oil release in a wetland Marine Pollut Bull 49 425-435
Mohn W amp Stewart RG 2000 Limiting factors for hydrocarbon biodegradation at low
temperatures in Artic soils Soil Biol Biochem 32 1161-1172
Referencias bibliograacuteficas
192
Molina MC Gonzaacutelez N Bautista LF Sanz R Simarro R Saacutenchez I amp Sanz JL 2009
Isolation and genetic identification of PAH degrading bacteria from a microbial
consortium Biodegradation 20 789-800
Mueller JG Chapman PJ Blattman BO amp Pritchard PH 1990 Isolation and
characterization of a fluoranthene-utilizing strain of Pseudomonas paucimobilis Appl
Environ Microbiol 56 1079-1086
Mueller JG Devereux R Santavy DL Lantz SE Willis SG amp Pritchard PH 1997
Phylogenetic and Physiological comparisions of PAH-degrading bacteria from
geographically diverse soils A van Leeuw J Microb 71 329-343
Nannipieri P Ascher J Ceccherini MT Landi L Pietramellara G amp Renella G 2003
Microbial diversity and soil functions European J Soil Sci 54 655-670
Okpokwasili GC Somerville CC Grimes DJ amp Colwell RR 1986 Plasmid-associated
phenanthrene degradation by Chesapeake Bay sediment bacteria A Colloq Inst
Fran Rech Exploit Mer 3 601ndash610
Pelz O Tesar M Wittich RM Moore ERB Timmis KN Abraham WR 1999 Towards
elucidation of microbial community metabolic pathways unrevealing the network of
carbon sharing in a pollutant-degrading bacterial consortium by immunocapture and
isotopic ratio mass spectrometry Environ Microbiol 1167ndash174
Portaels F amp Pattyn SR 1982 Growth of mycobacteria in relation to the pH of the medium
Ann Microbiol 133 213-221
Puntus IF Filonov AE Akhmetov LI Karpov AV amp Boronin AM 2008 Phenanthrene
degradation by bacteria of the genera Pseudomonas and Burkholderia in model soil
systems Microbiology 77 7-15
Rastogi G Muppidi GL Gurram RN Adhikari A Bischoff KM Hughes SR Apel WA
Bang SS Dixon DJ amp Sani RK 2009 Isolation and characterization of cellulose-
degrading bacteria from the deep subsurface of the Homestake gold mine Lead
South Dakota USA J Ind Microbiol Biotechnol 36 585-598
Readman J W Fillmann G Tolosa I Bartocci J Villeneuve J -P Catinni C amp Mee L D
2002 Petroleum and PAH contamination of the Black Sea Marine Pollut Bull 44
48-62
Rolling Willfred FM Milner MG Jones DM Lee K Danniel F Swanell Richard JP amp
Head IM 2002 Robust hydrocarbons degradation and dynamics of bacterial
communities during nutrients-enhanced oil spill bioremediation Appl Environ
Microbiol 68 5537-5548
Rosenberg E amp Ron EZ 1999 High ndash and low- molecular mass microbial surfactant Appl
Microiol Biotechnol 52 154-162
Referencias bibliograacuteficas
193
Santos E C Jacques R J S Bento F M Peralba M-C R Selbach PA Saacute E L S
Camargo FAO 2008 Anthracene biodegradation and surface activity by an iron-
stimulated Pseudomonas sp Bioresource Technol 99 2644-2649
Schlessinger WH 1991 Biogeochemistry Academic Press San Diego
Shuttleworth KL amp Cerniglia E 1995 Environmental aspect of PAH biodegradation Appl
Biochem Biotechnol 54 291-302
Soberon-Chavez G Lepine F amp Deziel E 2005 Production of rhamnolipids by
Pseudomonas aeruginosa Appl Microbiol Biotechnol 68 718-725
Soriano JA Vintildeas MA Franco JJ Gonzaacutelez JM amp Albaigeacutes J 2006 Spatial and
temporal trends of petroleum hydrocarbons in wild mussels from the Galician coast
(NW Spain) affected by the Prestige oil spill Sci Total Environ 370 80-90
Spain JC amp vanVeld PA 1983 Adaptation of natural microbial communities to degradation
of xenobiotic compounds-effects of concentration exposure time inoculum and
chemical structure Appl Microbiol 45428-435
Swofford DL 2003 PAUP Phylogenetic analysis using parsimony (and another methods)
version 40b 10 Sinauer Associates Sunderland
Szaboacute KE Itor POB Bertilsson STranvik L amp Eiler A 2007 Importance of rare and
abundant populations for the structure and functional potential of freshwater bacterial
communities Aquat Microb Ecol 47 1-10
Tian L Ma P amp Zhong J-J 2003 Impact of presence of salicylate or glucose on enzyme
activity and phenanthrene degradation by Pseudomonas mendocina Process
Biochem 38 1125-1132
Tian Y Luo Y Zheng T Cai L Cao X amp Yan C 2008 Contamination and potential
biodegradation of polycyclic aromatic hydrocarbons in mangrove sediments of
Xiamen China Marine Pollut Bull56 1184-1191
Toledo FL Calvo C Rodelas B amp Gonzaacutelez-Loacutepez J 2006 Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons
removal capacities Syst Appl Microbiol 29 244-252
Torres LG Rojas N Bautista G amp Iturbe R 2005 Effect of temperature and surfactantacutes
HLB and dose over the TPH-diesel biodegradation process in aged soils Process
Biochem 40 3296-3302
Viejo RM 2009 Resilience in intertidal rocky shore assemblages across the stress gradient
created by emersion times Marine Ecol-Prog Ser 390 55-65
Vintildeas M Sabateacute J Espuny MJ amp Solanas AM 2005 Bacterial community dynamics and
polycyclic aromatic hydrocarbon degradation during bioremediation of heavily
creosote-contaminated Soil App Environ Microbiol 71 7008-7018
Wagrowski DM amp Hites RA 1997 Polycyclic aromatic hydrocarbons accumulation in urban
suburban and rural vegetation Environ Sci Technol 31 279-282
Referencias bibliograacuteficas
194
Wei Y-H Wang LF Chang JS amp Kung SS 2003 Identification of induced in iron enriched
cultures of Bacilus subtilis during biosurfactant fermentation J Biosci Bioeng 96
174-178
Wong JWC Lai KM Wan CK amp Ma KK 2000 Isolation and optimization of PAHs-
degradative bacteria from contaminated soil for PAHs bioremediation Water Air Soil
Pollut 139 1-13
Wu SC amp Gschwend PM 1986 Sorption kinetics of hydrophobic organic compounds to
natural sediments and soil Environ Sci Technol 20 717-725
Ye B Siddigi MA Maccubbin AE Kumar S amp Sikka HC 1996 Degradation of
polynuclear aromatic hydrocarbons by Sphyngomonas paucimobilis Environ Sci
Technol 30136-142
Yu KSH Wong AHY Yau KWY Wong YS amp Tam NFY 2005 Natural attenuation
biostimulation and bioaugmentation on biodegradation of polycyclic aromatic
hydrocarbons (PAH) in mangrove sediments Marine Pollut Bull 51 1071-1077
Zender M 1983 Physical and chemical properties of polycyclic aromatic hydrocarbons p 1-
26 In ABjorseth (ed) Handbook of polycyclic aromatic hydrocarbons Marcel
Dekker Inc New York NY
Zhang XX Cheng SP Zhu CJ amp Sun SL 2006 Microbial PAH-degradation in soil
degradation pathways and contributing factors Pedosphere 16 555-565
Zhang Z Gai L Hou Z Yang C Ma C Wang Z Sun B He X Tang H amp Xu P 2010
Characterization and biotechnological potential of petroleum-degrading bacteria
isolated from oil-contaminated soils Bioresource Technol 101 8452ndash8456
Agradecimientos
197
Agradecimientos
Todaviacutea recuerdo el primer diacutea que entre en el departamento en el laboratorio
aquello me parecioacute todo un mundo en el cual sin quererlo y sin estar convencida de
ello acabeacute metida de lleno Poco a poco fueron pasando los meses los antildeos
presenteacute el Practicum y me diacute cuenta de que queriacutea seguir adelante Unos cuantos
antildeos despueacutes he llegado a la meta lo cual no hubiera sido posible sin mucha gente
que me ha apoyado ayudado y empujado en los momentos en los que yo no podiacutea
maacutes A todos ellos gracias por hacer que esto haya sido posible
El primero de mis agradecimientos va dirigido a Natalia Fernando y Mari
Carmen Os tengo que dar las gracias por brindarme la oportunidad de formar parte
del grupo y por tantas cosas que con cada uno de vosotros he aprendido Despueacutes
de estos antildeos creo que hemos conseguido cosas maravillosas aunque hayamos
tenido imprevistos de todo tipo porque como ya sabemos si ponemos un circo nos
crecen los enanoshellippero aquiacute estamos Somos un grupo muy equilibrado
profesionalmente tenemos un poco de todo y por otro lado no es mal balance tres
histeacutericas frente a uno que pone la calma no se como no hemos acabado contigo
Fernando Natalia gracias por hacerme controlar el miura que llevo dentro y tener
tanta paciencia Carmen gracias por estar siempre ahiacute ya sea desde Espantildea desde
el otro lado del charco o nada mas ser mamaacute En todo momento a nivel personal y
profesional me he sentido arropada por vosotros gracias por vuestro apoyo y ganas
de seguir adelante Vosotros habeis sido los responsables de que quiera investigar
Si una persona en concreto se merece especial agradecimiento es mi Yoli
Aunque al principio de todo no nos conociacuteamos no hay mas que vernos ahora Por
un lado ha sido imprescindible la ayuda que me has dado trabajando cuando maacutes
perdida estaba Por todo tu apoyo ten presnete que me has ayudado a escribir cada
una de las liacuteneas que has leiacutedo Has sabido ser mi amiga y estar conmigo cuando
maacutes lo he necesitado y hacer que me olvidara de todo ya sea haciendo toriijas
pizzas viendo una peli tomando una copichuela o con nuestros preciados pinchitos
sobre todo estos uacuteltimos meses estresantes en los que no seacute como no te he vuelto
loca Gracias tambieacuten por hacerme reir hasta llorar por preocuparte cada diacutea de
198
estas uacuteltimas semanas de coacutemo voy por conocerte todas y cada una de las cosas
en las que estoy trabajando y un largo etc Te conoces mejor yo el estado de cada
uno de mis artiacuteculos las correcciones que tengo y las que me faltan Eres estupenda
y espero no dejar de descubrir nunca cosas sobre ti Mil gracias
Son muchas las personas que han pasado por el despacho Pepe aunque
estas muy muy lejos agardezco tu ayuda continua sobre todo en el Maacutester la mitad
de las cosas se me hubieran olvidado si no hubiera sido por ti que cabeza la miacutea
Tambieacuten tengo que recordar a Raquel Felipe y Cris el antiguo equipo Ecotox
pasamos muy buenos ratos que se echan de menos A mis actuales compantildeeros
Alfredo Pesca Julia Silvia y Carlos que aunque no estas en el despacho como si lo
estuvieras Gracias por amenizar las horas de laboratorio y los madrugones Silvia
especialmente a ti gracias por sacar siempre un rato para charlar y escucharnos
mutuamente aunque nos separen un porroacuten de cajas y un poto gigante ahiacute estas
siempre Espero seguir aquiacute mucho tiempo para apoyarte igual que tuacute lo has hecho
conmigo Cris no me olvido de ti que desde el principio y hasta ahora te has
preocupado de saber que tal me iba estabas al tanto de todo y me has animado a
seguir adelante Te deseo que las cosas te vayan genial porque te lo mereces
asique aacutenimo que no es por presionar pero en breve te toca a tiacute Me faltan palabras
para contar todo lo que Moacutenica y Andrea me han ayudado y ensentildeado desde un
primer momento Igualmente agredezco el apoyo que Patri y Ester me han dado al
igual que los buenos ratos cotilleando imprescindibles Tambieacuten tengo que
agradecer a Jose Luis Sanz de la Universidad Autoacutenoma de Madrid que me abriera
las puertas de su laboratorio para aprender la maravillosa teacutecnica del DGGE y unas
cuantas cosas maacutes Ine a tiacute si que te agradezco un montoacuten las horas que has
perdido de tu trabajo para ensentildearme Desde un primer momento simpre con la
sonrisa puesta auacuten sin concocerme de nada Han sido muchos los viajes que he
hecho y el tiempo empleado en ello pero ha merecido la pena Asique igualmente
formas parte de esta tesis porque cada uno de los artiacuteculos no hubieran estado
completos sin tu ayuda
Son muchas las personas que sin formar parte del gremio han estado siempre
presentes Mis padres y mi hermano ya sabeis que no podriacutea hacer nada sin
vosotros a mi lado Durante estos antildeos no habeis dejado de preocuparos por mi y de
apoyarme ni un solo instante maacutes auacuten cuando las cosas han sido tan complicadas
199
para miacute Nada hubiera salido bien sin vosotros una vez maacutes os doy las gracias por
ser tan maravillosos y por teneros Por otro lado mis amigos ellos si que andan
agenos al tema y sin embargo siempre han sabido cuando preguntar y que palabras
usar cuando mas lo he necesitado Tengo que hacer una mencioacuten especial al sentildeor
Jimmy (responsable graacutefico y de disentildeo de la tesis) a ti si que te ha caiacutedo una
buena desde aquella llamada en la que te dije ldquoha llegado el momentordquo A
parte del gran trabajo que has hecho vistiendo la tesis tuacute una de las personas maacutes
sosegadas que conozco has podido aguantar el histerismo de los diacuteas previos a
depositar la tesis Gracias Jimmy eres un sol pero que sepas que auacuten me queda la
defensa oacutesea presentacioacuten en power pointhellipyo no digo nada Tambieacuten
agaradezco al ldquogrupo parkeeerdquo las horas que pasamos en las cuales a parte de
mucho friacuteo tambieacuten pasamos muy buenos ratos Especialmente a Lauri gracias por
acercarte un buen diacutea y preguntarme iquesttodo bien Desde entonces tus achuchones
tus canciones y tu ldquoflower powerrdquo han hecho que me despeje cada tarde Gracias
tambieacuten por interesarte tanto por mi trabajo dentro de poco te lo podreacute presentar
Las uacuteltimas palabras van dirigidas a Javi A ti que has estado conmigo desde el
principio gracias por no dejar que me desquicie y darme siempre tranquilidad Son
muchas las horas que he dedicado a esto y siempre has estado recordaacutendome
cuando era el momeno de parar Gracias por saber comprender lo que hago aunque
a veces me queje tanto y por ayudarme a echarle un par de narices cuando maacutes
desanimada estaba Gracias por hacer que este mundo roto no estropee mi sonrisa
Todo el tiempo que no te he dedicado lo recuperaremos juntos en nuestra casa
A todos y cada uno de vosotros gracias
Raquel